Starting /dee2/code/volunteer_pipeline.sh SRR7230773 current disk space = 3057343627264 free memory = 1513724156 SRR7230773 SRAfilesize 9b0012927e2c17f2ed340b8401427751 SRR7230773.sra SRR7230773.sra file validated SRR7230773 is paired end SRR7230773 is conventional basespace SRR7230773 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230773_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3075 34.0 33.0 34.0 33.0 34.0 2 33.38775 34.0 33.0 34.0 33.0 34.0 3 33.414 34.0 33.0 34.0 33.0 34.0 4 33.4065 34.0 33.0 34.0 33.0 34.0 5 33.388 34.0 33.0 34.0 33.0 34.0 6 37.23125 38.0 38.0 38.0 36.0 38.0 7 37.5065 38.0 38.0 38.0 37.0 38.0 8 37.30775 38.0 38.0 38.0 37.0 38.0 9 37.44675 38.0 38.0 38.0 37.0 38.0 10-14 37.5065 38.0 38.0 38.0 38.0 38.0 15-19 37.4802 38.0 38.0 38.0 37.6 38.0 20-24 37.559650000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.4202 38.0 38.0 38.0 37.4 38.0 30-34 37.31940000000001 38.0 38.0 38.0 37.2 38.0 35-39 37.2147 38.0 38.0 38.0 36.8 38.0 40-44 36.8077 38.0 38.0 38.0 35.2 38.0 45-49 37.1716 38.0 38.0 38.0 36.6 38.0 50-54 37.3134 38.0 38.0 38.0 37.0 38.0 55-59 37.205349999999996 38.0 38.0 38.0 36.6 38.0 60-64 37.12925 38.0 38.0 38.0 36.4 38.0 65-69 37.13545 38.0 38.0 38.0 36.2 38.0 70-74 31.026100000000003 38.0 21.6 38.0 15.4 38.0 75-79 32.16425 38.0 33.6 38.0 6.6 38.0 80-84 34.89855 38.0 37.4 38.0 27.6 38.0 85-89 36.07169999999999 38.0 38.0 38.0 33.4 38.0 90-94 36.396950000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.523849999999996 38.0 38.0 38.0 34.4 38.0 100-104 36.43605000000001 38.0 38.0 38.0 34.0 38.0 105-109 35.76375 38.0 37.2 38.0 30.2 38.0 110-114 36.014599999999994 38.0 37.2 38.0 32.6 38.0 115-119 35.96995 38.0 37.6 38.0 32.6 38.0 120-124 35.6536 38.0 37.0 38.0 31.0 38.0 125-129 34.996300000000005 38.0 35.6 38.0 27.2 38.0 130-134 35.3484 38.0 36.0 38.0 30.6 38.0 135-139 35.19865 38.0 36.0 38.0 30.4 38.0 140-144 34.9006 38.0 36.0 38.0 28.0 38.0 145-149 34.1059 38.0 34.4 38.0 25.0 38.0 150-151 30.783749999999998 35.5 30.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 5.0 15 1.0 16 2.0 17 1.0 18 1.0 19 2.0 20 5.0 21 7.0 22 5.0 23 9.0 24 14.0 25 10.0 26 16.0 27 27.0 28 30.0 29 42.0 30 66.0 31 68.0 32 84.0 33 169.0 34 284.0 35 430.0 36 750.0 37 1968.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.392696348174084 15.032516258129064 10.955477738869435 38.61930965482742 2 20.974999999999998 22.0 36.65 20.375 3 18.224999999999998 28.1 26.325 27.35 4 22.85 34.35 21.825 20.974999999999998 5 20.9 37.724999999999994 22.925 18.45 6 16.85 37.225 25.575 20.349999999999998 7 13.125 23.525 44.05 19.3 8 18.8 21.95 30.575000000000003 28.675 9 17.849999999999998 22.225 33.7 26.224999999999998 10-14 19.99 29.65 26.595000000000002 23.765 15-19 20.19 28.044999999999998 28.16 23.605 20-24 20.095 28.22 28.09 23.595 25-29 20.325 28.59 27.575 23.51 30-34 19.585 28.51 28.555000000000003 23.35 35-39 19.971997199719972 28.312831283128315 28.347834783478348 23.367336733673366 40-44 20.35442531037245 28.56427713255907 27.833400080096116 23.24789747697237 45-49 19.97 29.085 27.284999999999997 23.66 50-54 20.405 28.794999999999998 26.715 24.085 55-59 20.23 28.505000000000003 27.575 23.69 60-64 19.62490622655664 28.362090522630655 28.602150537634408 23.410852713178297 65-69 19.994999999999997 28.255000000000003 27.994999999999997 23.755000000000003 70-74 20.700296735905045 28.136498516320472 27.560830860534125 23.602373887240354 75-79 20.271723747523353 28.21398245117464 28.12906878007359 23.38522502122842 80-84 20.443117536140793 28.331238214959146 27.51937984496124 23.706264403938825 85-89 20.140752366968762 28.89980254164346 27.745430611108297 23.21401448027948 90-94 20.909956406273487 28.471213108182592 27.178433632309467 23.440396853234454 95-99 20.54478994542086 28.311051023984778 27.970557308096737 23.173601722497622 100-104 19.958909601122468 28.7632792142714 27.24994988975747 24.02786129484867 105-109 20.21915340738517 28.42990093065146 27.749424597218052 23.60152106474532 110-114 20.622062206220622 28.617861786178615 27.412741274127413 23.347334733473346 115-119 21.14236999147485 28.067800010029586 27.586379820470384 23.203450178025175 120-124 20.697102104364422 28.456632012455422 26.990105971573502 23.85615991160665 125-129 20.974999999999998 28.939999999999998 27.165 22.919999999999998 130-134 20.905 28.01 27.435 23.65 135-139 21.125 28.189999999999998 27.200000000000003 23.485 140-144 21.545 28.139999999999997 26.86 23.455000000000002 145-149 20.74508036653147 29.197336137399226 26.493415452405987 23.56416804366331 150-151 21.2625 28.787499999999998 25.687500000000004 24.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.5 18 1.5 19 0.5 20 0.5 21 2.0 22 2.5 23 2.0 24 2.5 25 5.5 26 8.5 27 9.5 28 15.0 29 23.5 30 33.5 31 40.0 32 46.0 33 65.0 34 80.5 35 90.5 36 111.5 37 129.0 38 156.5 39 191.0 40 199.5 41 208.0 42 229.5 43 268.5 44 280.0 45 249.0 46 231.5 47 212.5 48 203.5 49 193.5 50 153.0 51 124.5 52 103.5 53 80.0 54 59.0 55 43.5 56 36.5 57 27.5 58 22.0 59 17.5 60 12.0 61 7.0 62 4.0 63 3.5 64 2.5 65 1.5 66 1.0 67 0.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.12 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.025 65-69 0.0 70-74 15.75 75-79 11.675 80-84 4.54 85-89 1.2449999999999999 90-94 0.215 95-99 0.145 100-104 0.22 105-109 0.06999999999999999 110-114 0.01 115-119 0.295 120-124 0.445 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.145 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26933736457546 98.5 2 0.6802721088435374 1.35 3 0.05039052658100278 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.1125 0.0 0.0 0.0 0.0 114-115 1.425 0.0 0.0 0.0 0.0 116-117 1.7625000000000002 0.0 0.0 0.0 0.0 118-119 2.1125 0.0 0.0 0.0 0.0 120-121 2.5250000000000004 0.0 0.0 0.0 0.0 122-123 2.8375000000000004 0.0 0.0 0.0 0.0 124-125 3.0999999999999996 0.0 0.0 0.0 0.0 126-127 3.3 0.0 0.0 0.0 0.0 128-129 3.5625 0.0 0.0 0.0 0.0 130-131 3.9125 0.0 0.0 0.0 0.0 132-133 4.375 0.0 0.0 0.0 0.0 134-135 4.75 0.0 0.0 0.0 0.0 136-137 5.275 0.0 0.0 0.0 0.0 138-139 5.637499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7230773 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230773_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.39125 33.0 33.0 34.0 32.0 34.0 2 32.8815 34.0 33.0 34.0 32.0 34.0 3 33.0075 34.0 33.0 34.0 32.0 34.0 4 32.986 34.0 33.0 34.0 32.0 34.0 5 33.01175 34.0 33.0 34.0 32.0 34.0 6 37.1855 38.0 38.0 38.0 37.0 38.0 7 37.0075 38.0 38.0 38.0 36.0 38.0 8 36.99625 38.0 38.0 38.0 36.0 38.0 9 36.85275 38.0 38.0 38.0 36.0 38.0 10-14 36.83905 38.0 38.0 38.0 35.6 38.0 15-19 37.0315 38.0 38.0 38.0 36.6 38.0 20-24 36.95125 38.0 38.0 38.0 36.4 38.0 25-29 36.8574 38.0 38.0 38.0 36.2 38.0 30-34 36.91459999999999 38.0 38.0 38.0 36.4 38.0 35-39 36.581450000000004 38.0 38.0 38.0 35.4 38.0 40-44 36.36875 38.0 38.0 38.0 34.2 38.0 45-49 36.605 38.0 38.0 38.0 35.4 38.0 50-54 36.5625 38.0 38.0 38.0 34.6 38.0 55-59 36.51805 38.0 38.0 38.0 35.0 38.0 60-64 36.70415 38.0 38.0 38.0 35.8 38.0 65-69 36.62 38.0 38.0 38.0 35.6 38.0 70-74 36.5588 38.0 38.0 38.0 35.0 38.0 75-79 36.560750000000006 38.0 38.0 38.0 35.2 38.0 80-84 36.5789 38.0 38.0 38.0 35.2 38.0 85-89 36.54705 38.0 38.0 38.0 35.0 38.0 90-94 36.4386 38.0 38.0 38.0 34.8 38.0 95-99 36.2008 38.0 38.0 38.0 33.8 38.0 100-104 35.55005 38.0 37.2 38.0 29.8 38.0 105-109 35.82845 38.0 38.0 38.0 32.6 38.0 110-114 35.9019 38.0 38.0 38.0 33.2 38.0 115-119 35.79075 38.0 38.0 38.0 33.0 38.0 120-124 35.474450000000004 38.0 37.2 38.0 31.0 38.0 125-129 35.074799999999996 38.0 36.4 38.0 28.4 38.0 130-134 34.907 38.0 36.0 38.0 27.8 38.0 135-139 34.61775 38.0 36.0 38.0 26.4 38.0 140-144 34.1414 38.0 35.0 38.0 23.4 38.0 145-149 33.606550000000006 38.0 33.8 38.0 21.0 38.0 150-151 29.194 35.5 26.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 4.0 5 5.0 6 2.0 7 0.0 8 1.0 9 3.0 10 4.0 11 0.0 12 3.0 13 0.0 14 4.0 15 5.0 16 5.0 17 9.0 18 7.0 19 3.0 20 5.0 21 14.0 22 20.0 23 7.0 24 16.0 25 14.0 26 23.0 27 42.0 28 38.0 29 34.0 30 47.0 31 56.0 32 66.0 33 101.0 34 121.0 35 223.0 36 490.0 37 2620.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.908998474834775 18.251143873919677 16.090493136756482 28.749364514489066 2 25.900000000000002 24.05 33.825 16.225 3 20.525 27.0 31.674999999999997 20.8 4 23.875 35.075 22.475 18.575 5 22.85 37.4 22.075 17.675 6 19.650000000000002 36.0 25.124999999999996 19.225 7 18.8 18.6 41.099999999999994 21.5 8 20.724999999999998 22.95 29.25 27.075 9 21.7 24.425 29.299999999999997 24.575 10-14 22.94261844014208 28.940917504627546 26.06433538446145 22.052128670768923 15-19 22.99 27.855 27.91 21.245 20-24 22.37842705623374 27.996798078847306 28.181909145487293 21.44286571943166 25-29 22.67066766691673 27.961990497624406 28.162040510127532 21.205301325331334 30-34 22.422332282755516 27.645204862674472 28.485667116914303 21.446795737655712 35-39 22.76182854856457 27.293187956386916 28.203461038311495 21.741522456737023 40-44 23.19159579789895 27.03851925962982 28.25912956478239 21.510755377688845 45-49 23.361538076403143 27.401992690131678 28.34827016472238 20.888199068742804 50-54 23.165849264337904 27.569812831548397 27.935141627464716 21.329196276648986 55-59 22.983264856198016 27.70818719310552 27.84347128970839 21.465076660988075 60-64 23.10424169667867 27.941176470588236 27.681072428971586 21.273509403761505 65-69 22.97446169253881 27.38607911867802 27.74161241862794 21.897846770155233 70-74 23.43757818363773 27.710783087315487 27.33049787340505 21.521140855641733 75-79 23.03418589518995 27.443816006807147 27.969367836228038 21.552630261774862 80-84 23.559135481288774 28.0768461076646 27.176305783470085 21.187712627576545 85-89 23.455492139781718 28.25673375388004 27.610894162411135 20.676879943927105 90-94 23.52823388065679 28.108730476571886 27.573087705246298 20.78994793752503 95-99 23.03190957287186 28.6035810743223 27.333199959987997 21.031309392817846 100-104 23.358503775566337 28.034205130769614 27.76916537480622 20.838125718857828 105-109 23.723303156104635 27.544640624218474 27.94478067323563 20.787275546441254 110-114 23.369999999999997 28.050000000000004 27.750000000000004 20.830000000000002 115-119 23.59 27.595 27.83 20.985 120-124 23.583254138948632 28.22487870754764 27.934777172010207 20.25708998149352 125-129 23.39254440830623 27.630723042281712 27.530647985989493 21.44608456342257 130-134 23.815 27.325 28.189999999999998 20.669999999999998 135-139 24.29228768630589 27.283184955486643 27.748324497349202 20.676202860858258 140-144 24.806085172396536 28.063854276134713 27.00295250963319 20.12710804183556 145-149 24.457445744574457 28.797879787978797 26.787678767876788 19.95699569956996 150-151 25.2125 28.787499999999998 26.674999999999997 19.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 3.0 20 2.5 21 0.5 22 0.5 23 2.5 24 3.0 25 4.5 26 5.5 27 3.5 28 7.0 29 13.0 30 22.0 31 29.5 32 31.5 33 41.5 34 49.0 35 59.0 36 84.5 37 107.5 38 130.0 39 146.0 40 170.5 41 203.0 42 232.0 43 250.5 44 263.0 45 266.5 46 266.0 47 256.0 48 232.5 49 212.5 50 176.5 51 144.5 52 122.0 53 102.5 54 85.5 55 72.0 56 54.5 57 40.0 58 33.5 59 25.0 60 13.5 61 5.0 62 4.5 63 5.0 64 5.0 65 3.0 66 1.0 67 1.0 68 1.0 69 1.5 70 1.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.055 15-19 0.0 20-24 0.06 25-29 0.025 30-34 0.055 35-39 0.03 40-44 0.05 45-49 0.135 50-54 0.09 55-59 0.21 60-64 0.04 65-69 0.15 70-74 0.075 75-79 0.105 80-84 0.06 85-89 0.13 90-94 0.12 95-99 0.03 100-104 0.015 105-109 0.034999999999999996 110-114 0.0 115-119 0.0 120-124 0.034999999999999996 125-129 0.075 130-134 0.0 135-139 0.03 140-144 0.08499999999999999 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52201257861634 98.9 2 0.37735849056603776 0.75 3 0.07547169811320754 0.22499999999999998 4 0.0 0.0 5 0.025157232704402514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7124999999999999 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.1625 0.0 0.0 0.0 0.0 114-115 1.45 0.0 0.0 0.0 0.0 116-117 1.7875 0.0 0.0 0.0 0.0 118-119 2.1375 0.0 0.0 0.0 0.0 120-121 2.5625 0.0 0.0 0.0 0.0 122-123 2.8875 0.0 0.0 0.0 0.0 124-125 3.1375 0.0 0.0 0.0 0.0 126-127 3.325 0.0 0.0 0.0 0.0 128-129 3.5875 0.0 0.0 0.0 0.0 130-131 3.95 0.0 0.0 0.0 0.0 132-133 4.425 0.0 0.0 0.0 0.0 134-135 4.8125 0.0 0.0 0.0 0.0 136-137 5.35 0.0 0.0 0.0 0.0 138-139 5.737500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGCTAC 10 0.006390669 148.21796 1 AAAGCAG 10 0.006390669 148.21796 1 GAAATTG 10 0.006899958 144.51251 2 CCAGAAA 10 0.006899958 144.51251 145 >>END_MODULE Read 846799 spots for SRR7230773.sra Written 846799 spots for SRR7230773.sra Read 846799 spots for SRR7230773.sra Written 846799 spots for SRR7230773.sra Read 846799 spots for SRR7230773.sra Written 846799 spots for SRR7230773.sra Read 846799 spots for SRR7230773.sra Written 846799 spots for SRR7230773.sra Read 846799 spots for SRR7230773.sra Written 846799 spots for SRR7230773.sra Read 846799 spots for SRR7230773.sra Written 846799 spots for SRR7230773.sra Read 846799 spots for SRR7230773.sra Written 846799 spots for SRR7230773.sra Read 846799 spots for SRR7230773.sra Written 846799 spots for SRR7230773.sra Read 846799 spots for SRR7230773.sra Written 846799 spots for SRR7230773.sra Read 846799 spots for SRR7230773.sra Written 846799 spots for SRR7230773.sra Read 846799 spots for SRR7230773.sra Written 846799 spots for SRR7230773.sra Read 846799 spots for SRR7230773.sra Written 846799 spots for SRR7230773.sra Read 846799 spots for SRR7230773.sra Written 846799 spots for SRR7230773.sra Read 846799 spots for SRR7230773.sra Written 846799 spots for SRR7230773.sra Read 846799 spots for SRR7230773.sra Written 846799 spots for SRR7230773.sra Read 846799 spots for SRR7230773.sra Written 846799 spots for SRR7230773.sra Read 846799 spots for SRR7230773.sra Written 846799 spots for SRR7230773.sra Read 846799 spots for SRR7230773.sra Written 846799 spots for SRR7230773.sra Read 846799 spots for SRR7230773.sra Written 846799 spots for SRR7230773.sra Read 846816 spots for SRR7230773.sra Written 846816 spots for SRR7230773.sra SRR ids: ['SRR7230773.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m27gz6mn SRR7230773.sra spots: 16935997 blocks: [[1, 846799], [846800, 1693598], [1693599, 2540397], [2540398, 3387196], [3387197, 4233995], [4233996, 5080794], [5080795, 5927593], [5927594, 6774392], [6774393, 7621191], [7621192, 8467990], [8467991, 9314789], [9314790, 10161588], [10161589, 11008387], [11008388, 11855186], [11855187, 12701985], [12701986, 13548784], [13548785, 14395583], [14395584, 15242382], [15242383, 16089181], [16089182, 16935997]] SRR7230773 file size 5717353 SRR7230773 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230773 SRR7230773_1.fastq SRR7230773_2.fastq Input file: SRR7230773_1.fastq Paired file: SRR7230773_2.fastq trimmed: SRR7230773-trimmed-pair1.fastq, SRR7230773-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:28:03 2025 >> started Tue Feb 11 00:28:22 2025 >> done (19.378s) 16935997 read pairs processed; of these: 11039 ( 0.07%) short read pairs filtered out after trimming by size control 8955 ( 0.05%) empty read pairs filtered out after trimming by size control 16916003 (99.88%) read pairs available; of these: 7527871 (44.50%) trimmed read pairs available after processing 9388132 (55.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 4 0.00% 21 1 0.00% 22 4 0.00% 23 5 0.00% 24 4 0.00% 25 4 0.00% 26 6 0.00% 27 7 0.00% 28 9 0.00% 29 6 0.00% 30 5 0.00% 31 6 0.00% 32 6 0.00% 33 12 0.00% 34 8 0.00% 35 12 0.00% 36 15 0.00% 37 16 0.00% 38 18 0.00% 39 11 0.00% 40 17 0.00% 41 22 0.00% 42 26 0.00% 43 27 0.00% 44 30 0.00% 45 31 0.00% 46 46 0.00% 47 34 0.00% 48 46 0.00% 49 63 0.00% 50 56 0.00% 51 85 0.00% 52 96 0.00% 53 93 0.00% 54 80 0.00% 55 88 0.00% 56 129 0.00% 57 117 0.00% 58 141 0.00% 59 184 0.00% 60 199 0.00% 61 227 0.00% 62 253 0.00% 63 264 0.00% 64 306 0.00% 65 368 0.00% 66 396 0.00% 67 498 0.00% 68 489 0.00% 69 810 0.00% 70 1040 0.01% 71 803 0.00% 72 828 0.00% 73 858 0.01% 74 1073 0.01% 75 1142 0.01% 76 1180 0.01% 77 1361 0.01% 78 1609 0.01% 79 1763 0.01% 80 2130 0.01% 81 2191 0.01% 82 2635 0.02% 83 2793 0.02% 84 3648 0.02% 85 4350 0.03% 86 4589 0.03% 87 4858 0.03% 88 5300 0.03% 89 5643 0.03% 90 6050 0.04% 91 6418 0.04% 92 7127 0.04% 93 7672 0.05% 94 8219 0.05% 95 8712 0.05% 96 9482 0.06% 97 10139 0.06% 98 10821 0.06% 99 11364 0.07% 100 12175 0.07% 101 12787 0.08% 102 13397 0.08% 103 14367 0.08% 104 15035 0.09% 105 15854 0.09% 106 16952 0.10% 107 17665 0.10% 108 18487 0.11% 109 20124 0.12% 110 20875 0.12% 111 21665 0.13% 112 22734 0.13% 113 23979 0.14% 114 24849 0.15% 115 26626 0.16% 116 27024 0.16% 117 28152 0.17% 118 29391 0.17% 119 30771 0.18% 120 32164 0.19% 121 33989 0.20% 122 35095 0.21% 123 36985 0.22% 124 38636 0.23% 125 39184 0.23% 126 41354 0.24% 127 42819 0.25% 128 44612 0.26% 129 46621 0.28% 130 48750 0.29% 131 50851 0.30% 132 53671 0.32% 133 56532 0.33% 134 59118 0.35% 135 62501 0.37% 136 66003 0.39% 137 69946 0.41% 138 74353 0.44% 139 79495 0.47% 140 83430 0.49% 141 89804 0.53% 142 97512 0.58% 143 110141 0.65% 144 127204 0.75% 145 148869 0.88% 146 189051 1.12% 147 239027 1.41% 148 374793 2.22% 149 709605 4.19% 150 3791663 22.41% 151 9388132 55.50% 16916003 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=15 prefix-density=0.58 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=49.89 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.6 sequence=CCAAATCTGTTATTCCATTTATTTATTAATTGTCATAAGAACATTTATTAAATGTGTTGTCGTCCAACTCTTTCCATAAAAAGAAAGAGTTGTGAACCACCACATTTGATCATGGACAAAAGGTAATCAAATAGTTGCCTCCACTAGGACAAGTAAACGTGCTCGATTTATCATCATAAGCATAACTATAAGCTTGAGGACACTGCTGCTTGAAAGTCATCGAATATTGGGTAGGAGGACATGTGTCAGCTGTATTATGGTCTCCTGTGCAGCAGTACTGCGGCTGGTTAAATGCCAAACACGCACTCTTGCAGGCAATCACAGTCCCATCTGCCCCCTTCACTGCC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=21 prefix-density=0.67 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.19 sequence-density-rank=18 fanout-score=13.21 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=4.8 sequence=AGCAATGGCAGCA SRR7230773 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:29:05 Started mapping on | Feb 11 00:29:05 Finished on | Feb 11 00:31:00 Mapping speed, Million of reads per hour | 529.54 Number of input reads | 16916003 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15919904 Uniquely mapped reads % | 94.11% Average mapped length | 294.47 Number of splices: Total | 15195392 Number of splices: Annotated (sjdb) | 14861808 Number of splices: GT/AG | 14860011 Number of splices: GC/AG | 286604 Number of splices: AT/AC | 8432 Number of splices: Non-canonical | 40345 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 461439 % of reads mapped to multiple loci | 2.73% Number of reads mapped to too many loci | 80485 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.55% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 548457 548457 548457 N_multimapping 461439 461439 461439 N_noFeature 637868 15655539 752353 N_ambiguous 264869 1084 114223 UnstrandedReadsAssigned:15017167 PositiveStrandReadsAssigned:263281 NegativeStrandReadsAssigned:15053328 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7230773 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230773-trimmed-pair1.fastq SRR7230773-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,916,003 reads, 15,111,764 reads pseudoaligned [quant] estimated average fragment length: 247.304 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,024 rounds 52401 SRR7230773.ke.tsv 34699 SRR7230773.se.tsv 87100 total ==> SRR7230773.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.7 555 20.2063 Potri.005G024800.1.v4.1 1035 788.696 170 13.9034 Potri.004G059700.1.v4.1 961 714.768 5 0.45122 Potri.007G009000.2.v4.1 1416 1169.7 0 0 Potri.003G141000.2.v4.1 2943 2696.7 781.398 18.6906 Potri.016G087400.1.v4.1 270 80.1541 538.129 433.056 Potri.015G069301.1.v4.1 564 324.813 0 0 Potri.010G195200.1.v4.1 1773 1526.7 7 0.295753 Potri.012G127500.1.v4.1 977 730.733 106 9.35687 ==> SRR7230773.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1332 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 287 Potri.001G212900.v4.1 19 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 26 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7230773 completed mapping pipeline successfully