Starting /dee2/code/volunteer_pipeline.sh SRR7230777 current disk space = 3057220370432 free memory = 1509422120 SRR7230777 SRAfilesize 048a9c6b36a8b153fea4d9a13ec003d3 SRR7230777.sra SRR7230777.sra file validated SRR7230777 is paired end SRR7230777 is conventional basespace SRR7230777 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230777_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.46675 34.0 34.0 34.0 33.0 34.0 2 33.50375 34.0 34.0 34.0 33.0 34.0 3 33.527 34.0 34.0 34.0 33.0 34.0 4 33.44125 34.0 34.0 34.0 33.0 34.0 5 33.4575 34.0 34.0 34.0 33.0 34.0 6 37.21575 38.0 38.0 38.0 36.0 38.0 7 37.459 38.0 38.0 38.0 37.0 38.0 8 37.52425 38.0 38.0 38.0 38.0 38.0 9 37.6475 38.0 38.0 38.0 38.0 38.0 10-14 37.6656 38.0 38.0 38.0 38.0 38.0 15-19 37.36135 38.0 38.0 38.0 37.2 38.0 20-24 37.561899999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.5583 38.0 38.0 38.0 38.0 38.0 30-34 37.54325 38.0 38.0 38.0 38.0 38.0 35-39 37.22355 38.0 38.0 38.0 37.2 38.0 40-44 36.9851 38.0 38.0 38.0 36.4 38.0 45-49 37.0064 38.0 38.0 38.0 36.0 38.0 50-54 36.701800000000006 38.0 37.8 38.0 34.2 38.0 55-59 37.329 38.0 38.0 38.0 37.0 38.0 60-64 37.3249 38.0 38.0 38.0 37.0 38.0 65-69 37.27415 38.0 38.0 38.0 37.0 38.0 70-74 33.026399999999995 38.0 31.4 38.0 15.8 38.0 75-79 33.50065 38.0 36.4 38.0 19.2 38.0 80-84 35.56895 38.0 38.0 38.0 30.2 38.0 85-89 36.422650000000004 38.0 38.0 38.0 34.2 38.0 90-94 36.693 38.0 38.0 38.0 34.8 38.0 95-99 36.712399999999995 38.0 38.0 38.0 34.8 38.0 100-104 35.76655 38.0 36.8 38.0 30.2 38.0 105-109 36.24525 38.0 37.4 38.0 33.6 38.0 110-114 35.725100000000005 38.0 36.8 38.0 30.8 38.0 115-119 36.0993 38.0 37.4 38.0 33.6 38.0 120-124 35.4165 38.0 36.4 38.0 29.2 38.0 125-129 35.3043 38.0 36.0 38.0 29.4 38.0 130-134 34.896 38.0 35.2 38.0 26.0 38.0 135-139 35.080949999999994 38.0 35.4 38.0 29.4 38.0 140-144 34.436400000000006 38.0 35.0 38.0 26.6 38.0 145-149 33.772749999999995 38.0 34.0 38.0 23.8 38.0 150-151 30.02025 35.5 28.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 2.0 16 2.0 17 3.0 18 3.0 19 5.0 20 2.0 21 6.0 22 4.0 23 9.0 24 9.0 25 17.0 26 15.0 27 30.0 28 23.0 29 32.0 30 43.0 31 64.0 32 98.0 33 146.0 34 247.0 35 363.0 36 806.0 37 2067.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.35 15.7 10.7 37.25 2 21.575 21.224999999999998 35.949999999999996 21.25 3 17.724999999999998 27.750000000000004 26.174999999999997 28.349999999999998 4 22.2 34.849999999999994 22.2 20.75 5 20.925 38.224999999999994 23.0 17.849999999999998 6 16.60830415207604 36.743371685842924 26.413206603301653 20.23511755877939 7 13.175 21.15 46.9 18.775 8 17.275 22.425 30.325000000000003 29.975 9 17.7 22.825 33.75 25.724999999999998 10-14 19.68 29.335 27.139999999999997 23.845 15-19 19.86 28.71 27.405 24.025 20-24 19.994999999999997 28.82 27.750000000000004 23.435 25-29 19.985 28.999999999999996 27.43 23.585 30-34 19.915 28.67 27.925 23.49 35-39 20.005006257822277 28.430538172715895 27.5694618272841 23.994993742177723 40-44 19.886563268584048 29.056868945439945 27.59122622095066 23.465341565025348 45-49 20.176052815844752 28.44853456036811 27.52825847754326 23.847154146243874 50-54 20.03 27.834999999999997 28.605000000000004 23.53 55-59 20.1970197019702 28.657865786578657 27.752775277527753 23.392339233923394 60-64 20.064999999999998 28.92 27.46 23.555 65-69 19.756975697569757 28.452845284528454 28.14281428142814 23.647364736473648 70-74 20.467148378423794 28.4433988685375 27.737635131350473 23.35181762168823 75-79 20.03721744841552 28.367358108477912 28.482294346231736 23.11313009687483 80-84 20.124909672757305 28.078868586765772 28.342107979766695 23.45411376071023 85-89 20.486058589219986 28.266021277668536 27.76181112287601 23.486109010235467 90-94 20.07600380019001 28.711435571778587 27.551377568878443 23.661183059152957 95-99 20.7910395519776 27.811390569528477 28.356417820891046 23.04115205760288 100-104 20.35916162273023 28.287729478265216 28.257715972187487 23.09539292681707 105-109 20.28514257128564 28.86943471735868 27.99399699849925 22.851425712856425 110-114 20.623093464019604 28.294244136620495 28.489273391008652 22.593389008351252 115-119 20.587058705870586 28.79287928792879 27.667766776677666 22.95229522952295 120-124 20.005 29.060000000000002 27.485 23.45 125-129 20.543489140226203 29.091182063857474 26.764087678911018 23.601241117005305 130-134 20.56613226452906 28.992985971943884 27.329659318637272 23.11122244488978 135-139 20.9781467220083 28.149222383357504 27.404110616592487 23.46852027804171 140-144 20.11201120112011 28.557855785578557 28.002800280028 23.327332733273327 145-149 20.131072089649308 28.62574415928761 27.34503977187453 23.898143979188553 150-151 20.952619077384675 28.441055131891485 27.453431678959873 23.15289411176397 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 2.0 22 5.0 23 6.0 24 5.0 25 6.0 26 6.0 27 11.5 28 17.0 29 21.0 30 27.5 31 31.5 32 43.0 33 61.5 34 77.0 35 89.5 36 104.0 37 121.0 38 137.5 39 169.5 40 204.5 41 234.5 42 261.5 43 271.5 44 261.0 45 248.0 46 239.0 47 225.0 48 207.5 49 188.0 50 161.0 51 130.5 52 102.0 53 74.0 54 61.5 55 47.0 56 32.5 57 29.0 58 21.0 59 14.5 60 10.5 61 6.0 62 5.5 63 6.5 64 4.5 65 1.5 66 1.0 67 2.0 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.125 40-44 0.385 45-49 0.03 50-54 0.0 55-59 0.01 60-64 0.0 65-69 0.01 70-74 10.735 75-79 8.645 80-84 3.1300000000000003 85-89 0.835 90-94 0.005 95-99 0.005 100-104 0.045 105-109 0.05 110-114 0.015 115-119 0.01 120-124 0.0 125-129 0.09 130-134 0.2 135-139 0.015 140-144 0.01 145-149 0.055 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57286432160805 99.075 2 0.37688442211055273 0.75 3 0.02512562814070352 0.075 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.6625 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.1625 0.0 0.0 0.0 0.0 112-113 1.2374999999999998 0.0 0.0 0.0 0.0 114-115 1.425 0.0 0.0 0.0 0.0 116-117 1.6 0.0 0.0 0.0 0.0 118-119 1.8375 0.0 0.0 0.0 0.0 120-121 2.125 0.0 0.0 0.0 0.0 122-123 2.5374999999999996 0.0 0.0 0.0 0.0 124-125 2.9000000000000004 0.0 0.0 0.0 0.0 126-127 3.125 0.0 0.0 0.0 0.0 128-129 3.4 0.0 0.0 0.0 0.0 130-131 3.7125 0.0 0.0 0.0 0.0 132-133 3.9125 0.0 0.0 0.0 0.0 134-135 4.2625 0.0 0.0 0.0 0.0 136-137 4.4625 0.0 0.0 0.0 0.0 138-139 4.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7230777 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230777_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97225 34.0 33.0 34.0 32.0 34.0 2 33.1255 34.0 33.0 34.0 33.0 34.0 3 33.24975 34.0 33.0 34.0 33.0 34.0 4 33.14475 34.0 33.0 34.0 33.0 34.0 5 33.15375 34.0 33.0 34.0 33.0 34.0 6 37.31825 38.0 38.0 38.0 38.0 38.0 7 37.3375 38.0 38.0 38.0 38.0 38.0 8 37.29825 38.0 38.0 38.0 38.0 38.0 9 37.248 38.0 38.0 38.0 37.0 38.0 10-14 37.22765 38.0 38.0 38.0 37.6 38.0 15-19 37.239599999999996 38.0 38.0 38.0 37.4 38.0 20-24 37.2453 38.0 38.0 38.0 37.6 38.0 25-29 37.22265 38.0 38.0 38.0 37.2 38.0 30-34 37.16244999999999 38.0 38.0 38.0 37.2 38.0 35-39 37.0588 38.0 38.0 38.0 37.0 38.0 40-44 37.10275 38.0 38.0 38.0 37.0 38.0 45-49 37.0587 38.0 38.0 38.0 37.0 38.0 50-54 37.095150000000004 38.0 38.0 38.0 37.0 38.0 55-59 36.760549999999995 38.0 38.0 38.0 36.6 38.0 60-64 36.927 38.0 38.0 38.0 36.6 38.0 65-69 36.7726 38.0 38.0 38.0 36.6 38.0 70-74 36.49925 38.0 38.0 38.0 35.2 38.0 75-79 36.83415 38.0 38.0 38.0 36.2 38.0 80-84 36.77765 38.0 38.0 38.0 36.0 38.0 85-89 36.7664 38.0 38.0 38.0 36.0 38.0 90-94 36.704499999999996 38.0 38.0 38.0 36.0 38.0 95-99 36.67355 38.0 38.0 38.0 35.8 38.0 100-104 36.5153 38.0 38.0 38.0 34.8 38.0 105-109 36.2803 38.0 38.0 38.0 34.0 38.0 110-114 36.292199999999994 38.0 38.0 38.0 34.0 38.0 115-119 36.213049999999996 38.0 38.0 38.0 34.0 38.0 120-124 36.01535 38.0 38.0 38.0 33.6 38.0 125-129 35.85755 38.0 37.8 38.0 33.2 38.0 130-134 35.735400000000006 38.0 37.6 38.0 32.8 38.0 135-139 35.26245 38.0 36.2 38.0 31.2 38.0 140-144 34.864549999999994 38.0 36.0 38.0 29.6 38.0 145-149 33.808299999999996 38.0 35.4 38.0 22.2 38.0 150-151 28.596249999999998 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 4.0 4 0.0 5 3.0 6 0.0 7 1.0 8 3.0 9 2.0 10 2.0 11 1.0 12 2.0 13 4.0 14 2.0 15 4.0 16 4.0 17 2.0 18 3.0 19 1.0 20 5.0 21 11.0 22 4.0 23 13.0 24 17.0 25 21.0 26 15.0 27 11.0 28 22.0 29 34.0 30 49.0 31 59.0 32 42.0 33 75.0 34 107.0 35 169.0 36 491.0 37 2814.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.378033525143856 18.764073054791094 14.435826870152615 29.422066549912433 2 26.488244122061033 25.11255627813907 32.741370685342666 15.657828914457228 3 19.05 28.125 30.875000000000004 21.95 4 22.75 36.05 22.0 19.2 5 22.475 37.875 22.675 16.975 6 17.849999999999998 38.725 24.349999999999998 19.075 7 18.275 17.125 44.125 20.474999999999998 8 21.75 23.400000000000002 28.050000000000004 26.8 9 21.525 25.324999999999996 28.825 24.325 10-14 22.763414512176826 28.63929589438416 27.62414362154323 20.973145971895786 15-19 22.831141557077853 27.551377568878443 28.57142857142857 21.04605230261513 20-24 22.67907162865146 27.841136454581832 28.511404561824733 20.968387354941978 25-29 22.596779033710114 28.04341302390717 28.65859757927378 20.70121036310893 30-34 22.633395009251387 27.78916837525629 28.954343151472724 20.623093464019604 35-39 22.867577167442093 27.920356195907747 28.52568912902096 20.686377507629196 40-44 22.049409881976395 27.690538107621528 29.245849169833964 21.014202840568114 45-49 23.05960066056148 27.69854376219787 28.459190311765 20.782665265475657 50-54 22.913224175053827 27.620049071153176 28.921936808372138 20.54478994542086 55-59 23.212758464557027 27.383407958947526 28.882628163203705 20.521205413291742 60-64 22.697665096703076 27.16705080669406 28.880649363663697 21.254634732939174 65-69 23.32931363682042 27.132951462164606 28.595116068736807 20.94261883227816 70-74 23.239578101456555 27.86037167252637 28.448016072325466 20.452034153691613 75-79 22.908436265439818 27.98419762964445 28.05420813121968 21.053157973696056 80-84 23.12703583061889 28.499123026810324 27.36156351791531 21.012277624655475 85-89 23.39850977646647 28.179226884032605 27.799169875481322 20.623093464019604 90-94 23.194638927785558 28.085617123424683 28.160632126425284 20.55911182236447 95-99 23.50852627894184 28.464269640446066 27.614142121318196 20.413061959293895 100-104 23.356167808390417 28.07640382019101 27.966398319915996 20.601030051502576 105-109 23.256162808140406 27.476373818690934 28.401420071003553 20.866043302165107 110-114 23.306653326663334 27.723861930965484 28.394197098549274 20.57528764382191 115-119 23.575609024060828 28.39277674953729 27.86754039317693 20.16407383322495 120-124 23.926196309815488 27.92139606980349 28.0114005700285 20.141007050352517 125-129 23.791189559477974 27.901395069753487 27.946397319865994 20.361018050902548 130-134 23.89238923892389 28.44784478447845 27.802780278027804 19.856985698569858 135-139 24.361542313470206 27.601402103154733 28.192288432648972 19.84476715072609 140-144 24.026201310065503 28.106405320266013 28.026401320066004 19.84099204960248 145-149 24.841242062103106 27.631381569078457 27.83139156957848 19.695984799239962 150-151 25.624999999999996 27.8875 26.8625 19.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 1.0 15 1.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 5.0 26 7.5 27 7.0 28 10.5 29 20.0 30 26.0 31 27.5 32 31.0 33 40.0 34 59.5 35 79.0 36 87.0 37 114.5 38 149.0 39 165.5 40 192.0 41 217.0 42 244.5 43 271.0 44 287.0 45 287.0 46 258.0 47 231.5 48 215.0 49 195.0 50 165.0 51 125.0 52 102.5 53 90.5 54 75.5 55 54.5 56 38.0 57 31.0 58 21.5 59 18.5 60 12.5 61 7.5 62 5.0 63 4.0 64 4.0 65 1.5 66 1.0 67 0.5 68 2.0 69 1.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.005 20-24 0.04 25-29 0.03 30-34 0.015 35-39 0.055 40-44 0.02 45-49 0.08499999999999999 50-54 0.145 55-59 0.615 60-64 0.21 65-69 0.49 70-74 0.44999999999999996 75-79 0.015 80-84 0.22499999999999998 85-89 0.015 90-94 0.02 95-99 0.015 100-104 0.005 105-109 0.005 110-114 0.05 115-119 0.045 120-124 0.005 125-129 0.005 130-134 0.01 135-139 0.15 140-144 0.005 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39577039274926 98.7 2 0.5035246727089627 1.0 3 0.10070493454179255 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.6625 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.1625 0.0 0.0 0.0 0.0 112-113 1.2374999999999998 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.6375 0.0 0.0 0.0 0.0 118-119 1.8875000000000002 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.5875000000000004 0.0 0.0 0.0 0.0 124-125 2.95 0.0 0.0 0.0 0.0 126-127 3.1624999999999996 0.0 0.0 0.0 0.0 128-129 3.475 0.0 0.0 0.0 0.0 130-131 3.7875 0.0 0.0 0.0 0.0 132-133 4.0 0.0 0.0 0.0 0.0 134-135 4.3375 0.0 0.0 0.0 0.0 136-137 4.575 0.0 0.0 0.0 0.0 138-139 4.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 650975 spots for SRR7230777.sra Written 650975 spots for SRR7230777.sra Read 650975 spots for SRR7230777.sra Written 650975 spots for SRR7230777.sra Read 650975 spots for SRR7230777.sra Written 650975 spots for SRR7230777.sra Read 650975 spots for SRR7230777.sra Written 650975 spots for SRR7230777.sra Read 650975 spots for SRR7230777.sra Written 650975 spots for SRR7230777.sra Read 650975 spots for SRR7230777.sra Written 650975 spots for SRR7230777.sra Read 650975 spots for SRR7230777.sra Written 650975 spots for SRR7230777.sra Read 650975 spots for SRR7230777.sra Written 650975 spots for SRR7230777.sra Read 650975 spots for SRR7230777.sra Written 650975 spots for SRR7230777.sra Read 650975 spots for SRR7230777.sra Written 650975 spots for SRR7230777.sra Read 650975 spots for SRR7230777.sra Written 650975 spots for SRR7230777.sra Read 650975 spots for SRR7230777.sra Written 650975 spots for SRR7230777.sra Read 650975 spots for SRR7230777.sra Written 650975 spots for SRR7230777.sra Read 650975 spots for SRR7230777.sra Written 650975 spots for SRR7230777.sra Read 650975 spots for SRR7230777.sra Written 650975 spots for SRR7230777.sra Read 650975 spots for SRR7230777.sra Written 650975 spots for SRR7230777.sra Read 650992 spots for SRR7230777.sra Written 650992 spots for SRR7230777.sra Read 650975 spots for SRR7230777.sra Written 650975 spots for SRR7230777.sra Read 650975 spots for SRR7230777.sra Written 650975 spots for SRR7230777.sra Read 650975 spots for SRR7230777.sra Written 650975 spots for SRR7230777.sra SRR ids: ['SRR7230777.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vgafrcei SRR7230777.sra spots: 13019517 blocks: [[1, 650975], [650976, 1301950], [1301951, 1952925], [1952926, 2603900], [2603901, 3254875], [3254876, 3905850], [3905851, 4556825], [4556826, 5207800], [5207801, 5858775], [5858776, 6509750], [6509751, 7160725], [7160726, 7811700], [7811701, 8462675], [8462676, 9113650], [9113651, 9764625], [9764626, 10415600], [10415601, 11066575], [11066576, 11717550], [11717551, 12368525], [12368526, 13019517]] SRR7230777 file size 4390186 SRR7230777 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230777 SRR7230777_1.fastq SRR7230777_2.fastq Input file: SRR7230777_1.fastq Paired file: SRR7230777_2.fastq trimmed: SRR7230777-trimmed-pair1.fastq, SRR7230777-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:46:08 2025 >> started Tue Feb 11 00:46:23 2025 >> done (14.758s) 13019517 read pairs processed; of these: 12347 ( 0.09%) short read pairs filtered out after trimming by size control 7326 ( 0.06%) empty read pairs filtered out after trimming by size control 12999844 (99.85%) read pairs available; of these: 5330124 (41.00%) trimmed read pairs available after processing 7669720 (59.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 2 0.00% 21 3 0.00% 22 3 0.00% 23 7 0.00% 24 1 0.00% 25 9 0.00% 26 5 0.00% 27 6 0.00% 28 4 0.00% 29 6 0.00% 30 5 0.00% 31 3 0.00% 32 4 0.00% 33 9 0.00% 34 7 0.00% 35 14 0.00% 36 9 0.00% 37 19 0.00% 38 16 0.00% 39 14 0.00% 40 16 0.00% 41 11 0.00% 42 14 0.00% 43 25 0.00% 44 24 0.00% 45 22 0.00% 46 30 0.00% 47 26 0.00% 48 40 0.00% 49 43 0.00% 50 35 0.00% 51 51 0.00% 52 92 0.00% 53 86 0.00% 54 73 0.00% 55 75 0.00% 56 89 0.00% 57 110 0.00% 58 144 0.00% 59 137 0.00% 60 145 0.00% 61 169 0.00% 62 179 0.00% 63 186 0.00% 64 170 0.00% 65 247 0.00% 66 272 0.00% 67 282 0.00% 68 338 0.00% 69 657 0.01% 70 624 0.00% 71 509 0.00% 72 572 0.00% 73 614 0.00% 74 634 0.00% 75 683 0.01% 76 749 0.01% 77 817 0.01% 78 929 0.01% 79 1110 0.01% 80 1335 0.01% 81 1945 0.01% 82 1498 0.01% 83 1824 0.01% 84 2891 0.02% 85 2742 0.02% 86 2952 0.02% 87 3196 0.02% 88 3442 0.03% 89 3722 0.03% 90 4031 0.03% 91 4344 0.03% 92 4606 0.04% 93 4909 0.04% 94 5149 0.04% 95 5322 0.04% 96 5676 0.04% 97 6188 0.05% 98 6610 0.05% 99 7017 0.05% 100 7474 0.06% 101 7839 0.06% 102 8269 0.06% 103 8844 0.07% 104 9312 0.07% 105 9835 0.08% 106 10570 0.08% 107 11195 0.09% 108 11703 0.09% 109 12294 0.09% 110 12996 0.10% 111 13717 0.11% 112 14516 0.11% 113 14824 0.11% 114 16048 0.12% 115 16800 0.13% 116 17407 0.13% 117 17952 0.14% 118 18709 0.14% 119 19516 0.15% 120 20560 0.16% 121 21484 0.17% 122 22578 0.17% 123 23813 0.18% 124 24439 0.19% 125 25538 0.20% 126 26815 0.21% 127 28201 0.22% 128 29552 0.23% 129 30863 0.24% 130 31914 0.25% 131 33641 0.26% 132 34900 0.27% 133 36878 0.28% 134 38632 0.30% 135 40454 0.31% 136 43227 0.33% 137 45367 0.35% 138 48485 0.37% 139 51341 0.39% 140 55164 0.42% 141 59642 0.46% 142 65429 0.50% 143 72976 0.56% 144 83732 0.64% 145 97459 0.75% 146 119570 0.92% 147 157201 1.21% 148 235077 1.81% 149 465440 3.58% 150 2909351 22.38% 151 7669720 59.00% 12999844 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=15 prefix-density=0.37 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=478.27 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=18.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGTTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTG criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=24 prefix-density=0.45 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.22 sequence-density-rank=16 fanout-score=9.26 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=5.3 sequence=AAGAAAGCTTACCCTAAC SRR7230777 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:47:08 Started mapping on | Feb 11 00:47:08 Finished on | Feb 11 00:48:47 Mapping speed, Million of reads per hour | 472.72 Number of input reads | 12999844 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12178077 Uniquely mapped reads % | 93.68% Average mapped length | 295.48 Number of splices: Total | 11808247 Number of splices: Annotated (sjdb) | 11522373 Number of splices: GT/AG | 11583657 Number of splices: GC/AG | 180728 Number of splices: AT/AC | 7718 Number of splices: Non-canonical | 36144 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 338484 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 79675 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.97% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 498146 498146 498146 N_multimapping 338484 338484 338484 N_noFeature 547069 11964535 647827 N_ambiguous 195844 870 82508 UnstrandedReadsAssigned:11435164 PositiveStrandReadsAssigned:212672 NegativeStrandReadsAssigned:11447742 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7230777 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230777-trimmed-pair1.fastq SRR7230777-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,999,844 reads, 11,460,920 reads pseudoaligned [quant] estimated average fragment length: 255.651 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,055 rounds 52401 SRR7230777.ke.tsv 34699 SRR7230777.se.tsv 87100 total ==> SRR7230777.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.35 598 27.5944 Potri.005G024800.1.v4.1 1035 780.349 173 18.0391 Potri.004G059700.1.v4.1 961 706.457 14 1.6125 Potri.007G009000.2.v4.1 1416 1161.35 0 0 Potri.003G141000.2.v4.1 2943 2688.35 737.439 22.3202 Potri.016G087400.1.v4.1 270 77.528 643 674.854 Potri.015G069301.1.v4.1 564 318.122 0 0 Potri.010G195200.1.v4.1 1773 1518.35 53 2.84029 Potri.012G127500.1.v4.1 977 722.4 146 16.445 ==> SRR7230777.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 895 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 188 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 32 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 7 SRR7230777 completed mapping pipeline successfully