Starting /dee2/code/volunteer_pipeline.sh SRR7230775 current disk space = 3057418960896 free memory = 1149518636 SRR7230775 SRAfilesize 1bfeee338e6ac50ae405b2b74feb8bb7 SRR7230775.sra SRR7230775.sra file validated SRR7230775 is paired end SRR7230775 is conventional basespace SRR7230775 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230775_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.88375 34.0 33.0 34.0 32.0 34.0 2 32.934 34.0 33.0 34.0 32.0 34.0 3 33.0195 34.0 33.0 34.0 32.0 34.0 4 33.03825 34.0 33.0 34.0 32.0 34.0 5 33.10325 34.0 33.0 34.0 32.0 34.0 6 36.81475 38.0 37.0 38.0 35.0 38.0 7 37.20825 38.0 38.0 38.0 36.0 38.0 8 37.2795 38.0 38.0 38.0 37.0 38.0 9 37.3985 38.0 38.0 38.0 37.0 38.0 10-14 37.3485 38.0 38.0 38.0 37.0 38.0 15-19 37.269850000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.076649999999994 38.0 38.0 38.0 36.2 38.0 25-29 36.96235 38.0 38.0 38.0 36.0 38.0 30-34 36.951 38.0 38.0 38.0 36.0 38.0 35-39 37.034600000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.9901 38.0 38.0 38.0 36.0 38.0 45-49 36.924350000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.8972 38.0 38.0 38.0 35.6 38.0 55-59 36.7421 38.0 38.0 38.0 35.0 38.0 60-64 36.6473 38.0 38.0 38.0 34.8 38.0 65-69 36.635000000000005 38.0 38.0 38.0 34.8 38.0 70-74 36.13225 38.0 37.4 38.0 32.2 38.0 75-79 36.36710000000001 38.0 37.8 38.0 33.8 38.0 80-84 36.36055 38.0 38.0 38.0 34.0 38.0 85-89 36.2091 38.0 37.8 38.0 33.8 38.0 90-94 36.05225 38.0 37.2 38.0 33.2 38.0 95-99 35.77435 38.0 36.8 38.0 31.2 38.0 100-104 35.375299999999996 38.0 36.8 38.0 29.4 38.0 105-109 34.812200000000004 38.0 35.8 38.0 26.2 38.0 110-114 35.36945000000001 38.0 36.0 38.0 29.6 38.0 115-119 34.980650000000004 38.0 35.8 38.0 27.4 38.0 120-124 34.92405 38.0 35.8 38.0 27.8 38.0 125-129 34.31325 38.0 34.8 38.0 24.8 38.0 130-134 33.905049999999996 38.0 34.6 38.0 21.4 38.0 135-139 33.182399999999994 38.0 33.8 38.0 17.4 38.0 140-144 32.572 38.0 32.6 38.0 14.0 38.0 145-149 31.239250000000006 37.0 31.0 38.0 8.6 38.0 150-151 26.228125 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 1.0 7 1.0 8 1.0 9 1.0 10 3.0 11 3.0 12 3.0 13 0.0 14 1.0 15 2.0 16 3.0 17 6.0 18 3.0 19 8.0 20 4.0 21 9.0 22 14.0 23 11.0 24 13.0 25 32.0 26 39.0 27 33.0 28 44.0 29 38.0 30 63.0 31 90.0 32 106.0 33 167.0 34 212.0 35 394.0 36 753.0 37 1941.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.61819129528277 16.73182173573104 9.955694553036226 28.694292415949963 2 21.625 19.075 32.725 26.575 3 17.875 27.375 28.549999999999997 26.200000000000003 4 21.525 32.625 24.45 21.4 5 20.325 37.724999999999994 23.05 18.9 6 18.725 35.675000000000004 25.025 20.575 7 15.0 23.325000000000003 43.85 17.825 8 16.575 24.65 29.95 28.825 9 16.425 26.55 31.45 25.575 10-14 20.205000000000002 29.695 26.515 23.585 15-19 19.85 29.48 26.69 23.98 20-24 19.900000000000002 29.785 26.46 23.855 25-29 20.125 28.93 27.51 23.435 30-34 20.165 29.185 27.195000000000004 23.455000000000002 35-39 20.23 28.375 27.544999999999998 23.849999999999998 40-44 20.555 29.325000000000003 26.650000000000002 23.47 45-49 20.265 28.59 27.46 23.685000000000002 50-54 20.105 28.77 27.67 23.455000000000002 55-59 20.18 27.935 27.639999999999997 24.245 60-64 20.7 28.444999999999997 27.615000000000002 23.24 65-69 20.49 28.38 27.889999999999997 23.24 70-74 19.755 28.645 27.3 24.3 75-79 19.86 28.485 27.625 24.03 80-84 20.18105431629489 28.50855256576973 27.20816244873462 24.10223066920076 85-89 20.39661475286694 28.328909810205822 27.031899444138414 24.242575992788822 90-94 20.64580725907384 28.550688360450565 27.033792240300375 23.76971214017522 95-99 20.630000000000003 28.235 27.01 24.125 100-104 20.9374686339456 28.545618789521228 27.090233865301617 23.426678711231556 105-109 21.172344689378757 28.12625250501002 27.019038076152302 23.682364729458918 110-114 20.595 28.360000000000003 27.145000000000003 23.9 115-119 21.275 28.299999999999997 26.729999999999997 23.695 120-124 20.965 28.225 27.045 23.765 125-129 21.095 27.98 26.87 24.055 130-134 21.044999999999998 28.375 26.22 24.36 135-139 20.93 28.389999999999997 26.575 24.104999999999997 140-144 21.955 27.99 25.985000000000003 24.07 145-149 21.071053552677636 27.726386319315964 26.32131606580329 24.88124406220311 150-151 21.325 28.462500000000002 25.5625 24.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 1.0 14 1.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 0.5 23 1.0 24 3.0 25 5.5 26 4.5 27 8.5 28 13.5 29 16.5 30 24.5 31 37.0 32 48.5 33 49.5 34 59.5 35 77.0 36 91.5 37 116.0 38 132.0 39 146.5 40 181.0 41 217.0 42 223.0 43 240.5 44 257.0 45 242.5 46 241.0 47 224.0 48 209.0 49 207.5 50 181.0 51 153.5 52 122.0 53 94.0 54 85.5 55 67.0 56 52.5 57 41.5 58 30.0 59 26.5 60 21.0 61 12.0 62 7.0 63 5.5 64 2.0 65 1.5 66 3.0 67 3.5 68 1.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.03 85-89 0.155 90-94 0.125 95-99 0.0 100-104 0.37 105-109 0.2 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26915322580645 98.475 2 0.655241935483871 1.3 3 0.07560483870967742 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.8999999999999999 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.3625 0.0 0.0 0.0 0.0 108-109 1.55 0.0 0.0 0.0 0.0 110-111 1.7375 0.0 0.0 0.0 0.0 112-113 2.075 0.0 0.0 0.0 0.0 114-115 2.3 0.0 0.0 0.0 0.0 116-117 2.525 0.0 0.0 0.0 0.0 118-119 2.9 0.0 0.0 0.0 0.0 120-121 3.3 0.0 0.0 0.0 0.0 122-123 3.675 0.0 0.0 0.0 0.0 124-125 4.125 0.0 0.0 0.0 0.0 126-127 4.5625 0.0 0.0 0.0 0.0 128-129 5.0375 0.0 0.0 0.0 0.0 130-131 5.5 0.0 0.0 0.0 0.0 132-133 5.975 0.0 0.0 0.0 0.0 134-135 6.625 0.0 0.0 0.0 0.0 136-137 7.225 0.0 0.0 0.0 0.0 138-139 7.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGATC 10 0.0069339755 144.27501 2 >>END_MODULE SRR7230775 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230775_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.75025 33.0 33.0 34.0 32.0 34.0 2 32.87625 34.0 33.0 34.0 32.0 34.0 3 32.813 34.0 33.0 34.0 32.0 34.0 4 32.6825 34.0 33.0 34.0 32.0 34.0 5 32.6665 34.0 33.0 34.0 32.0 34.0 6 36.74125 38.0 38.0 38.0 36.0 38.0 7 36.80375 38.0 38.0 38.0 36.0 38.0 8 36.8195 38.0 38.0 38.0 36.0 38.0 9 36.824 38.0 38.0 38.0 36.0 38.0 10-14 36.343650000000004 38.0 37.8 38.0 34.0 38.0 15-19 36.6452 38.0 38.0 38.0 35.8 38.0 20-24 36.61585 38.0 38.0 38.0 36.0 38.0 25-29 36.54109999999999 38.0 38.0 38.0 35.6 38.0 30-34 36.2793 38.0 38.0 38.0 33.6 38.0 35-39 36.494550000000004 38.0 38.0 38.0 35.4 38.0 40-44 36.4212 38.0 38.0 38.0 35.0 38.0 45-49 36.2717 38.0 38.0 38.0 34.4 38.0 50-54 36.4349 38.0 38.0 38.0 35.0 38.0 55-59 36.4605 38.0 38.0 38.0 35.2 38.0 60-64 36.37295 38.0 38.0 38.0 34.8 38.0 65-69 36.3639 38.0 38.0 38.0 35.0 38.0 70-74 36.10125000000001 38.0 38.0 38.0 33.8 38.0 75-79 36.14045 38.0 38.0 38.0 34.0 38.0 80-84 36.0931 38.0 38.0 38.0 34.0 38.0 85-89 35.982150000000004 38.0 38.0 38.0 33.8 38.0 90-94 35.71695 38.0 37.8 38.0 31.8 38.0 95-99 35.697950000000006 38.0 38.0 38.0 32.6 38.0 100-104 35.65755 38.0 37.8 38.0 32.6 38.0 105-109 35.112199999999994 38.0 36.8 38.0 28.8 38.0 110-114 35.0649 38.0 36.6 38.0 28.2 38.0 115-119 35.0064 38.0 36.6 38.0 28.6 38.0 120-124 34.9011 38.0 36.4 38.0 28.0 38.0 125-129 34.22924999999999 38.0 35.4 38.0 23.8 38.0 130-134 33.39855 38.0 34.2 38.0 19.2 38.0 135-139 32.92475 38.0 33.8 38.0 15.8 38.0 140-144 32.42725 38.0 32.4 38.0 13.6 38.0 145-149 31.52895 38.0 31.8 38.0 8.6 38.0 150-151 27.747374999999998 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 8.0 4 2.0 5 8.0 6 1.0 7 5.0 8 4.0 9 4.0 10 2.0 11 3.0 12 6.0 13 7.0 14 6.0 15 10.0 16 9.0 17 2.0 18 8.0 19 6.0 20 5.0 21 13.0 22 7.0 23 21.0 24 25.0 25 13.0 26 26.0 27 23.0 28 31.0 29 59.0 30 59.0 31 58.0 32 80.0 33 125.0 34 168.0 35 293.0 36 656.0 37 2226.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.925 20.625 12.475 20.974999999999998 2 25.8 24.0 31.324999999999996 18.875 3 22.45 27.05 31.474999999999998 19.025 4 23.7 35.175 22.675 18.45 5 24.3 37.45 21.025 17.224999999999998 6 19.525000000000002 37.724999999999994 23.275000000000002 19.475 7 19.15 20.875 38.525 21.45 8 22.025 23.200000000000003 27.875 26.900000000000002 9 21.9 25.624999999999996 28.575 23.9 10-14 23.635 28.115000000000002 26.450000000000003 21.8 15-19 24.16 27.29 27.41 21.14 20-24 23.400000000000002 27.560000000000002 27.92 21.12 25-29 23.62 28.275 27.284999999999997 20.82 30-34 23.445 27.96 27.42 21.175 35-39 22.895 27.79 27.975 21.34 40-44 23.990000000000002 28.025 27.450000000000003 20.535 45-49 23.525 27.560000000000002 27.735 21.18 50-54 23.189999999999998 27.750000000000004 27.735 21.325 55-59 23.77 26.845000000000002 27.74 21.645 60-64 23.724999999999998 27.165 28.305000000000003 20.805 65-69 23.705000000000002 26.93 28.37 20.995 70-74 24.325 27.235 28.04 20.4 75-79 24.185000000000002 26.484999999999996 28.134999999999998 21.195 80-84 23.39 27.589999999999996 27.915 21.105 85-89 23.915 26.889999999999997 27.98 21.215 90-94 23.73 27.3 27.845 21.125 95-99 23.62 27.42 28.12 20.84 100-104 23.94 27.889999999999997 27.54 20.630000000000003 105-109 24.13 27.750000000000004 27.3 20.82 110-114 24.104999999999997 28.384999999999998 27.474999999999998 20.035 115-119 24.415 27.675 27.71 20.200000000000003 120-124 24.560000000000002 27.54 27.500000000000004 20.4 125-129 24.64 27.975 27.439999999999998 19.945 130-134 25.16 27.51 26.905 20.424999999999997 135-139 25.025 27.555000000000003 27.155 20.265 140-144 26.029999999999998 26.96 27.35 19.66 145-149 25.45 27.655 26.924999999999997 19.97 150-151 25.887500000000003 27.375 26.7625 19.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 1.0 21 2.0 22 1.0 23 2.0 24 3.5 25 2.5 26 5.0 27 6.0 28 6.0 29 12.0 30 16.0 31 19.5 32 26.0 33 33.5 34 42.5 35 51.0 36 71.5 37 89.5 38 117.5 39 156.0 40 180.0 41 211.0 42 240.0 43 256.0 44 255.0 45 253.0 46 268.5 47 258.5 48 229.5 49 208.0 50 172.0 51 138.5 52 119.5 53 117.0 54 107.0 55 78.5 56 58.5 57 45.0 58 35.5 59 30.5 60 20.0 61 13.5 62 13.0 63 7.5 64 3.5 65 2.5 66 2.0 67 1.5 68 1.5 69 1.0 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21776431995963 98.3 2 0.6813020439061317 1.35 3 0.0757002271006813 0.22499999999999998 4 0.0 0.0 5 0.025233409033560434 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.1375 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.6375000000000002 0.0 0.0 0.0 0.0 110-111 1.8125 0.0 0.0 0.0 0.0 112-113 2.1500000000000004 0.0 0.0 0.0 0.0 114-115 2.4000000000000004 0.0 0.0 0.0 0.0 116-117 2.6125 0.0 0.0 0.0 0.0 118-119 3.025 0.0 0.0 0.0 0.0 120-121 3.45 0.0 0.0 0.0 0.0 122-123 3.8 0.0 0.0 0.0 0.0 124-125 4.2375 0.0 0.0 0.0 0.0 126-127 4.6625 0.0 0.0 0.0 0.0 128-129 5.125 0.0 0.0 0.0 0.0 130-131 5.575 0.0 0.0 0.0 0.0 132-133 6.0375 0.0 0.0 0.0 0.0 134-135 6.7 0.0 0.0 0.0 0.0 136-137 7.325 0.0 0.0 0.0 0.0 138-139 8.087499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGATCC 10 0.006830828 145.0 2 CCTCTTG 10 0.006830828 145.0 5 >>END_MODULE Read 822810 spots for SRR7230775.sra Written 822810 spots for SRR7230775.sra Read 822810 spots for SRR7230775.sra Written 822810 spots for SRR7230775.sra Read 822810 spots for SRR7230775.sra Written 822810 spots for SRR7230775.sra Read 822810 spots for SRR7230775.sra Written 822810 spots for SRR7230775.sra Read 822810 spots for SRR7230775.sra Written 822810 spots for SRR7230775.sra Read 822810 spots for SRR7230775.sra Written 822810 spots for SRR7230775.sra Read 822810 spots for SRR7230775.sra Written 822810 spots for SRR7230775.sra Read 822810 spots for SRR7230775.sra Written 822810 spots for SRR7230775.sra Read 822810 spots for SRR7230775.sra Written 822810 spots for SRR7230775.sra Read 822810 spots for SRR7230775.sra Written 822810 spots for SRR7230775.sra Read 822810 spots for SRR7230775.sra Written 822810 spots for SRR7230775.sra Read 822810 spots for SRR7230775.sra Written 822810 spots for SRR7230775.sra Read 822810 spots for SRR7230775.sra Written 822810 spots for SRR7230775.sra Read 822810 spots for SRR7230775.sra Written 822810 spots for SRR7230775.sra Read 822810 spots for SRR7230775.sra Written 822810 spots for SRR7230775.sra Read 822825 spots for SRR7230775.sra Written 822825 spots for SRR7230775.sra Read 822810 spots for SRR7230775.sra Written 822810 spots for SRR7230775.sra Read 822810 spots for SRR7230775.sra Written 822810 spots for SRR7230775.sra Read 822810 spots for SRR7230775.sra Written 822810 spots for SRR7230775.sra Read 822810 spots for SRR7230775.sra Written 822810 spots for SRR7230775.sra SRR ids: ['SRR7230775.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3zoajqou SRR7230775.sra spots: 16456215 blocks: [[1, 822810], [822811, 1645620], [1645621, 2468430], [2468431, 3291240], [3291241, 4114050], [4114051, 4936860], [4936861, 5759670], [5759671, 6582480], [6582481, 7405290], [7405291, 8228100], [8228101, 9050910], [9050911, 9873720], [9873721, 10696530], [10696531, 11519340], [11519341, 12342150], [12342151, 13164960], [13164961, 13987770], [13987771, 14810580], [14810581, 15633390], [15633391, 16456215]] SRR7230775 file size 5554770 SRR7230775 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230775 SRR7230775_1.fastq SRR7230775_2.fastq Input file: SRR7230775_1.fastq Paired file: SRR7230775_2.fastq trimmed: SRR7230775-trimmed-pair1.fastq, SRR7230775-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:12:54 2025 >> started Tue Feb 11 00:13:13 2025 >> done (18.617s) 16456215 read pairs processed; of these: 44353 ( 0.27%) short read pairs filtered out after trimming by size control 33670 ( 0.20%) empty read pairs filtered out after trimming by size control 16378192 (99.53%) read pairs available; of these: 9301676 (56.79%) trimmed read pairs available after processing 7076516 (43.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 5 0.00% 21 10 0.00% 22 12 0.00% 23 18 0.00% 24 42 0.00% 25 13 0.00% 26 21 0.00% 27 24 0.00% 28 21 0.00% 29 13 0.00% 30 36 0.00% 31 19 0.00% 32 29 0.00% 33 25 0.00% 34 22 0.00% 35 32 0.00% 36 21 0.00% 37 30 0.00% 38 33 0.00% 39 33 0.00% 40 43 0.00% 41 45 0.00% 42 49 0.00% 43 48 0.00% 44 62 0.00% 45 69 0.00% 46 62 0.00% 47 74 0.00% 48 87 0.00% 49 103 0.00% 50 123 0.00% 51 131 0.00% 52 137 0.00% 53 133 0.00% 54 186 0.00% 55 188 0.00% 56 194 0.00% 57 225 0.00% 58 286 0.00% 59 305 0.00% 60 331 0.00% 61 409 0.00% 62 396 0.00% 63 475 0.00% 64 510 0.00% 65 561 0.00% 66 644 0.00% 67 745 0.00% 68 1042 0.01% 69 2353 0.01% 70 2718 0.02% 71 1710 0.01% 72 1505 0.01% 73 1638 0.01% 74 1694 0.01% 75 1859 0.01% 76 2011 0.01% 77 2223 0.01% 78 2358 0.01% 79 2795 0.02% 80 3047 0.02% 81 3518 0.02% 82 3950 0.02% 83 4718 0.03% 84 6749 0.04% 85 7803 0.05% 86 8243 0.05% 87 8968 0.05% 88 9370 0.06% 89 9839 0.06% 90 10452 0.06% 91 11184 0.07% 92 11712 0.07% 93 12488 0.08% 94 13246 0.08% 95 14030 0.09% 96 14519 0.09% 97 15204 0.09% 98 15881 0.10% 99 16745 0.10% 100 18137 0.11% 101 18836 0.12% 102 20544 0.13% 103 22008 0.13% 104 23123 0.14% 105 24609 0.15% 106 25505 0.16% 107 26491 0.16% 108 27616 0.17% 109 29162 0.18% 110 30205 0.18% 111 31735 0.19% 112 33708 0.21% 113 35834 0.22% 114 37069 0.23% 115 38810 0.24% 116 40556 0.25% 117 41733 0.25% 118 43071 0.26% 119 44220 0.27% 120 45942 0.28% 121 47758 0.29% 122 50405 0.31% 123 53833 0.33% 124 55788 0.34% 125 58313 0.36% 126 60443 0.37% 127 62227 0.38% 128 64275 0.39% 129 67767 0.41% 130 69766 0.43% 131 73161 0.45% 132 77279 0.47% 133 81280 0.50% 134 85479 0.52% 135 91379 0.56% 136 94970 0.58% 137 100550 0.61% 138 107954 0.66% 139 114027 0.70% 140 121128 0.74% 141 133568 0.82% 142 145235 0.89% 143 163280 1.00% 144 187914 1.15% 145 219639 1.34% 146 270284 1.65% 147 357378 2.18% 148 521186 3.18% 149 975581 5.96% 150 3898254 23.80% 151 7076516 43.21% 16378192 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=13 prefix-density=0.57 prefix-fanout=2.5 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=68.66 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.2 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=27 prefix-density=0.41 prefix-fanout=1.9 sequence=CTACCCATGTTTGGATGCACTGAGGCATCTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=72.96 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=3.8 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT SRR7230775 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:14:03 Started mapping on | Feb 11 00:14:03 Finished on | Feb 11 00:15:57 Mapping speed, Million of reads per hour | 517.21 Number of input reads | 16378192 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 14914035 Uniquely mapped reads % | 91.06% Average mapped length | 291.02 Number of splices: Total | 13477971 Number of splices: Annotated (sjdb) | 13185989 Number of splices: GT/AG | 13200832 Number of splices: GC/AG | 228312 Number of splices: AT/AC | 8316 Number of splices: Non-canonical | 40511 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 514569 % of reads mapped to multiple loci | 3.14% Number of reads mapped to too many loci | 134989 % of reads mapped to too many loci | 0.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.79% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 990587 990587 990587 N_multimapping 514569 514569 514569 N_noFeature 480859 14645503 575734 N_ambiguous 279323 1000 105155 UnstrandedReadsAssigned:14153853 PositiveStrandReadsAssigned:267532 NegativeStrandReadsAssigned:14233146 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7230775 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230775-trimmed-pair1.fastq SRR7230775-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,378,192 reads, 14,409,529 reads pseudoaligned [quant] estimated average fragment length: 229.28 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52401 SRR7230775.ke.tsv 34699 SRR7230775.se.tsv 87100 total ==> SRR7230775.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.72 602 20.5539 Potri.005G024800.1.v4.1 1035 806.72 212 16.0581 Potri.004G059700.1.v4.1 961 732.745 8 0.667144 Potri.007G009000.2.v4.1 1416 1187.72 2 0.102896 Potri.003G141000.2.v4.1 2943 2714.72 784 17.6471 Potri.016G087400.1.v4.1 270 86.3619 680.463 481.465 Potri.015G069301.1.v4.1 564 340.437 0 0 Potri.010G195200.1.v4.1 1773 1544.72 220 8.70272 Potri.012G127500.1.v4.1 977 748.74 271 22.1167 ==> SRR7230775.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 713 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 369 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 180 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7230775 completed mapping pipeline successfully