Starting /dee2/code/volunteer_pipeline.sh SRR7230774 current disk space = 3057324380160 free memory = 1579746000 SRR7230774 SRAfilesize 59f76ad07e5152974f9f51f1d1083978 SRR7230774.sra SRR7230774.sra file validated SRR7230774 is paired end SRR7230774 is conventional basespace SRR7230774 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230774_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3435 34.0 33.0 34.0 33.0 34.0 2 33.3775 34.0 33.0 34.0 33.0 34.0 3 33.42725 34.0 34.0 34.0 33.0 34.0 4 33.3965 34.0 34.0 34.0 33.0 34.0 5 33.34675 34.0 34.0 34.0 33.0 34.0 6 37.1575 38.0 37.0 38.0 36.0 38.0 7 37.439 38.0 38.0 38.0 37.0 38.0 8 37.507 38.0 38.0 38.0 38.0 38.0 9 37.47425 38.0 38.0 38.0 38.0 38.0 10-14 37.47735 38.0 38.0 38.0 37.8 38.0 15-19 37.418949999999995 38.0 38.0 38.0 37.6 38.0 20-24 37.2335 38.0 38.0 38.0 36.4 38.0 25-29 37.32335 38.0 38.0 38.0 37.2 38.0 30-34 37.4205 38.0 38.0 38.0 37.2 38.0 35-39 37.288149999999995 38.0 38.0 38.0 36.8 38.0 40-44 36.8524 38.0 38.0 38.0 35.4 38.0 45-49 36.965799999999994 38.0 38.0 38.0 36.0 38.0 50-54 37.20855 38.0 38.0 38.0 36.8 38.0 55-59 37.0978 38.0 38.0 38.0 36.2 38.0 60-64 37.0445 38.0 38.0 38.0 36.0 38.0 65-69 37.044200000000004 38.0 38.0 38.0 36.0 38.0 70-74 32.174850000000006 38.0 26.8 38.0 15.2 38.0 75-79 32.78255 38.0 35.0 38.0 7.4 38.0 80-84 34.91585 38.0 37.0 38.0 28.0 38.0 85-89 36.20825 38.0 38.0 38.0 33.4 38.0 90-94 36.2376 38.0 37.8 38.0 33.8 38.0 95-99 36.28485 38.0 38.0 38.0 34.0 38.0 100-104 36.2308 38.0 37.8 38.0 33.6 38.0 105-109 36.236149999999995 38.0 37.8 38.0 33.8 38.0 110-114 34.606100000000005 37.8 35.2 38.0 25.2 38.0 115-119 34.243849999999995 37.8 34.2 38.0 23.2 38.0 120-124 34.8836 38.0 35.4 38.0 27.2 38.0 125-129 34.29935 38.0 34.4 38.0 24.2 38.0 130-134 34.2434 38.0 34.8 38.0 24.2 38.0 135-139 33.647400000000005 38.0 34.2 38.0 21.0 38.0 140-144 33.8836 38.0 34.2 38.0 23.0 38.0 145-149 32.8843 38.0 33.4 38.0 15.4 38.0 150-151 28.509375 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 1.0 9 1.0 10 2.0 11 0.0 12 1.0 13 1.0 14 2.0 15 1.0 16 1.0 17 2.0 18 7.0 19 6.0 20 6.0 21 9.0 22 7.0 23 10.0 24 13.0 25 22.0 26 27.0 27 28.0 28 34.0 29 42.0 30 54.0 31 96.0 32 126.0 33 179.0 34 319.0 35 436.0 36 883.0 37 1683.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.675000000000004 16.1 10.0 32.225 2 21.575 20.125 32.800000000000004 25.5 3 19.45 28.000000000000004 25.15 27.400000000000002 4 23.5 34.55 22.400000000000002 19.55 5 21.55 36.825 22.95 18.675 6 18.099999999999998 36.175000000000004 25.05 20.674999999999997 7 13.100000000000001 23.225 44.975 18.7 8 18.075 22.75 30.15 29.025000000000002 9 18.075 24.474999999999998 31.0 26.450000000000003 10-14 19.978995799159833 29.260852170434088 26.655331066213243 24.10482096419284 15-19 19.919999999999998 28.405 27.62 24.055 20-24 20.375 28.389999999999997 27.985 23.25 25-29 20.29819382598689 29.1939760844549 27.02256466703357 23.48526542252464 30-34 20.317031703170315 27.86278627862786 27.9027902790279 23.91739173917392 35-39 20.55102755137757 28.72643632181609 27.251362568128407 23.471173558677936 40-44 20.486510836378198 29.09555032784424 27.06341658741679 23.35452224836078 45-49 20.61 28.46 27.07 23.86 50-54 20.080000000000002 28.65 27.63 23.64 55-59 20.178115775253914 28.443488267373795 27.868114274278284 23.51028168309401 60-64 20.18610235629596 28.970934013707538 27.164940717394565 23.678022912601932 65-69 20.81624487346204 28.943683104931477 27.068120436130837 23.171951585475643 70-74 21.299577094525088 28.151788775860098 27.214538804434792 23.33409532518002 75-79 20.730486991327552 28.385590393595734 27.24594173893707 23.63798087613965 80-84 20.589460529056446 27.68694022078734 27.228702353676315 24.4948968964799 85-89 21.462335311274263 28.57789399577592 26.79774715880519 23.162023534144623 90-94 20.920230057514377 28.687171792948234 26.901725431357836 23.490872718179546 95-99 20.674999999999997 29.330000000000002 26.625 23.369999999999997 100-104 20.83520880220055 28.777194298574642 26.826706676669165 23.56089022255564 105-109 20.855 27.900000000000002 27.145000000000003 24.099999999999998 110-114 20.945 28.435 26.955000000000002 23.665 115-119 21.23 28.139999999999997 26.645000000000003 23.985 120-124 21.148263089398338 28.33116428070878 26.389027930723795 24.131544699169087 125-129 21.22 28.005000000000003 26.529999999999998 24.245 130-134 21.19 28.65 26.41 23.75 135-139 21.545 27.765 26.61 24.08 140-144 21.325 27.96 26.840000000000003 23.875 145-149 21.437143714371437 28.257825782578255 26.242624262426244 24.062406240624064 150-151 21.224999999999998 28.15 26.1 24.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 2.0 24 5.0 25 5.0 26 7.0 27 9.5 28 12.5 29 17.0 30 24.0 31 41.0 32 47.5 33 59.0 34 78.0 35 86.5 36 104.0 37 128.5 38 142.5 39 166.5 40 195.0 41 223.0 42 239.5 43 228.0 44 233.5 45 248.5 46 227.0 47 211.0 48 221.5 49 205.5 50 162.5 51 129.0 52 112.0 53 105.5 54 80.0 55 51.0 56 43.5 57 37.0 58 29.0 59 23.0 60 19.5 61 13.5 62 8.0 63 4.0 64 2.0 65 1.5 66 1.5 67 1.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.02 15-19 0.0 20-24 0.0 25-29 0.065 30-34 0.01 35-39 0.005 40-44 0.105 45-49 0.0 50-54 0.0 55-59 0.065 60-64 0.055 65-69 0.03 70-74 12.509999999999998 75-79 10.059999999999999 80-84 3.9800000000000004 85-89 0.5700000000000001 90-94 0.025 95-99 0.0 100-104 0.025 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.11 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16771752837327 98.3 2 0.7818411097099622 1.55 3 0.05044136191677175 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.11249999999999999 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.3 0.0 0.0 0.0 0.0 104-105 1.4875 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.9375 0.0 0.0 0.0 0.0 110-111 2.1500000000000004 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.7750000000000004 0.0 0.0 0.0 0.0 116-117 3.0875 0.0 0.0 0.0 0.0 118-119 3.4625 0.0 0.0 0.0 0.0 120-121 3.8125 0.0 0.0 0.0 0.0 122-123 4.262499999999999 0.0 0.0 0.0 0.0 124-125 4.65 0.0 0.0 0.0 0.0 126-127 4.9375 0.0 0.0 0.0 0.0 128-129 5.3875 0.0 0.0 0.0 0.0 130-131 5.9 0.0 0.0 0.0 0.0 132-133 6.35 0.0 0.0 0.0 0.0 134-135 7.0125 0.0 0.0 0.0 0.0 136-137 7.7125 0.0 0.0 0.0 0.0 138-139 8.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7230774 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230774_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77075 33.0 33.0 34.0 32.0 34.0 2 32.90675 34.0 33.0 34.0 32.0 34.0 3 32.8785 34.0 33.0 34.0 32.0 34.0 4 32.9125 34.0 33.0 34.0 32.0 34.0 5 32.833 34.0 33.0 34.0 32.0 34.0 6 36.8525 38.0 38.0 38.0 36.0 38.0 7 36.976 38.0 38.0 38.0 37.0 38.0 8 36.86025 38.0 38.0 38.0 36.0 38.0 9 36.8555 38.0 38.0 38.0 36.0 38.0 10-14 36.84985 38.0 38.0 38.0 36.4 38.0 15-19 36.8654 38.0 38.0 38.0 36.8 38.0 20-24 36.83665 38.0 38.0 38.0 36.8 38.0 25-29 36.747 38.0 38.0 38.0 36.4 38.0 30-34 36.7328 38.0 38.0 38.0 36.4 38.0 35-39 36.5268 38.0 38.0 38.0 35.8 38.0 40-44 36.3371 38.0 38.0 38.0 34.6 38.0 45-49 36.63314999999999 38.0 38.0 38.0 36.0 38.0 50-54 36.65285 38.0 38.0 38.0 36.0 38.0 55-59 36.248149999999995 38.0 38.0 38.0 34.6 38.0 60-64 36.50995 38.0 38.0 38.0 35.4 38.0 65-69 36.24725 38.0 38.0 38.0 35.0 38.0 70-74 36.1795 38.0 38.0 38.0 34.4 38.0 75-79 36.35645 38.0 38.0 38.0 34.8 38.0 80-84 36.336850000000005 38.0 38.0 38.0 34.8 38.0 85-89 36.295300000000005 38.0 38.0 38.0 34.2 38.0 90-94 36.251999999999995 38.0 38.0 38.0 34.2 38.0 95-99 35.56695 38.0 37.4 38.0 30.2 38.0 100-104 35.71925 38.0 38.0 38.0 32.8 38.0 105-109 35.27275 38.0 37.0 38.0 29.0 38.0 110-114 35.498799999999996 38.0 37.0 38.0 31.0 38.0 115-119 35.5256 38.0 37.4 38.0 31.0 38.0 120-124 35.295 38.0 36.8 38.0 30.2 38.0 125-129 34.94665 38.0 36.0 38.0 28.2 38.0 130-134 34.79025 38.0 36.0 38.0 28.6 38.0 135-139 34.37825 38.0 35.6 38.0 25.4 38.0 140-144 33.865199999999994 38.0 34.4 38.0 23.0 38.0 145-149 32.95235 38.0 33.0 38.0 12.8 38.0 150-151 27.084375 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 11.0 4 7.0 5 1.0 6 3.0 7 2.0 8 4.0 9 3.0 10 3.0 11 1.0 12 0.0 13 4.0 14 2.0 15 7.0 16 6.0 17 6.0 18 7.0 19 2.0 20 7.0 21 11.0 22 10.0 23 11.0 24 19.0 25 24.0 26 13.0 27 24.0 28 40.0 29 36.0 30 28.0 31 72.0 32 74.0 33 92.0 34 148.0 35 259.0 36 546.0 37 2498.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.925000000000004 20.0 13.700000000000001 24.375 2 27.325 24.6 31.7 16.375 3 20.875 28.425 31.05 19.650000000000002 4 24.2 33.25 22.875 19.675 5 24.05 35.725 22.45 17.775 6 19.875 36.575 22.875 20.674999999999997 7 18.125 18.625 41.05 22.2 8 20.825 22.15 28.999999999999996 28.025 9 22.425 23.674999999999997 28.875 25.025 10-14 23.14 27.839999999999996 26.775 22.245 15-19 22.975 28.000000000000004 27.544999999999998 21.48 20-24 22.759999999999998 28.225 27.49 21.525 25-29 23.385 27.51 28.13 20.974999999999998 30-34 22.29 27.63 28.175 21.905 35-39 23.372855070288658 27.310020511281202 28.26054329881435 21.05658111961579 40-44 23.9747949589918 27.955591118223644 27.330466093218643 20.739147829565912 45-49 23.492047614284285 27.28818645593678 27.738321496448936 21.481444433329997 50-54 23.505000000000003 27.884999999999998 27.67 20.94 55-59 23.475027635413525 27.670585870766757 27.936890764747265 20.917495729072456 60-64 23.51705511653496 27.213163949184754 27.793338001400418 21.476442932879863 65-69 23.160227673399486 27.24021558454642 28.000805923538003 21.598750818516095 70-74 23.22363123993559 27.621779388083734 27.329911433172306 21.824677938808374 75-79 23.849999999999998 27.605 26.945000000000004 21.6 80-84 23.280476214296435 27.447351308088642 27.93757190735831 21.334600570256615 85-89 23.31 27.405 27.66 21.625 90-94 23.52 27.605 28.005000000000003 20.87 95-99 23.51 27.005000000000003 28.365000000000002 21.12 100-104 23.865 27.655 27.35 21.13 105-109 23.765 27.61 27.955000000000002 20.669999999999998 110-114 24.104999999999997 26.99 27.675 21.23 115-119 24.585 27.71 26.825 20.880000000000003 120-124 23.925 28.165000000000003 27.439999999999998 20.47 125-129 24.535 27.73 26.955000000000002 20.78 130-134 25.055 27.325 27.155 20.465 135-139 24.844968993798762 27.780556111222243 27.370474094818963 20.004000800160032 140-144 25.180072028811523 27.516006402561022 27.21588635454182 20.088035214085632 145-149 25.525 27.735 26.63 20.11 150-151 26.575 27.250000000000004 26.625 19.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 1.5 23 2.0 24 2.5 25 5.0 26 9.0 27 10.5 28 7.5 29 6.0 30 9.5 31 24.0 32 30.0 33 37.5 34 52.5 35 60.0 36 76.5 37 98.0 38 119.5 39 156.5 40 178.5 41 201.5 42 234.0 43 240.0 44 240.5 45 239.5 46 254.5 47 257.0 48 237.0 49 222.5 50 178.0 51 147.0 52 140.5 53 118.5 54 95.5 55 74.0 56 55.5 57 44.0 58 36.0 59 29.5 60 21.0 61 12.0 62 12.0 63 9.0 64 4.0 65 2.0 66 1.0 67 0.5 68 0.5 69 1.0 70 0.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.055 40-44 0.02 45-49 0.03 50-54 0.0 55-59 0.49 60-64 0.03 65-69 0.735 70-74 0.64 75-79 0.0 80-84 0.045 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.02 140-144 0.04 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1670873296315 98.225 2 0.7319535588086825 1.4500000000000002 3 0.0757193336698637 0.22499999999999998 4 0.025239777889954566 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.11249999999999999 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.425 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.6000000000000001 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.85 0.0 0.0 0.0 0.0 96-97 0.9125000000000001 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.9625 0.0 0.0 0.0 0.0 110-111 2.2375 0.0 0.0 0.0 0.0 112-113 2.5625 0.0 0.0 0.0 0.0 114-115 2.9875 0.0 0.0 0.0 0.0 116-117 3.3 0.0 0.0 0.0 0.0 118-119 3.6875 0.0 0.0 0.0 0.0 120-121 4.0375 0.0 0.0 0.0 0.0 122-123 4.45 0.0 0.0 0.0 0.0 124-125 4.875 0.0 0.0 0.0 0.0 126-127 5.1625 0.0 0.0 0.0 0.0 128-129 5.6125 0.0 0.0 0.0 0.0 130-131 6.05 0.0 0.0 0.0 0.0 132-133 6.4875 0.0 0.0 0.0 0.0 134-135 7.15 0.0 0.0 0.0 0.0 136-137 7.825 0.0 0.0 0.0 0.0 138-139 8.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGCTT 10 0.0069071017 144.46251 1 TCTATGT 10 0.0069071017 144.46251 145 GGGATCC 10 0.0069071017 144.46251 1 AAATGCA 10 0.0069071017 144.46251 8 >>END_MODULE Read 710632 spots for SRR7230774.sra Written 710632 spots for SRR7230774.sra Read 710632 spots for SRR7230774.sra Written 710632 spots for SRR7230774.sra Read 710632 spots for SRR7230774.sra Written 710632 spots for SRR7230774.sra Read 710632 spots for SRR7230774.sra Written 710632 spots for SRR7230774.sra Read 710632 spots for SRR7230774.sra Written 710632 spots for SRR7230774.sra Read 710632 spots for SRR7230774.sra Written 710632 spots for SRR7230774.sra Read 710632 spots for SRR7230774.sra Written 710632 spots for SRR7230774.sra Read 710632 spots for SRR7230774.sra Written 710632 spots for SRR7230774.sra Read 710632 spots for SRR7230774.sra Written 710632 spots for SRR7230774.sra Read 710632 spots for SRR7230774.sra Written 710632 spots for SRR7230774.sra Read 710632 spots for SRR7230774.sra Written 710632 spots for SRR7230774.sra Read 710632 spots for SRR7230774.sra Written 710632 spots for SRR7230774.sra Read 710635 spots for SRR7230774.sra Written 710635 spots for SRR7230774.sra Read 710632 spots for SRR7230774.sra Written 710632 spots for SRR7230774.sra Read 710632 spots for SRR7230774.sra Written 710632 spots for SRR7230774.sra Read 710632 spots for SRR7230774.sra Written 710632 spots for SRR7230774.sra Read 710632 spots for SRR7230774.sra Written 710632 spots for SRR7230774.sra Read 710632 spots for SRR7230774.sra Written 710632 spots for SRR7230774.sra Read 710632 spots for SRR7230774.sra Written 710632 spots for SRR7230774.sra Read 710632 spots for SRR7230774.sra Written 710632 spots for SRR7230774.sra SRR ids: ['SRR7230774.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_08h78fpo SRR7230774.sra spots: 14212643 blocks: [[1, 710632], [710633, 1421264], [1421265, 2131896], [2131897, 2842528], [2842529, 3553160], [3553161, 4263792], [4263793, 4974424], [4974425, 5685056], [5685057, 6395688], [6395689, 7106320], [7106321, 7816952], [7816953, 8527584], [8527585, 9238216], [9238217, 9948848], [9948849, 10659480], [10659481, 11370112], [11370113, 12080744], [12080745, 12791376], [12791377, 13502008], [13502009, 14212643]] SRR7230774 file size 4794497 SRR7230774 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230774 SRR7230774_1.fastq SRR7230774_2.fastq Input file: SRR7230774_1.fastq Paired file: SRR7230774_2.fastq trimmed: SRR7230774-trimmed-pair1.fastq, SRR7230774-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 01:02:27 2025 >> started Tue Feb 11 01:02:44 2025 >> done (17.574s) 14212643 read pairs processed; of these: 32105 ( 0.23%) short read pairs filtered out after trimming by size control 32274 ( 0.23%) empty read pairs filtered out after trimming by size control 14148264 (99.55%) read pairs available; of these: 6926351 (48.96%) trimmed read pairs available after processing 7221913 (51.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 5 0.00% 21 6 0.00% 22 6 0.00% 23 4 0.00% 24 5 0.00% 25 8 0.00% 26 5 0.00% 27 11 0.00% 28 10 0.00% 29 8 0.00% 30 8 0.00% 31 7 0.00% 32 11 0.00% 33 9 0.00% 34 13 0.00% 35 20 0.00% 36 11 0.00% 37 17 0.00% 38 9 0.00% 39 29 0.00% 40 17 0.00% 41 27 0.00% 42 27 0.00% 43 24 0.00% 44 35 0.00% 45 41 0.00% 46 38 0.00% 47 49 0.00% 48 66 0.00% 49 71 0.00% 50 81 0.00% 51 104 0.00% 52 90 0.00% 53 97 0.00% 54 126 0.00% 55 123 0.00% 56 149 0.00% 57 173 0.00% 58 218 0.00% 59 232 0.00% 60 282 0.00% 61 328 0.00% 62 348 0.00% 63 395 0.00% 64 450 0.00% 65 495 0.00% 66 604 0.00% 67 644 0.00% 68 782 0.01% 69 1274 0.01% 70 1248 0.01% 71 1093 0.01% 72 1168 0.01% 73 1409 0.01% 74 1524 0.01% 75 1670 0.01% 76 1898 0.01% 77 2135 0.02% 78 2274 0.02% 79 2618 0.02% 80 2898 0.02% 81 3281 0.02% 82 4174 0.03% 83 4287 0.03% 84 5982 0.04% 85 7164 0.05% 86 7511 0.05% 87 7959 0.06% 88 8372 0.06% 89 8916 0.06% 90 9447 0.07% 91 9724 0.07% 92 10383 0.07% 93 11330 0.08% 94 12095 0.09% 95 12834 0.09% 96 13551 0.10% 97 14189 0.10% 98 14570 0.10% 99 15705 0.11% 100 16591 0.12% 101 17324 0.12% 102 18684 0.13% 103 19426 0.14% 104 20540 0.15% 105 21854 0.15% 106 22522 0.16% 107 23526 0.17% 108 24514 0.17% 109 25386 0.18% 110 26548 0.19% 111 27466 0.19% 112 28547 0.20% 113 30151 0.21% 114 31417 0.22% 115 33050 0.23% 116 33801 0.24% 117 34589 0.24% 118 35655 0.25% 119 36692 0.26% 120 38212 0.27% 121 39043 0.28% 122 41120 0.29% 123 42828 0.30% 124 44510 0.31% 125 46347 0.33% 126 47942 0.34% 127 49278 0.35% 128 50348 0.36% 129 52269 0.37% 130 54067 0.38% 131 55430 0.39% 132 57917 0.41% 133 61096 0.43% 134 63759 0.45% 135 66787 0.47% 136 69286 0.49% 137 72667 0.51% 138 75776 0.54% 139 79694 0.56% 140 83920 0.59% 141 90148 0.64% 142 98585 0.70% 143 108258 0.77% 144 121594 0.86% 145 141174 1.00% 146 170030 1.20% 147 220628 1.56% 148 319105 2.26% 149 600467 4.24% 150 3126775 22.10% 151 7221913 51.04% 14148264 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=13 prefix-density=0.64 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=67.42 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.0 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=18 prefix-density=0.61 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=10.25 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.9 sequence=CAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7230774 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 01:03:32 Started mapping on | Feb 11 01:03:32 Finished on | Feb 11 01:05:18 Mapping speed, Million of reads per hour | 480.51 Number of input reads | 14148264 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 12960154 Uniquely mapped reads % | 91.60% Average mapped length | 291.74 Number of splices: Total | 12117600 Number of splices: Annotated (sjdb) | 11880963 Number of splices: GT/AG | 11871596 Number of splices: GC/AG | 208178 Number of splices: AT/AC | 6838 Number of splices: Non-canonical | 30988 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 355469 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 98071 % of reads mapped to too many loci | 0.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.04% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 861040 861040 861040 N_multimapping 355469 355469 355469 N_noFeature 458616 12728447 554549 N_ambiguous 216434 1026 80001 UnstrandedReadsAssigned:12285104 PositiveStrandReadsAssigned:230681 NegativeStrandReadsAssigned:12325604 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7230774 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230774-trimmed-pair1.fastq SRR7230774-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,148,264 reads, 12,414,550 reads pseudoaligned [quant] estimated average fragment length: 232.437 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,049 rounds 52401 SRR7230774.ke.tsv 34699 SRR7230774.se.tsv 87100 total ==> SRR7230774.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.56 375 15.8561 Potri.005G024800.1.v4.1 1035 803.563 86 8.08469 Potri.004G059700.1.v4.1 961 729.593 17 1.76016 Potri.007G009000.2.v4.1 1416 1184.56 0 0 Potri.003G141000.2.v4.1 2943 2711.56 918.499 25.5884 Potri.016G087400.1.v4.1 270 87.9624 543.702 466.927 Potri.015G069301.1.v4.1 564 338.473 0 0 Potri.010G195200.1.v4.1 1773 1541.56 20 0.980062 Potri.012G127500.1.v4.1 977 745.573 78 7.90295 ==> SRR7230774.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1080 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 322 Potri.001G212900.v4.1 17 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 25 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7230774 completed mapping pipeline successfully