Starting /dee2/code/volunteer_pipeline.sh SRR7230772 current disk space = 3057434599424 free memory = 1156024456 SRR7230772 SRAfilesize baa56f029d85ce14e7dc92b800edbeae SRR7230772.sra SRR7230772.sra file validated SRR7230772 is paired end SRR7230772 is conventional basespace SRR7230772 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230772_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.86575 34.0 33.0 34.0 32.0 34.0 2 32.898 34.0 33.0 34.0 32.0 34.0 3 32.9565 34.0 33.0 34.0 32.0 34.0 4 33.0075 34.0 33.0 34.0 32.0 34.0 5 33.0635 34.0 33.0 34.0 32.0 34.0 6 36.813 38.0 37.0 38.0 35.0 38.0 7 37.164 38.0 38.0 38.0 36.0 38.0 8 37.24875 38.0 38.0 38.0 37.0 38.0 9 37.29875 38.0 38.0 38.0 37.0 38.0 10-14 37.3466 38.0 38.0 38.0 37.0 38.0 15-19 37.31855 38.0 38.0 38.0 37.0 38.0 20-24 37.1494 38.0 38.0 38.0 36.4 38.0 25-29 37.050200000000004 38.0 38.0 38.0 36.0 38.0 30-34 37.00105 38.0 38.0 38.0 36.0 38.0 35-39 37.0558 38.0 38.0 38.0 36.0 38.0 40-44 37.0472 38.0 38.0 38.0 36.0 38.0 45-49 37.00945 38.0 38.0 38.0 36.0 38.0 50-54 36.959 38.0 38.0 38.0 35.8 38.0 55-59 36.762600000000006 38.0 38.0 38.0 34.8 38.0 60-64 36.727599999999995 38.0 38.0 38.0 34.8 38.0 65-69 36.77315 38.0 38.0 38.0 34.6 38.0 70-74 36.187599999999996 38.0 37.6 38.0 32.8 38.0 75-79 36.42175 38.0 37.8 38.0 33.8 38.0 80-84 36.39145 38.0 38.0 38.0 33.8 38.0 85-89 36.245349999999995 38.0 37.8 38.0 33.4 38.0 90-94 36.019 38.0 37.0 38.0 32.6 38.0 95-99 35.82785 38.0 36.8 38.0 31.4 38.0 100-104 35.39555 38.0 36.8 38.0 29.0 38.0 105-109 34.784200000000006 38.0 35.6 38.0 25.2 38.0 110-114 35.306349999999995 38.0 36.0 38.0 28.6 38.0 115-119 35.0338 38.0 35.6 38.0 27.8 38.0 120-124 34.806 38.0 35.2 38.0 26.8 38.0 125-129 34.15555 38.0 34.4 38.0 23.4 38.0 130-134 33.8301 38.0 34.2 38.0 21.0 38.0 135-139 33.231449999999995 38.0 33.6 38.0 17.4 38.0 140-144 32.530100000000004 38.0 32.2 38.0 15.4 38.0 145-149 30.886400000000002 36.4 31.0 38.0 8.6 38.0 150-151 25.831125 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 1.0 15 1.0 16 3.0 17 4.0 18 3.0 19 2.0 20 3.0 21 11.0 22 9.0 23 18.0 24 17.0 25 25.0 26 24.0 27 43.0 28 49.0 29 57.0 30 78.0 31 99.0 32 119.0 33 164.0 34 251.0 35 386.0 36 782.0 37 1847.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.480519480519476 15.818181818181817 10.181818181818182 38.51948051948052 2 20.0 21.025 36.475 22.5 3 19.65982991495748 26.28814407203602 25.887943971985994 28.16408204102051 4 23.525 32.65 20.974999999999998 22.85 5 21.4 36.275 23.925 18.4 6 16.650000000000002 36.275 25.575 21.5 7 13.075000000000001 23.125 45.25 18.55 8 17.65 22.85 31.45 28.050000000000004 9 17.525 23.75 31.125000000000004 27.6 10-14 19.445 30.214999999999996 26.784999999999997 23.555 15-19 19.56 28.84 27.474999999999998 24.125 20-24 19.705000000000002 28.62 27.994999999999997 23.68 25-29 19.72 28.865000000000002 27.334999999999997 24.08 30-34 20.085 28.79 27.54 23.585 35-39 20.235 28.24 27.900000000000002 23.625 40-44 20.015 28.93 27.18 23.875 45-49 19.61 28.754999999999995 28.24 23.395 50-54 20.285 28.175 27.839999999999996 23.7 55-59 19.675 28.194999999999997 28.285 23.845 60-64 20.235 28.345 27.615000000000002 23.805 65-69 19.79 28.705000000000002 27.785 23.72 70-74 19.895 28.305000000000003 27.689999999999998 24.11 75-79 20.135 29.060000000000002 27.32 23.485 80-84 19.98198919351611 28.587152291374824 27.791675005003004 23.63918351010606 85-89 20.620364802565643 28.768290238524752 26.994387652836238 23.61695730607336 90-94 20.40785649864716 28.349534021445034 27.84347128970839 23.39913819019942 95-99 20.27 28.185 27.584999999999997 23.96 100-104 20.197960106516604 28.6640204994222 27.89529216701 23.242727227051198 105-109 19.961881833684423 27.796168121175647 27.89146353696459 24.350486508175344 110-114 20.625 28.16 27.655 23.56 115-119 20.84 28.485 27.27 23.405 120-124 20.54 28.025 27.839999999999996 23.595 125-129 20.605 28.395 27.665 23.335 130-134 20.76 27.97 27.150000000000002 24.12 135-139 20.945 27.965 26.93 24.16 140-144 21.21 28.144999999999996 26.96 23.685000000000002 145-149 21.299259851970394 29.370874174834967 26.26025205041008 23.06961392278456 150-151 21.025 28.499999999999996 26.737499999999997 23.7375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 1.5 23 1.5 24 3.0 25 4.5 26 6.5 27 11.5 28 11.0 29 15.0 30 21.5 31 31.5 32 47.5 33 53.5 34 63.5 35 76.5 36 96.5 37 136.0 38 148.0 39 161.0 40 191.0 41 205.0 42 247.0 43 253.0 44 225.5 45 244.5 46 254.5 47 231.0 48 217.0 49 192.5 50 163.0 51 144.0 52 117.0 53 102.0 54 88.0 55 67.0 56 46.5 57 35.0 58 23.5 59 12.5 60 14.0 61 10.5 62 4.5 63 5.0 64 3.5 65 1.0 66 2.0 67 2.0 68 0.5 69 1.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.75 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.06 85-89 0.22 90-94 0.21 95-99 0.0 100-104 0.485 105-109 0.31 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.02 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26915322580645 98.475 2 0.655241935483871 1.3 3 0.07560483870967742 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.5249999999999999 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.175 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.675 0.0 0.0 0.0 0.0 114-115 1.825 0.0 0.0 0.0 0.0 116-117 1.9500000000000002 0.0 0.0 0.0 0.0 118-119 2.25 0.0 0.0 0.0 0.0 120-121 2.5999999999999996 0.0 0.0 0.0 0.0 122-123 2.9625 0.0 0.0 0.0 0.0 124-125 3.175 0.0 0.0 0.0 0.0 126-127 3.4875 0.0 0.0 0.0 0.0 128-129 3.7874999999999996 0.0 0.0 0.0 0.0 130-131 4.2 0.0 0.0 0.0 0.0 132-133 4.4375 0.0 0.0 0.0 0.0 134-135 4.762499999999999 0.0 0.0 0.0 0.0 136-137 5.2125 0.0 0.0 0.0 0.0 138-139 5.612500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7230772 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230772_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.80675 33.0 33.0 34.0 32.0 34.0 2 32.90275 34.0 33.0 34.0 32.0 34.0 3 32.9595 34.0 33.0 34.0 32.0 34.0 4 32.81125 34.0 33.0 34.0 32.0 34.0 5 32.75825 34.0 33.0 34.0 32.0 34.0 6 36.837 38.0 38.0 38.0 36.0 38.0 7 36.858 38.0 38.0 38.0 36.0 38.0 8 36.94725 38.0 38.0 38.0 36.0 38.0 9 36.87725 38.0 38.0 38.0 36.0 38.0 10-14 36.38015 38.0 37.8 38.0 33.8 38.0 15-19 36.7315 38.0 38.0 38.0 35.6 38.0 20-24 36.69044999999999 38.0 38.0 38.0 35.6 38.0 25-29 36.699650000000005 38.0 38.0 38.0 35.6 38.0 30-34 36.33284999999999 38.0 38.0 38.0 33.8 38.0 35-39 36.5887 38.0 38.0 38.0 35.4 38.0 40-44 36.50385 38.0 38.0 38.0 34.8 38.0 45-49 36.41185 38.0 38.0 38.0 34.2 38.0 50-54 36.4821 38.0 38.0 38.0 34.8 38.0 55-59 36.602999999999994 38.0 38.0 38.0 35.0 38.0 60-64 36.48915000000001 38.0 38.0 38.0 34.8 38.0 65-69 36.445899999999995 38.0 38.0 38.0 34.6 38.0 70-74 36.06850000000001 38.0 38.0 38.0 33.0 38.0 75-79 36.205799999999996 38.0 38.0 38.0 34.0 38.0 80-84 36.139 38.0 38.0 38.0 33.8 38.0 85-89 36.06455 38.0 38.0 38.0 33.8 38.0 90-94 35.76035 38.0 37.8 38.0 32.0 38.0 95-99 35.7651 38.0 37.4 38.0 32.0 38.0 100-104 35.74300000000001 38.0 37.6 38.0 32.2 38.0 105-109 35.17115 38.0 36.8 38.0 28.2 38.0 110-114 35.2333 38.0 36.6 38.0 29.6 38.0 115-119 35.2152 38.0 36.6 38.0 29.8 38.0 120-124 34.948299999999996 38.0 36.2 38.0 28.2 38.0 125-129 34.265 38.0 35.4 38.0 23.4 38.0 130-134 33.48895 38.0 34.2 38.0 19.8 38.0 135-139 33.072 38.0 33.8 38.0 17.2 38.0 140-144 32.5362 38.0 32.4 38.0 13.8 38.0 145-149 31.64055 37.8 31.8 38.0 10.8 38.0 150-151 27.8155 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 8.0 4 3.0 5 2.0 6 2.0 7 1.0 8 1.0 9 3.0 10 4.0 11 5.0 12 3.0 13 3.0 14 3.0 15 2.0 16 5.0 17 6.0 18 11.0 19 12.0 20 10.0 21 6.0 22 15.0 23 21.0 24 29.0 25 32.0 26 16.0 27 34.0 28 38.0 29 42.0 30 57.0 31 67.0 32 93.0 33 140.0 34 182.0 35 318.0 36 679.0 37 2138.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.875 18.55 14.124999999999998 29.45 2 23.400000000000002 26.25 34.925 15.425 3 21.725 26.950000000000003 31.424999999999997 19.900000000000002 4 23.724999999999998 34.9 22.400000000000002 18.975 5 23.375 37.0 22.775000000000002 16.85 6 20.375 36.95 23.599999999999998 19.075 7 19.900000000000002 19.85 39.925 20.325 8 21.275 22.575 28.599999999999998 27.55 9 22.25 24.325 28.325 25.1 10-14 23.35 28.58 26.325 21.745 15-19 23.3 27.889999999999997 27.845 20.965 20-24 23.075000000000003 28.16 28.315 20.45 25-29 23.225 28.335 27.584999999999997 20.855 30-34 23.035 28.084999999999997 27.845 21.035 35-39 22.759999999999998 28.249999999999996 27.61 21.38 40-44 22.985 27.67 28.28 21.065 45-49 22.97 27.944999999999997 28.285 20.8 50-54 22.55 27.71 28.58 21.16 55-59 23.68 27.72 27.785 20.815 60-64 23.419999999999998 27.884999999999998 27.77 20.925 65-69 22.994999999999997 28.105000000000004 27.36 21.54 70-74 23.61 27.85 27.48 21.060000000000002 75-79 23.825 27.495000000000005 27.57 21.11 80-84 23.375 27.605 28.095 20.925 85-89 23.365 27.884999999999998 27.74 21.01 90-94 23.25 27.755000000000003 28.59 20.405 95-99 23.655 27.750000000000004 28.03 20.565 100-104 23.865 27.700000000000003 28.185 20.25 105-109 23.580000000000002 27.889999999999997 28.075 20.455000000000002 110-114 23.785 27.405 28.04 20.77 115-119 23.465 28.075 27.935 20.525 120-124 24.58 27.93 27.455000000000002 20.035 125-129 23.815 27.88 28.000000000000004 20.305 130-134 24.125 27.555000000000003 27.810000000000002 20.51 135-139 23.880000000000003 28.22 27.655 20.244999999999997 140-144 24.775 27.975 27.200000000000003 20.05 145-149 25.629999999999995 28.449999999999996 26.6 19.32 150-151 25.937500000000004 27.2625 26.637499999999996 20.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 2.0 19 2.0 20 0.0 21 0.0 22 1.0 23 3.0 24 2.5 25 3.0 26 4.5 27 4.5 28 6.5 29 17.0 30 18.5 31 17.5 32 29.0 33 37.5 34 54.0 35 70.0 36 89.0 37 107.5 38 129.5 39 172.5 40 195.5 41 219.0 42 241.0 43 246.0 44 246.5 45 258.5 46 267.5 47 242.0 48 210.0 49 202.5 50 181.0 51 144.5 52 124.5 53 99.5 54 78.0 55 65.0 56 61.5 57 46.5 58 24.5 59 16.0 60 13.5 61 13.0 62 10.5 63 6.5 64 4.0 65 2.5 66 2.0 67 1.0 68 0.5 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11616161616162 98.125 2 0.7828282828282829 1.55 3 0.07575757575757576 0.22499999999999998 4 0.025252525252525252 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.0 0.0 0.0 0.0 0.0 118-119 2.2875 0.0 0.0 0.0 0.0 120-121 2.625 0.0 0.0 0.0 0.0 122-123 2.9625 0.0 0.0 0.0 0.0 124-125 3.2 0.0 0.0 0.0 0.0 126-127 3.525 0.0 0.0 0.0 0.0 128-129 3.8625 0.0 0.0 0.0 0.0 130-131 4.262499999999999 0.0 0.0 0.0 0.0 132-133 4.5125 0.0 0.0 0.0 0.0 134-135 4.8375 0.0 0.0 0.0 0.0 136-137 5.275 0.0 0.0 0.0 0.0 138-139 5.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 774847 spots for SRR7230772.sra Written 774847 spots for SRR7230772.sra Read 774847 spots for SRR7230772.sra Written 774847 spots for SRR7230772.sra Read 774847 spots for SRR7230772.sra Written 774847 spots for SRR7230772.sra Read 774847 spots for SRR7230772.sra Written 774847 spots for SRR7230772.sra Read 774847 spots for SRR7230772.sra Written 774847 spots for SRR7230772.sra Read 774847 spots for SRR7230772.sra Written 774847 spots for SRR7230772.sra Read 774847 spots for SRR7230772.sra Written 774847 spots for SRR7230772.sra Read 774847 spots for SRR7230772.sra Written 774847 spots for SRR7230772.sra Read 774847 spots for SRR7230772.sra Written 774847 spots for SRR7230772.sra Read 774847 spots for SRR7230772.sra Written 774847 spots for SRR7230772.sra Read 774847 spots for SRR7230772.sra Written 774847 spots for SRR7230772.sra Read 774847 spots for SRR7230772.sra Written 774847 spots for SRR7230772.sra Read 774847 spots for SRR7230772.sra Written 774847 spots for SRR7230772.sra Read 774847 spots for SRR7230772.sra Written 774847 spots for SRR7230772.sra Read 774847 spots for SRR7230772.sra Written 774847 spots for SRR7230772.sra Read 774847 spots for SRR7230772.sra Written 774847 spots for SRR7230772.sra Read 774852 spots for SRR7230772.sra Written 774852 spots for SRR7230772.sra Read 774847 spots for SRR7230772.sra Written 774847 spots for SRR7230772.sra Read 774847 spots for SRR7230772.sra Written 774847 spots for SRR7230772.sra Read 774847 spots for SRR7230772.sra Written 774847 spots for SRR7230772.sra SRR ids: ['SRR7230772.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lm2f3umr SRR7230772.sra spots: 15496945 blocks: [[1, 774847], [774848, 1549694], [1549695, 2324541], [2324542, 3099388], [3099389, 3874235], [3874236, 4649082], [4649083, 5423929], [5423930, 6198776], [6198777, 6973623], [6973624, 7748470], [7748471, 8523317], [8523318, 9298164], [9298165, 10073011], [10073012, 10847858], [10847859, 11622705], [11622706, 12397552], [12397553, 13172399], [13172400, 13947246], [13947247, 14722093], [14722094, 15496945]] SRR7230772 file size 5229705 SRR7230772 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230772 SRR7230772_1.fastq SRR7230772_2.fastq Input file: SRR7230772_1.fastq Paired file: SRR7230772_2.fastq trimmed: SRR7230772-trimmed-pair1.fastq, SRR7230772-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:09:26 2025 >> started Tue Feb 11 00:09:43 2025 >> done (16.806s) 15496945 read pairs processed; of these: 15917 ( 0.10%) short read pairs filtered out after trimming by size control 10449 ( 0.07%) empty read pairs filtered out after trimming by size control 15470579 (99.83%) read pairs available; of these: 8706544 (56.28%) trimmed read pairs available after processing 6764035 (43.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 1 0.00% 24 7 0.00% 25 8 0.00% 26 6 0.00% 27 7 0.00% 28 11 0.00% 29 7 0.00% 30 9 0.00% 31 9 0.00% 32 5 0.00% 33 13 0.00% 34 10 0.00% 35 11 0.00% 36 8 0.00% 37 19 0.00% 38 25 0.00% 39 19 0.00% 40 15 0.00% 41 27 0.00% 42 32 0.00% 43 25 0.00% 44 33 0.00% 45 34 0.00% 46 50 0.00% 47 42 0.00% 48 45 0.00% 49 52 0.00% 50 66 0.00% 51 81 0.00% 52 72 0.00% 53 84 0.00% 54 114 0.00% 55 103 0.00% 56 120 0.00% 57 127 0.00% 58 149 0.00% 59 181 0.00% 60 204 0.00% 61 226 0.00% 62 223 0.00% 63 285 0.00% 64 318 0.00% 65 353 0.00% 66 399 0.00% 67 483 0.00% 68 536 0.00% 69 870 0.01% 70 1031 0.01% 71 869 0.01% 72 929 0.01% 73 1048 0.01% 74 1176 0.01% 75 1276 0.01% 76 1389 0.01% 77 1511 0.01% 78 1611 0.01% 79 1922 0.01% 80 2069 0.01% 81 2449 0.02% 82 2813 0.02% 83 3045 0.02% 84 4119 0.03% 85 4687 0.03% 86 4958 0.03% 87 5432 0.04% 88 5925 0.04% 89 6327 0.04% 90 6734 0.04% 91 7174 0.05% 92 7476 0.05% 93 8390 0.05% 94 8772 0.06% 95 9576 0.06% 96 10016 0.06% 97 10623 0.07% 98 11277 0.07% 99 11895 0.08% 100 12715 0.08% 101 13389 0.09% 102 14320 0.09% 103 15120 0.10% 104 16255 0.11% 105 17230 0.11% 106 18280 0.12% 107 18662 0.12% 108 19909 0.13% 109 21268 0.14% 110 21947 0.14% 111 23293 0.15% 112 24412 0.16% 113 25717 0.17% 114 27163 0.18% 115 28438 0.18% 116 29749 0.19% 117 31089 0.20% 118 32309 0.21% 119 33982 0.22% 120 35183 0.23% 121 37070 0.24% 122 38807 0.25% 123 40676 0.26% 124 43219 0.28% 125 44960 0.29% 126 47535 0.31% 127 49063 0.32% 128 51518 0.33% 129 54560 0.35% 130 56548 0.37% 131 60403 0.39% 132 63734 0.41% 133 67333 0.44% 134 71491 0.46% 135 76649 0.50% 136 81031 0.52% 137 86574 0.56% 138 93555 0.60% 139 100299 0.65% 140 109918 0.71% 141 121854 0.79% 142 135192 0.87% 143 153635 0.99% 144 179257 1.16% 145 211100 1.36% 146 264453 1.71% 147 354342 2.29% 148 527686 3.41% 149 994877 6.43% 150 3856718 24.93% 151 6764035 43.72% 15470579 reads passed initial QC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=16 prefix-density=0.82 prefix-fanout=2.1 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=84.23 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.1 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=14 prefix-density=0.71 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=14.26 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.8 sequence=CAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7230772 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:10:29 Started mapping on | Feb 11 00:10:29 Finished on | Feb 11 00:12:19 Mapping speed, Million of reads per hour | 506.31 Number of input reads | 15470579 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14508480 Uniquely mapped reads % | 93.78% Average mapped length | 292.76 Number of splices: Total | 13841921 Number of splices: Annotated (sjdb) | 13541293 Number of splices: GT/AG | 13573548 Number of splices: GC/AG | 224921 Number of splices: AT/AC | 7844 Number of splices: Non-canonical | 35608 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 376690 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 57726 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.31% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 603581 603581 603581 N_multimapping 376690 376690 376690 N_noFeature 627700 14200903 739883 N_ambiguous 281785 930 85790 UnstrandedReadsAssigned:13598995 PositiveStrandReadsAssigned:306647 NegativeStrandReadsAssigned:13682807 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7230772 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230772-trimmed-pair1.fastq SRR7230772-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,470,579 reads, 13,662,149 reads pseudoaligned [quant] estimated average fragment length: 239.753 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52401 SRR7230772.ke.tsv 34699 SRR7230772.se.tsv 87100 total ==> SRR7230772.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.25 529 17.7922 Potri.005G024800.1.v4.1 1035 796.247 173 13.002 Potri.004G059700.1.v4.1 961 722.299 8 0.662802 Potri.007G009000.2.v4.1 1416 1177.25 0 0 Potri.003G141000.2.v4.1 2943 2704.25 1074.53 23.7784 Potri.016G087400.1.v4.1 270 81.7838 515 376.835 Potri.015G069301.1.v4.1 564 330.579 0 0 Potri.010G195200.1.v4.1 1773 1534.25 24 0.93611 Potri.012G127500.1.v4.1 977 738.258 257 20.8322 ==> SRR7230772.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 858 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 242 Potri.001G212900.v4.1 29 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 24 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 3 SRR7230772 completed mapping pipeline successfully