Starting /dee2/code/volunteer_pipeline.sh SRR7230771 current disk space = 3057329803264 free memory = 1472352200 SRR7230771 SRAfilesize d0cad0bc3a7a591e0c76499dd4313845 SRR7230771.sra SRR7230771.sra file validated SRR7230771 is paired end SRR7230771 is conventional basespace SRR7230771 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230771_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2865 34.0 33.0 34.0 33.0 34.0 2 33.35875 34.0 33.0 34.0 33.0 34.0 3 33.43775 34.0 33.0 34.0 33.0 34.0 4 33.4135 34.0 34.0 34.0 33.0 34.0 5 33.36075 34.0 33.0 34.0 33.0 34.0 6 37.15375 38.0 37.0 38.0 36.0 38.0 7 37.4215 38.0 38.0 38.0 37.0 38.0 8 37.54075 38.0 38.0 38.0 38.0 38.0 9 37.4225 38.0 38.0 38.0 38.0 38.0 10-14 37.51514999999999 38.0 38.0 38.0 38.0 38.0 15-19 37.3996 38.0 38.0 38.0 37.6 38.0 20-24 37.2512 38.0 38.0 38.0 36.8 38.0 25-29 37.35055 38.0 38.0 38.0 37.6 38.0 30-34 37.41575 38.0 38.0 38.0 37.2 38.0 35-39 37.27290000000001 38.0 38.0 38.0 36.8 38.0 40-44 36.6837 38.0 38.0 38.0 34.8 38.0 45-49 37.05545 38.0 38.0 38.0 36.0 38.0 50-54 37.2248 38.0 38.0 38.0 36.8 38.0 55-59 37.083600000000004 38.0 38.0 38.0 36.2 38.0 60-64 37.0849 38.0 38.0 38.0 36.0 38.0 65-69 37.0349 38.0 38.0 38.0 36.0 38.0 70-74 30.828449999999997 38.0 21.4 38.0 15.4 38.0 75-79 31.694049999999997 38.0 32.0 38.0 4.4 38.0 80-84 34.4911 38.0 36.6 38.0 25.4 38.0 85-89 36.0344 38.0 37.6 38.0 32.2 38.0 90-94 36.15325 38.0 37.8 38.0 33.0 38.0 95-99 36.25455 38.0 38.0 38.0 33.8 38.0 100-104 36.2521 38.0 37.8 38.0 33.8 38.0 105-109 36.28995 38.0 37.8 38.0 33.8 38.0 110-114 34.60935 37.8 34.8 38.0 25.0 38.0 115-119 34.3247 37.8 33.6 38.0 24.8 38.0 120-124 34.97645 38.0 35.4 38.0 27.6 38.0 125-129 34.16415 38.0 34.4 38.0 22.8 38.0 130-134 34.37485 38.0 34.6 38.0 24.6 38.0 135-139 33.52230000000001 37.8 33.6 38.0 21.0 38.0 140-144 33.94235 38.0 34.2 38.0 23.0 38.0 145-149 33.11129999999999 38.0 33.6 38.0 17.4 38.0 150-151 28.82375 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 2.0 12 0.0 13 2.0 14 1.0 15 0.0 16 4.0 17 1.0 18 2.0 19 4.0 20 5.0 21 6.0 22 11.0 23 18.0 24 13.0 25 23.0 26 28.0 27 28.0 28 30.0 29 50.0 30 92.0 31 86.0 32 129.0 33 193.0 34 317.0 35 459.0 36 930.0 37 1565.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.900000000000006 16.75 10.4 32.95 2 20.849999999999998 21.15 34.975 23.025000000000002 3 18.9 28.15 26.85 26.1 4 22.6 34.825 22.75 19.825 5 21.3 36.225 24.125 18.35 6 16.925 36.449999999999996 25.124999999999996 21.5 7 13.0 23.150000000000002 43.75 20.1 8 17.325 21.9 31.275 29.5 9 17.95 23.225 32.1 26.724999999999998 10-14 20.006000300015 28.926446322316117 26.711335566778338 24.356217810890545 15-19 19.805 28.854999999999997 28.025 23.315 20-24 19.98 28.310000000000002 28.17 23.54 25-29 19.738882497123704 28.467810514731628 28.207693462057925 23.58561352608674 30-34 19.725 28.95 27.755000000000003 23.57 35-39 20.507050705070505 28.797879787978797 27.762776277627765 22.932293229322934 40-44 20.08814543997596 28.326739119547252 27.740772274252517 23.84434316622427 45-49 19.91 28.1 27.810000000000002 24.18 50-54 20.02 28.785 27.595 23.599999999999998 55-59 20.19908959031564 28.422790255615027 27.967585413436048 23.410534740633285 60-64 20.294132359561804 28.39277674953729 27.90255615026762 23.410534740633285 65-69 20.51512878219555 28.162040510127532 27.80195048762191 23.520880220055012 70-74 19.427719821162444 28.315946348733235 27.672131147540984 24.584202682563337 75-79 20.155215704177127 28.29833371376398 27.955946131020315 23.590504451038576 80-84 20.225840336134453 28.13550420168067 27.673319327731093 23.965336134453782 85-89 20.564414708989386 28.22073544946929 27.59193118366115 23.622918657880177 90-94 20.073029211684673 28.156262505002 28.101240496198482 23.669467787114844 95-99 20.05200520052005 28.012801280128013 28.04280428042804 23.89238923892389 100-104 20.292102235782526 27.984794678137348 27.97979292752463 23.743310158555495 105-109 20.945 28.715000000000003 27.185 23.155 110-114 20.846042302115105 27.806390319515977 27.771388569428474 23.576178808940448 115-119 21.01710171017102 28.73287328732873 26.642664266426642 23.607360736073606 120-124 21.400330313798108 28.116710875331563 27.29092638006106 23.19203243080927 125-129 20.724999999999998 28.28 27.395000000000003 23.599999999999998 130-134 21.32 28.194999999999997 26.640000000000004 23.845 135-139 21.26 28.08 26.795 23.865 140-144 21.475 28.265 27.07 23.189999999999998 145-149 21.699339867973595 28.42068413682737 26.06521304260852 23.814762952590517 150-151 20.375 28.762500000000003 26.950000000000003 23.9125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 1.0 16 1.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.5 22 2.0 23 4.0 24 6.0 25 6.5 26 9.0 27 12.5 28 19.5 29 23.5 30 25.5 31 37.5 32 49.5 33 59.5 34 75.0 35 98.0 36 108.0 37 115.5 38 154.0 39 184.5 40 198.5 41 212.5 42 254.5 43 274.0 44 239.5 45 241.5 46 254.0 47 235.5 48 220.0 49 183.0 50 138.5 51 122.5 52 105.0 53 83.0 54 63.5 55 47.5 56 30.0 57 19.0 58 20.0 59 18.5 60 11.5 61 8.5 62 6.0 63 4.0 64 4.0 65 2.0 66 1.5 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.045 30-34 0.0 35-39 0.01 40-44 0.165 45-49 0.0 50-54 0.0 55-59 0.045 60-64 0.045 65-69 0.025 70-74 16.125 75-79 12.379999999999999 80-84 4.8 85-89 0.605 90-94 0.04 95-99 0.01 100-104 0.034999999999999996 105-109 0.0 110-114 0.005 115-119 0.01 120-124 0.095 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.02 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49723479135244 98.95 2 0.47762694821518353 0.95 3 0.0 0.0 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.6000000000000001 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.2625000000000002 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.625 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114-115 2.3625 0.0 0.0 0.0 0.0 116-117 2.5250000000000004 0.0 0.0 0.0 0.0 118-119 2.9375 0.0 0.0 0.0 0.0 120-121 3.2375 0.0 0.0 0.0 0.0 122-123 3.5375 0.0 0.0 0.0 0.0 124-125 4.025 0.0 0.0 0.0 0.0 126-127 4.325 0.0 0.0 0.0 0.0 128-129 4.7125 0.0 0.0 0.0 0.0 130-131 5.1625 0.0 0.0 0.0 0.0 132-133 5.7125 0.0 0.0 0.0 0.0 134-135 6.2 0.0 0.0 0.0 0.0 136-137 6.6625 0.0 0.0 0.0 0.0 138-139 7.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTAGTC 10 0.007482115 140.65001 2 TAGTCAT 10 0.007482115 140.65001 4 CTAGTCA 10 0.007482115 140.65001 3 >>END_MODULE SRR7230771 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230771_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82825 33.0 33.0 34.0 32.0 34.0 2 32.98375 34.0 33.0 34.0 32.0 34.0 3 32.947 34.0 33.0 34.0 32.0 34.0 4 32.92375 34.0 33.0 34.0 32.0 34.0 5 32.89175 34.0 33.0 34.0 32.0 34.0 6 36.77525 38.0 38.0 38.0 36.0 38.0 7 36.866 38.0 38.0 38.0 36.0 38.0 8 36.676 38.0 38.0 38.0 36.0 38.0 9 36.746 38.0 38.0 38.0 36.0 38.0 10-14 36.7972 38.0 38.0 38.0 36.0 38.0 15-19 36.888149999999996 38.0 38.0 38.0 36.2 38.0 20-24 36.85195 38.0 38.0 38.0 36.4 38.0 25-29 36.78685 38.0 38.0 38.0 36.2 38.0 30-34 36.730199999999996 38.0 38.0 38.0 35.8 38.0 35-39 36.380449999999996 38.0 38.0 38.0 34.4 38.0 40-44 36.2379 38.0 38.0 38.0 33.8 38.0 45-49 36.678 38.0 38.0 38.0 36.0 38.0 50-54 36.63185 38.0 38.0 38.0 35.6 38.0 55-59 36.142 38.0 38.0 38.0 33.4 38.0 60-64 36.472500000000004 38.0 38.0 38.0 34.6 38.0 65-69 36.132799999999996 38.0 38.0 38.0 34.4 38.0 70-74 36.11155 38.0 38.0 38.0 33.8 38.0 75-79 36.3966 38.0 38.0 38.0 34.6 38.0 80-84 36.313900000000004 38.0 38.0 38.0 34.2 38.0 85-89 36.288799999999995 38.0 38.0 38.0 34.2 38.0 90-94 36.21 38.0 38.0 38.0 34.0 38.0 95-99 35.6668 38.0 37.2 38.0 31.2 38.0 100-104 35.650999999999996 38.0 37.8 38.0 31.8 38.0 105-109 35.063900000000004 38.0 36.6 38.0 26.4 38.0 110-114 35.48435 38.0 37.0 38.0 30.8 38.0 115-119 35.45100000000001 38.0 37.0 38.0 31.0 38.0 120-124 35.20985 38.0 36.8 38.0 29.6 38.0 125-129 34.88785 38.0 36.0 38.0 27.6 38.0 130-134 34.742149999999995 38.0 36.0 38.0 27.2 38.0 135-139 34.35549999999999 38.0 35.2 38.0 24.4 38.0 140-144 33.8193 38.0 34.0 38.0 22.6 38.0 145-149 32.80005 38.0 33.0 38.0 13.8 38.0 150-151 26.851750000000003 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 9.0 4 5.0 5 4.0 6 2.0 7 4.0 8 2.0 9 2.0 10 2.0 11 1.0 12 3.0 13 5.0 14 4.0 15 2.0 16 12.0 17 8.0 18 6.0 19 8.0 20 8.0 21 10.0 22 9.0 23 22.0 24 16.0 25 22.0 26 17.0 27 28.0 28 28.0 29 35.0 30 49.0 31 68.0 32 83.0 33 114.0 34 148.0 35 260.0 36 602.0 37 2393.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.550000000000004 19.6 13.625000000000002 26.224999999999998 2 24.474999999999998 24.625 34.1 16.8 3 19.3 28.249999999999996 31.900000000000002 20.549999999999997 4 23.799999999999997 35.175 22.675 18.35 5 22.375 39.074999999999996 21.575 16.975 6 18.65 37.225 23.5 20.625 7 18.125 18.8 41.225 21.85 8 19.85 23.549999999999997 28.525 28.075 9 20.8 24.55 30.075000000000003 24.575 10-14 23.0 28.395 26.174999999999997 22.43 15-19 22.935 27.725 28.16 21.18 20-24 22.895 28.365000000000002 27.815 20.925 25-29 22.869999999999997 28.49 27.689999999999998 20.95 30-34 22.81 27.455000000000002 28.95 20.785 35-39 22.615176829573308 27.592416587464356 28.68290730828873 21.109499274673603 40-44 23.192319231923193 28.02280228022802 27.567756775677566 21.217121712171217 45-49 23.04845726859029 28.274241136170424 27.69415412311847 20.98314747212082 50-54 22.575 28.735 27.41 21.279999999999998 55-59 22.904522613065325 28.56281407035176 27.48241206030151 21.050251256281406 60-64 22.98229822982298 27.51775177517752 28.237823782378236 21.26212621262126 65-69 23.03886925795053 27.647652700656234 28.273599192327108 21.039878849066127 70-74 22.972360670593567 27.47319136082163 28.339122992498616 21.21532497608619 75-79 23.365 27.584999999999997 28.07 20.979999999999997 80-84 23.301310917642347 28.43490443310317 27.769438607024917 20.494346042229562 85-89 23.1 28.084999999999997 27.944999999999997 20.87 90-94 23.75 27.705000000000002 27.744999999999997 20.8 95-99 22.869999999999997 28.575 27.900000000000002 20.655 100-104 22.89 27.375 28.189999999999998 21.545 105-109 23.14 27.884999999999998 28.18 20.794999999999998 110-114 23.89 27.825 27.925 20.36 115-119 24.279999999999998 27.88 27.6 20.24 120-124 23.965 28.03 27.815 20.19 125-129 24.385 28.065 27.1 20.45 130-134 24.865000000000002 27.584999999999997 27.389999999999997 20.16 135-139 24.897489748974895 27.63776377637764 27.607760776077605 19.856985698569858 140-144 24.70864802680938 28.22487870754764 26.924423548241883 20.14204971740109 145-149 25.66 28.22 26.68 19.439999999999998 150-151 25.825 28.787499999999998 26.900000000000002 18.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.5 17 0.5 18 1.5 19 1.5 20 0.5 21 1.0 22 2.0 23 4.0 24 3.5 25 2.0 26 5.5 27 8.0 28 8.0 29 13.0 30 19.0 31 30.5 32 43.0 33 38.0 34 50.0 35 70.5 36 81.5 37 111.0 38 141.5 39 169.0 40 201.0 41 215.0 42 235.5 43 255.0 44 258.0 45 246.0 46 236.5 47 253.0 48 253.0 49 221.0 50 173.0 51 126.0 52 98.5 53 91.0 54 82.5 55 68.0 56 45.5 57 37.0 58 31.0 59 18.5 60 12.0 61 7.0 62 6.5 63 5.5 64 3.5 65 1.5 66 0.5 67 2.0 68 3.5 69 2.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.045 40-44 0.01 45-49 0.015 50-54 0.0 55-59 0.5 60-64 0.01 65-69 0.95 70-74 0.685 75-79 0.0 80-84 0.06999999999999999 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.034999999999999996 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24337957124843 98.375 2 0.6809583858764187 1.35 3 0.05044136191677175 0.15 4 0.0 0.0 5 0.025220680958385876 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.575 0.0 0.0 0.0 0.0 110-111 1.675 0.0 0.0 0.0 0.0 112-113 2.0375 0.0 0.0 0.0 0.0 114-115 2.3625 0.0 0.0 0.0 0.0 116-117 2.5250000000000004 0.0 0.0 0.0 0.0 118-119 2.975 0.0 0.0 0.0 0.0 120-121 3.2750000000000004 0.0 0.0 0.0 0.0 122-123 3.575 0.0 0.0 0.0 0.0 124-125 4.075 0.0 0.0 0.0 0.0 126-127 4.375 0.0 0.0 0.0 0.0 128-129 4.75 0.0 0.0 0.0 0.0 130-131 5.137499999999999 0.0 0.0 0.0 0.0 132-133 5.7125 0.0 0.0 0.0 0.0 134-135 6.2125 0.0 0.0 0.0 0.0 136-137 6.762499999999999 0.0 0.0 0.0 0.0 138-139 7.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 949578 spots for SRR7230771.sra Written 949578 spots for SRR7230771.sra Read 949578 spots for SRR7230771.sra Written 949578 spots for SRR7230771.sra Read 949578 spots for SRR7230771.sra Written 949578 spots for SRR7230771.sra Read 949578 spots for SRR7230771.sra Written 949578 spots for SRR7230771.sra Read 949578 spots for SRR7230771.sra Written 949578 spots for SRR7230771.sra Read 949578 spots for SRR7230771.sra Written 949578 spots for SRR7230771.sra Read 949578 spots for SRR7230771.sra Written 949578 spots for SRR7230771.sra Read 949578 spots for SRR7230771.sra Written 949578 spots for SRR7230771.sra Read 949578 spots for SRR7230771.sra Written 949578 spots for SRR7230771.sra Read 949578 spots for SRR7230771.sra Written 949578 spots for SRR7230771.sra Read 949578 spots for SRR7230771.sra Written 949578 spots for SRR7230771.sra Read 949578 spots for SRR7230771.sra Written 949578 spots for SRR7230771.sra Read 949578 spots for SRR7230771.sra Written 949578 spots for SRR7230771.sra Read 949578 spots for SRR7230771.sra Written 949578 spots for SRR7230771.sra Read 949594 spots for SRR7230771.sra Written 949594 spots for SRR7230771.sra Read 949578 spots for SRR7230771.sra Written 949578 spots for SRR7230771.sra Read 949578 spots for SRR7230771.sra Written 949578 spots for SRR7230771.sra Read 949578 spots for SRR7230771.sra Written 949578 spots for SRR7230771.sra Read 949578 spots for SRR7230771.sra Written 949578 spots for SRR7230771.sra Read 949578 spots for SRR7230771.sra Written 949578 spots for SRR7230771.sra SRR ids: ['SRR7230771.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3isucmlt SRR7230771.sra spots: 18991576 blocks: [[1, 949578], [949579, 1899156], [1899157, 2848734], [2848735, 3798312], [3798313, 4747890], [4747891, 5697468], [5697469, 6647046], [6647047, 7596624], [7596625, 8546202], [8546203, 9495780], [9495781, 10445358], [10445359, 11394936], [11394937, 12344514], [12344515, 13294092], [13294093, 14243670], [14243671, 15193248], [15193249, 16142826], [16142827, 17092404], [17092405, 18041982], [18041983, 18991576]] SRR7230771 file size 6413921 SRR7230771 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230771 SRR7230771_1.fastq SRR7230771_2.fastq Input file: SRR7230771_1.fastq Paired file: SRR7230771_2.fastq trimmed: SRR7230771-trimmed-pair1.fastq, SRR7230771-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:29:12 2025 >> started Tue Feb 11 00:29:32 2025 >> done (19.408s) 18991576 read pairs processed; of these: 28346 ( 0.15%) short read pairs filtered out after trimming by size control 27301 ( 0.14%) empty read pairs filtered out after trimming by size control 18935929 (99.71%) read pairs available; of these: 9290525 (49.06%) trimmed read pairs available after processing 9645404 (50.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 2 0.00% 21 2 0.00% 22 5 0.00% 23 4 0.00% 24 9 0.00% 25 6 0.00% 26 3 0.00% 27 7 0.00% 28 10 0.00% 29 6 0.00% 30 6 0.00% 31 12 0.00% 32 13 0.00% 33 10 0.00% 34 17 0.00% 35 7 0.00% 36 10 0.00% 37 24 0.00% 38 27 0.00% 39 18 0.00% 40 21 0.00% 41 28 0.00% 42 27 0.00% 43 38 0.00% 44 35 0.00% 45 47 0.00% 46 51 0.00% 47 79 0.00% 48 63 0.00% 49 90 0.00% 50 99 0.00% 51 105 0.00% 52 124 0.00% 53 158 0.00% 54 137 0.00% 55 170 0.00% 56 196 0.00% 57 204 0.00% 58 233 0.00% 59 283 0.00% 60 345 0.00% 61 339 0.00% 62 397 0.00% 63 425 0.00% 64 520 0.00% 65 590 0.00% 66 655 0.00% 67 768 0.00% 68 903 0.00% 69 1347 0.01% 70 1252 0.01% 71 1179 0.01% 72 1404 0.01% 73 1511 0.01% 74 1719 0.01% 75 1912 0.01% 76 2147 0.01% 77 2485 0.01% 78 2627 0.01% 79 2962 0.02% 80 3312 0.02% 81 3780 0.02% 82 4718 0.02% 83 4786 0.03% 84 6634 0.04% 85 7549 0.04% 86 7866 0.04% 87 8362 0.04% 88 8913 0.05% 89 9462 0.05% 90 10438 0.06% 91 10917 0.06% 92 11724 0.06% 93 12456 0.07% 94 13450 0.07% 95 14028 0.07% 96 14879 0.08% 97 15927 0.08% 98 16510 0.09% 99 17773 0.09% 100 18609 0.10% 101 19604 0.10% 102 20855 0.11% 103 21906 0.12% 104 23150 0.12% 105 24357 0.13% 106 25849 0.14% 107 26418 0.14% 108 27763 0.15% 109 29536 0.16% 110 30197 0.16% 111 32193 0.17% 112 33346 0.18% 113 34821 0.18% 114 36578 0.19% 115 38295 0.20% 116 39368 0.21% 117 40727 0.22% 118 42263 0.22% 119 43735 0.23% 120 45759 0.24% 121 47820 0.25% 122 49006 0.26% 123 51675 0.27% 124 53333 0.28% 125 55540 0.29% 126 57740 0.30% 127 59679 0.32% 128 61472 0.32% 129 64818 0.34% 130 66945 0.35% 131 68825 0.36% 132 72597 0.38% 133 76843 0.41% 134 79151 0.42% 135 83999 0.44% 136 87406 0.46% 137 93001 0.49% 138 97580 0.52% 139 103284 0.55% 140 109806 0.58% 141 119586 0.63% 142 128886 0.68% 143 143202 0.76% 144 163466 0.86% 145 190510 1.01% 146 231699 1.22% 147 305826 1.62% 148 447021 2.36% 149 852510 4.50% 150 4380607 23.13% 151 9645404 50.94% 18935929 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=4.03 fanout-score-rank=5 prefix-density=0.64 prefix-fanout=3.1 sequence=CCATTGCTTGCAATGGAAGTAATGTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=378.55 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=17.7 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCT criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=24 prefix-density=0.62 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=30.69 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.6 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACAACTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA SRR7230771 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:30:18 Started mapping on | Feb 11 00:30:18 Finished on | Feb 11 00:32:23 Mapping speed, Million of reads per hour | 545.35 Number of input reads | 18935929 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 17675090 Uniquely mapped reads % | 93.34% Average mapped length | 292.54 Number of splices: Total | 17333392 Number of splices: Annotated (sjdb) | 16929005 Number of splices: GT/AG | 16994878 Number of splices: GC/AG | 278169 Number of splices: AT/AC | 10243 Number of splices: Non-canonical | 50102 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 453375 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 127949 % of reads mapped to too many loci | 0.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.42% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 834678 834678 834678 N_multimapping 453375 453375 453375 N_noFeature 713575 17343710 862825 N_ambiguous 315411 1531 132191 UnstrandedReadsAssigned:16646104 PositiveStrandReadsAssigned:329849 NegativeStrandReadsAssigned:16680074 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7230771 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230771-trimmed-pair1.fastq SRR7230771-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,935,929 reads, 16,746,552 reads pseudoaligned [quant] estimated average fragment length: 237.021 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,019 rounds 52401 SRR7230771.ke.tsv 34699 SRR7230771.se.tsv 87100 total ==> SRR7230771.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.98 840 25.8756 Potri.005G024800.1.v4.1 1035 798.979 135 9.27496 Potri.004G059700.1.v4.1 961 725.091 7 0.529931 Potri.007G009000.2.v4.1 1416 1179.98 0 0 Potri.003G141000.2.v4.1 2943 2706.98 987 20.0146 Potri.016G087400.1.v4.1 270 85.3948 877 563.744 Potri.015G069301.1.v4.1 564 334.104 0 0 Potri.010G195200.1.v4.1 1773 1536.98 58 2.07145 Potri.012G127500.1.v4.1 977 741.02 25 1.85193 ==> SRR7230771.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 375 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 314 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7230771 completed mapping pipeline successfully