Starting /dee2/code/volunteer_pipeline.sh SRR7230776 current disk space = 3057072472064 free memory = 1574651412 SRR7230776 SRAfilesize 5dac647b17919620f424d7d6f64c03a2 SRR7230776.sra SRR7230776.sra file validated SRR7230776 is paired end SRR7230776 is conventional basespace SRR7230776 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230776_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.4795 34.0 34.0 34.0 33.0 34.0 2 33.5755 34.0 34.0 34.0 33.0 34.0 3 33.5425 34.0 34.0 34.0 33.0 34.0 4 33.496 34.0 34.0 34.0 33.0 34.0 5 33.52825 34.0 34.0 34.0 33.0 34.0 6 37.38125 38.0 38.0 38.0 37.0 38.0 7 37.56275 38.0 38.0 38.0 37.0 38.0 8 37.65175 38.0 38.0 38.0 38.0 38.0 9 37.66325 38.0 38.0 38.0 38.0 38.0 10-14 37.70015 38.0 38.0 38.0 38.0 38.0 15-19 37.3724 38.0 38.0 38.0 37.2 38.0 20-24 37.62734999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.6514 38.0 38.0 38.0 38.0 38.0 30-34 37.591300000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.385999999999996 38.0 38.0 38.0 37.6 38.0 40-44 37.10875 38.0 38.0 38.0 36.6 38.0 45-49 37.102700000000006 38.0 38.0 38.0 36.4 38.0 50-54 36.8291 38.0 37.8 38.0 34.8 38.0 55-59 37.3698 38.0 38.0 38.0 37.0 38.0 60-64 37.3916 38.0 38.0 38.0 37.0 38.0 65-69 37.3578 38.0 38.0 38.0 37.0 38.0 70-74 32.619350000000004 38.0 26.8 38.0 15.8 38.0 75-79 33.0732 38.0 36.4 38.0 14.2 38.0 80-84 35.44930000000001 38.0 38.0 38.0 30.2 38.0 85-89 36.43665 38.0 38.0 38.0 34.2 38.0 90-94 36.7464 38.0 38.0 38.0 35.2 38.0 95-99 36.81204999999999 38.0 38.0 38.0 35.4 38.0 100-104 35.818149999999996 38.0 36.8 38.0 30.4 38.0 105-109 36.41185 38.0 37.8 38.0 33.8 38.0 110-114 36.01495 38.0 37.6 38.0 32.6 38.0 115-119 36.369299999999996 38.0 38.0 38.0 34.0 38.0 120-124 35.45825 38.0 36.2 38.0 28.4 38.0 125-129 35.632549999999995 38.0 36.4 38.0 31.0 38.0 130-134 34.99125 38.0 35.6 38.0 26.6 38.0 135-139 35.329150000000006 38.0 35.4 38.0 30.2 38.0 140-144 34.6931 38.0 35.0 38.0 27.4 38.0 145-149 33.95655 38.0 34.2 38.0 24.0 38.0 150-151 30.36725 35.5 28.5 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 3.0 17 1.0 18 0.0 19 6.0 20 4.0 21 4.0 22 6.0 23 2.0 24 11.0 25 11.0 26 13.0 27 16.0 28 27.0 29 51.0 30 41.0 31 57.0 32 92.0 33 152.0 34 225.0 35 372.0 36 798.0 37 2104.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.375 14.2 11.075 41.349999999999994 2 20.3 20.225 37.3 22.175 3 19.25 25.474999999999998 26.650000000000002 28.625 4 22.725 33.475 21.2 22.6 5 22.6 36.0 23.974999999999998 17.424999999999997 6 17.22930732683171 36.134033508377094 25.881470367591895 20.7551887971993 7 13.825000000000001 22.975 44.6 18.6 8 17.0 22.775000000000002 32.45 27.775 9 17.275 23.549999999999997 33.4 25.775 10-14 19.545 29.54 27.295 23.62 15-19 19.49 27.96 27.985 24.565 20-24 19.855 28.84 27.625 23.68 25-29 19.62 29.099999999999998 27.52 23.76 30-34 20.125 28.945 27.32 23.61 35-39 20.126100880704563 28.537830264211365 27.697157726180944 23.63891112890312 40-44 19.80644837787695 28.23547109261395 28.51627137341423 23.44180915609487 45-49 20.307030703070307 28.232823282328233 27.63776377637764 23.82238223822382 50-54 19.91 29.18 27.435 23.474999999999998 55-59 19.96798719487795 28.876550620248096 27.531012404961984 23.624449779911966 60-64 19.965 28.134999999999998 27.894999999999996 24.005000000000003 65-69 19.76494123530883 28.882220555138783 27.881970492623154 23.470867716929234 70-74 20.20138809875981 27.722152690863577 28.3706906360223 23.70576857435431 75-79 20.204319582477375 28.316029093331853 27.988451501859974 23.491199822330795 80-84 20.566233766233765 28.23896103896104 27.54285714285714 23.65194805194805 85-89 20.408163265306122 28.35926449787836 27.38432006465953 23.84825217215599 90-94 20.743111466720006 28.42926438965845 27.474121118167727 23.35350302545382 95-99 20.115028757189297 28.217054263565895 27.686921730432605 23.980995248812203 100-104 20.53271917088069 28.828919040704953 27.111600660892204 23.526761127522157 105-109 20.93325990086617 28.343263405597558 27.02147899664547 23.701997696890803 110-114 21.26594946209657 28.276207155366524 27.285464098073554 23.17237928446335 115-119 20.955477738869437 28.86943471735868 26.678339169584792 23.496748374187092 120-124 20.61 28.615000000000002 27.245 23.53 125-129 21.213031076414953 28.078867036981435 26.627633488465197 24.080468398138418 130-134 21.329056830710634 28.75613911997594 25.87451137616518 24.04029267314824 135-139 21.613241986297947 28.124218632794918 26.478971845776865 23.78356753513027 140-144 21.393557422969188 28.591436574629853 26.355542216886757 23.659463785514205 145-149 21.14028507126782 28.57214303575894 26.5666416604151 23.72093023255814 150-151 21.43035758939735 27.294323580895224 27.344336084021002 23.93098274568642 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 1.0 19 1.5 20 0.5 21 1.0 22 1.0 23 2.0 24 4.5 25 6.0 26 6.5 27 7.5 28 14.0 29 28.5 30 40.0 31 40.5 32 46.0 33 61.0 34 75.0 35 92.0 36 115.5 37 140.0 38 154.5 39 189.5 40 198.0 41 192.0 42 226.5 43 239.5 44 243.0 45 242.5 46 238.0 47 226.5 48 208.5 49 185.0 50 155.0 51 132.0 52 109.0 53 91.0 54 77.0 55 60.5 56 40.0 57 28.5 58 20.0 59 16.5 60 14.5 61 9.0 62 7.5 63 4.5 64 1.5 65 0.5 66 0.5 67 0.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.08 40-44 0.28500000000000003 45-49 0.01 50-54 0.0 55-59 0.04 60-64 0.0 65-69 0.025 70-74 12.11 75-79 9.945 80-84 3.75 85-89 1.02 90-94 0.015 95-99 0.025 100-104 0.135 105-109 0.135 110-114 0.075 115-119 0.05 120-124 0.0 125-129 0.08499999999999999 130-134 0.22999999999999998 135-139 0.015 140-144 0.04 145-149 0.025 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47076612903226 98.675 2 0.3024193548387097 0.6 3 0.20161290322580644 0.6 4 0.0 0.0 5 0.025201612903225805 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.9750000000000001 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.5 0.0 0.0 0.0 0.0 108-109 1.725 0.0 0.0 0.0 0.0 110-111 1.9749999999999999 0.0 0.0 0.0 0.0 112-113 2.375 0.0 0.0 0.0 0.0 114-115 2.7875 0.0 0.0 0.0 0.0 116-117 2.9749999999999996 0.0 0.0 0.0 0.0 118-119 3.2874999999999996 0.0 0.0 0.0 0.0 120-121 3.75 0.0 0.0 0.0 0.0 122-123 4.2875 0.0 0.0 0.0 0.0 124-125 4.825 0.0 0.0 0.0 0.0 126-127 5.4625 0.0 0.0 0.0 0.0 128-129 5.7875 0.0 0.0 0.0 0.0 130-131 6.362500000000001 0.0 0.0 0.0 0.0 132-133 7.0 0.0 0.0 0.0 0.0 134-135 7.6125 0.0 0.0 0.0 0.0 136-137 8.2 0.0 0.0 0.0 0.0 138-139 9.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7230776 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230776_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9455 34.0 33.0 34.0 32.0 34.0 2 33.06025 34.0 33.0 34.0 33.0 34.0 3 33.17675 34.0 33.0 34.0 33.0 34.0 4 33.14125 34.0 33.0 34.0 33.0 34.0 5 33.19475 34.0 33.0 34.0 33.0 34.0 6 37.30875 38.0 38.0 38.0 37.0 38.0 7 37.37975 38.0 38.0 38.0 38.0 38.0 8 37.30175 38.0 38.0 38.0 38.0 38.0 9 37.28 38.0 38.0 38.0 38.0 38.0 10-14 37.214549999999996 38.0 38.0 38.0 37.6 38.0 15-19 37.26005 38.0 38.0 38.0 37.8 38.0 20-24 37.25235 38.0 38.0 38.0 38.0 38.0 25-29 37.15755 38.0 38.0 38.0 37.6 38.0 30-34 37.127599999999994 38.0 38.0 38.0 37.6 38.0 35-39 36.935199999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.0257 38.0 38.0 38.0 37.0 38.0 45-49 37.0744 38.0 38.0 38.0 37.2 38.0 50-54 37.06635 38.0 38.0 38.0 37.2 38.0 55-59 36.77995 38.0 38.0 38.0 37.0 38.0 60-64 36.91315 38.0 38.0 38.0 36.8 38.0 65-69 36.80165 38.0 38.0 38.0 36.8 38.0 70-74 36.54265 38.0 38.0 38.0 35.8 38.0 75-79 36.8664 38.0 38.0 38.0 36.6 38.0 80-84 36.83225 38.0 38.0 38.0 36.6 38.0 85-89 36.81875 38.0 38.0 38.0 36.6 38.0 90-94 36.7372 38.0 38.0 38.0 36.0 38.0 95-99 36.61875 38.0 38.0 38.0 35.6 38.0 100-104 36.43429999999999 38.0 38.0 38.0 34.8 38.0 105-109 36.3464 38.0 38.0 38.0 34.6 38.0 110-114 36.33794999999999 38.0 38.0 38.0 34.2 38.0 115-119 36.30785 38.0 38.0 38.0 34.2 38.0 120-124 35.96125 38.0 38.0 38.0 33.6 38.0 125-129 35.82045 38.0 38.0 38.0 33.0 38.0 130-134 35.68235 38.0 37.8 38.0 32.6 38.0 135-139 35.135450000000006 38.0 36.2 38.0 30.4 38.0 140-144 34.856049999999996 38.0 36.0 38.0 29.6 38.0 145-149 33.8365 38.0 35.4 38.0 22.2 38.0 150-151 28.511875 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 7.0 4 4.0 5 2.0 6 3.0 7 4.0 8 2.0 9 1.0 10 2.0 11 1.0 12 1.0 13 1.0 14 3.0 15 4.0 16 2.0 17 4.0 18 5.0 19 6.0 20 8.0 21 10.0 22 6.0 23 11.0 24 12.0 25 15.0 26 9.0 27 20.0 28 23.0 29 30.0 30 35.0 31 35.0 32 51.0 33 50.0 34 121.0 35 210.0 36 480.0 37 2821.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.84582602155929 17.397844071195788 16.06919027325144 31.687139633993482 2 23.74749498997996 23.922845691382765 36.27254509018036 16.057114228456914 3 21.099999999999998 27.425 30.9 20.575 4 24.15 34.525 22.425 18.9 5 24.625 36.1 22.3 16.975 6 19.85 37.65 23.549999999999997 18.95 7 17.75 19.325 42.65 20.275000000000002 8 19.825 22.8 29.349999999999998 28.025 9 22.380595148787197 24.031007751937985 28.35708927231808 25.23130782695674 10-14 23.00265145830207 28.890889989494223 26.429536244934717 21.676922307269 15-19 23.15041768795958 27.487369316192282 28.122655194837677 21.239557801010456 20-24 23.06114279995997 28.404883418392874 27.639347543280294 20.894626238366858 25-29 23.056514992241077 27.94213345347149 27.656805326125045 21.344546228162386 30-34 22.89331465172138 27.517013610888714 28.447758206565254 21.14191353082466 35-39 22.85814430924841 28.240949376596063 27.765259626458366 21.13564668769716 40-44 23.15468147925737 27.558424660961816 28.168943602061752 21.117950257719063 45-49 22.732054300455843 28.69308220207384 27.515904423182892 21.05895907428743 50-54 23.236930479675205 27.732945717006668 27.98857200140344 21.04155180191469 55-59 22.499244484738593 27.949027903696987 28.21597662939458 21.33575098216984 60-64 22.681188516362177 28.041557920096366 27.87090945593254 21.406344107608913 65-69 23.0533199195171 27.515090543259557 28.033199195171026 21.398390342052316 70-74 23.054479601589616 27.67744856381106 27.813270285225617 21.454801549373713 75-79 23.504979232347495 27.80863734174048 27.568433168192964 21.117950257719063 80-84 23.11472121941436 28.24909747292419 27.496991576413958 21.139189731247495 85-89 23.481437005904134 28.229760832582805 27.744421094766338 20.544381066746723 90-94 23.962764626395074 27.155798008107702 27.991592012411793 20.88984535308543 95-99 23.33983886303358 27.888705399589654 27.793624580893763 20.97783115648301 100-104 24.149659863945576 27.55102040816326 27.696078431372552 20.603241296518608 105-109 23.633271645075776 27.854749162206772 27.879757915270343 20.63222127744711 110-114 23.863921038128165 28.047497369607694 27.661706498321557 20.42687509394258 115-119 23.74874874874875 28.16816816816817 27.77777777777778 20.305305305305303 120-124 23.779755951190236 28.290658131626323 27.725545109021805 20.204040808161633 125-129 24.108616292443866 28.20423063459519 26.8440266039906 20.843126468970347 130-134 24.64108848982042 27.947576409384222 27.337301785803614 20.074033314991745 135-139 25.060144346431436 27.611267040898156 27.405773857257422 19.92281475541299 140-144 25.386346586646663 27.921980495123783 26.911727931983 19.779944986246562 145-149 25.43635908977244 28.652163040760193 26.616654163540886 19.294823705926483 150-151 26.224999999999998 27.625 26.0375 20.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 2.0 20 1.5 21 1.0 22 1.0 23 2.5 24 3.0 25 3.5 26 4.5 27 7.0 28 13.5 29 14.0 30 13.5 31 23.5 32 30.5 33 32.5 34 46.5 35 70.5 36 93.5 37 105.5 38 125.0 39 159.5 40 196.5 41 215.5 42 246.5 43 259.0 44 255.5 45 267.0 46 269.0 47 250.0 48 222.5 49 201.0 50 167.5 51 142.5 52 117.0 53 96.5 54 85.0 55 69.5 56 50.5 57 39.5 58 31.0 59 22.0 60 14.0 61 10.0 62 7.5 63 2.5 64 0.5 65 0.0 66 0.0 67 0.0 68 1.0 69 1.5 70 1.0 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.055 15-19 0.045 20-24 0.06999999999999999 25-29 0.11499999999999999 30-34 0.08 35-39 0.145 40-44 0.08499999999999999 45-49 0.185 50-54 0.245 55-59 0.73 60-64 0.38 65-69 0.6 70-74 0.605 75-79 0.08499999999999999 80-84 0.27999999999999997 85-89 0.06999999999999999 90-94 0.095 95-99 0.08499999999999999 100-104 0.04 105-109 0.034999999999999996 110-114 0.20500000000000002 115-119 0.1 120-124 0.02 125-129 0.015 130-134 0.045 135-139 0.24 140-144 0.025 145-149 0.025 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19171507956554 98.175 2 0.6567314978529932 1.3 3 0.07577671129072998 0.22499999999999998 4 0.07577671129072998 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.9750000000000001 0.0 0.0 0.0 0.0 104-105 1.2625000000000002 0.0 0.0 0.0 0.0 106-107 1.4500000000000002 0.0 0.0 0.0 0.0 108-109 1.675 0.0 0.0 0.0 0.0 110-111 1.925 0.0 0.0 0.0 0.0 112-113 2.325 0.0 0.0 0.0 0.0 114-115 2.7125 0.0 0.0 0.0 0.0 116-117 2.9000000000000004 0.0 0.0 0.0 0.0 118-119 3.2125000000000004 0.0 0.0 0.0 0.0 120-121 3.675 0.0 0.0 0.0 0.0 122-123 4.2125 0.0 0.0 0.0 0.0 124-125 4.7375 0.0 0.0 0.0 0.0 126-127 5.387499999999999 0.0 0.0 0.0 0.0 128-129 5.725 0.0 0.0 0.0 0.0 130-131 6.3125 0.0 0.0 0.0 0.0 132-133 6.9125 0.0 0.0 0.0 0.0 134-135 7.5125 0.0 0.0 0.0 0.0 136-137 8.1125 0.0 0.0 0.0 0.0 138-139 9.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 743025 spots for SRR7230776.sra Written 743025 spots for SRR7230776.sra Read 743025 spots for SRR7230776.sra Written 743025 spots for SRR7230776.sra Read 743025 spots for SRR7230776.sra Written 743025 spots for SRR7230776.sra Read 743025 spots for SRR7230776.sra Written 743025 spots for SRR7230776.sra Read 743025 spots for SRR7230776.sra Written 743025 spots for SRR7230776.sra Read 743025 spots for SRR7230776.sra Written 743025 spots for SRR7230776.sra Read 743025 spots for SRR7230776.sra Written 743025 spots for SRR7230776.sra Read 743025 spots for SRR7230776.sra Written 743025 spots for SRR7230776.sra Read 743025 spots for SRR7230776.sra Written 743025 spots for SRR7230776.sra Read 743025 spots for SRR7230776.sra Written 743025 spots for SRR7230776.sra Read 743025 spots for SRR7230776.sra Written 743025 spots for SRR7230776.sra Read 743025 spots for SRR7230776.sra Written 743025 spots for SRR7230776.sra Read 743025 spots for SRR7230776.sra Written 743025 spots for SRR7230776.sra Read 743025 spots for SRR7230776.sra Written 743025 spots for SRR7230776.sra Read 743025 spots for SRR7230776.sra Written 743025 spots for SRR7230776.sra Read 743025 spots for SRR7230776.sra Written 743025 spots for SRR7230776.sra Read 743025 spots for SRR7230776.sra Written 743025 spots for SRR7230776.sra Read 743025 spots for SRR7230776.sra Written 743025 spots for SRR7230776.sra Read 743025 spots for SRR7230776.sra Written 743025 spots for SRR7230776.sra Read 743025 spots for SRR7230776.sra Written 743025 spots for SRR7230776.sra SRR ids: ['SRR7230776.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_404loxl_ SRR7230776.sra spots: 14860500 blocks: [[1, 743025], [743026, 1486050], [1486051, 2229075], [2229076, 2972100], [2972101, 3715125], [3715126, 4458150], [4458151, 5201175], [5201176, 5944200], [5944201, 6687225], [6687226, 7430250], [7430251, 8173275], [8173276, 8916300], [8916301, 9659325], [9659326, 10402350], [10402351, 11145375], [11145376, 11888400], [11888401, 12631425], [12631426, 13374450], [13374451, 14117475], [14117476, 14860500]] SRR7230776 file size 5014035 SRR7230776 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230776 SRR7230776_1.fastq SRR7230776_2.fastq Input file: SRR7230776_1.fastq Paired file: SRR7230776_2.fastq trimmed: SRR7230776-trimmed-pair1.fastq, SRR7230776-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 01:53:55 2025 >> started Tue Feb 11 02:02:47 2025 >> done (532.507s) 14860500 read pairs processed; of these: 13315 ( 0.09%) short read pairs filtered out after trimming by size control 10156 ( 0.07%) empty read pairs filtered out after trimming by size control 14837029 (99.84%) read pairs available; of these: 6491308 (43.75%) trimmed read pairs available after processing 8345721 (56.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 2 0.00% 21 3 0.00% 22 3 0.00% 23 4 0.00% 24 3 0.00% 25 6 0.00% 26 5 0.00% 27 11 0.00% 28 5 0.00% 29 10 0.00% 30 5 0.00% 31 10 0.00% 32 13 0.00% 33 10 0.00% 34 17 0.00% 35 5 0.00% 36 8 0.00% 37 18 0.00% 38 21 0.00% 39 22 0.00% 40 24 0.00% 41 23 0.00% 42 21 0.00% 43 28 0.00% 44 26 0.00% 45 35 0.00% 46 49 0.00% 47 29 0.00% 48 53 0.00% 49 64 0.00% 50 65 0.00% 51 100 0.00% 52 121 0.00% 53 158 0.00% 54 120 0.00% 55 130 0.00% 56 193 0.00% 57 192 0.00% 58 244 0.00% 59 222 0.00% 60 248 0.00% 61 272 0.00% 62 319 0.00% 63 374 0.00% 64 409 0.00% 65 442 0.00% 66 533 0.00% 67 590 0.00% 68 690 0.00% 69 1141 0.01% 70 1498 0.01% 71 1458 0.01% 72 1290 0.01% 73 1354 0.01% 74 1358 0.01% 75 1560 0.01% 76 1521 0.01% 77 1823 0.01% 78 2112 0.01% 79 2347 0.02% 80 2755 0.02% 81 3430 0.02% 82 3305 0.02% 83 3649 0.02% 84 5189 0.03% 85 5282 0.04% 86 5784 0.04% 87 6300 0.04% 88 6936 0.05% 89 7351 0.05% 90 8026 0.05% 91 8654 0.06% 92 9152 0.06% 93 9873 0.07% 94 10478 0.07% 95 11474 0.08% 96 12053 0.08% 97 13040 0.09% 98 13799 0.09% 99 14891 0.10% 100 15578 0.10% 101 15993 0.11% 102 17328 0.12% 103 18222 0.12% 104 19627 0.13% 105 20538 0.14% 106 21691 0.15% 107 22534 0.15% 108 24128 0.16% 109 25425 0.17% 110 26662 0.18% 111 27512 0.19% 112 28444 0.19% 113 29624 0.20% 114 30880 0.21% 115 32290 0.22% 116 33217 0.22% 117 34299 0.23% 118 36063 0.24% 119 37313 0.25% 120 38067 0.26% 121 39844 0.27% 122 41026 0.28% 123 43029 0.29% 124 43900 0.30% 125 45282 0.31% 126 47013 0.32% 127 47915 0.32% 128 50009 0.34% 129 51848 0.35% 130 53316 0.36% 131 55098 0.37% 132 57094 0.38% 133 58692 0.40% 134 60707 0.41% 135 62803 0.42% 136 65429 0.44% 137 68050 0.46% 138 71612 0.48% 139 75155 0.51% 140 78228 0.53% 141 82554 0.56% 142 88383 0.60% 143 95868 0.65% 144 106203 0.72% 145 120094 0.81% 146 140784 0.95% 147 178269 1.20% 148 257142 1.73% 149 488811 3.29% 150 3076872 20.74% 151 8345721 56.25% 14837029 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=18 prefix-density=0.56 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=39.48 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=7.7 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=17 prefix-density=0.52 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=30.85 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.8 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7230776 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 02:18:39 Started mapping on | Feb 11 02:19:10 Finished on | Feb 11 03:13:26 Mapping speed, Million of reads per hour | 16.40 Number of input reads | 14837029 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13857499 Uniquely mapped reads % | 93.40% Average mapped length | 292.79 Number of splices: Total | 13140651 Number of splices: Annotated (sjdb) | 12805456 Number of splices: GT/AG | 12876269 Number of splices: GC/AG | 215268 Number of splices: AT/AC | 8227 Number of splices: Non-canonical | 40887 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 360130 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 93798 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.41% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 634697 634697 634697 N_multimapping 360130 360130 360130 N_noFeature 635668 13568902 735692 N_ambiguous 291336 967 102237 UnstrandedReadsAssigned:12930495 PositiveStrandReadsAssigned:287630 NegativeStrandReadsAssigned:13019570 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7230776 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230776-trimmed-pair1.fastq SRR7230776-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,837,029 reads, 13,002,208 reads pseudoaligned [quant] estimated average fragment length: 232.842 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,020 rounds 52401 SRR7230776.ke.tsv 34699 SRR7230776.se.tsv 87100 total ==> SRR7230776.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.16 544 19.4511 Potri.005G024800.1.v4.1 1035 803.158 148 11.7687 Potri.004G059700.1.v4.1 961 729.2 7 0.613081 Potri.007G009000.2.v4.1 1416 1184.16 0 0 Potri.003G141000.2.v4.1 2943 2711.16 765.426 18.0308 Potri.016G087400.1.v4.1 270 87.4051 566 413.567 Potri.015G069301.1.v4.1 564 337.616 0 0 Potri.010G195200.1.v4.1 1773 1541.16 31 1.28464 Potri.012G127500.1.v4.1 977 745.184 76 6.51352 ==> SRR7230776.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 751 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 250 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7230776 completed mapping pipeline successfully