Starting /dee2/code/volunteer_pipeline.sh SRR7230778 current disk space = 3057226096640 free memory = 1017902364 SRR7230778 SRAfilesize ed64c16e58b79c4a898323b7fd0bcab7 SRR7230778.sra SRR7230778.sra file validated SRR7230778 is paired end SRR7230778 is conventional basespace SRR7230778 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230778_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.352 34.0 33.0 34.0 33.0 34.0 2 33.3855 34.0 33.0 34.0 33.0 34.0 3 33.4125 34.0 34.0 34.0 33.0 34.0 4 33.42275 34.0 34.0 34.0 33.0 34.0 5 33.34275 34.0 34.0 34.0 33.0 34.0 6 37.30725 38.0 38.0 38.0 36.0 38.0 7 37.51675 38.0 38.0 38.0 37.0 38.0 8 37.43325 38.0 38.0 38.0 37.0 38.0 9 37.5285 38.0 38.0 38.0 38.0 38.0 10-14 37.572250000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.45795 38.0 38.0 38.0 37.6 38.0 20-24 37.5985 38.0 38.0 38.0 38.0 38.0 25-29 37.5087 38.0 38.0 38.0 37.8 38.0 30-34 37.355450000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.3134 38.0 38.0 38.0 37.0 38.0 40-44 36.9293 38.0 38.0 38.0 36.0 38.0 45-49 37.25785 38.0 38.0 38.0 36.6 38.0 50-54 37.2999 38.0 38.0 38.0 37.0 38.0 55-59 37.24185 38.0 38.0 38.0 37.0 38.0 60-64 37.13995 38.0 38.0 38.0 36.4 38.0 65-69 37.1274 38.0 38.0 38.0 36.0 38.0 70-74 31.961450000000003 38.0 26.8 38.0 15.6 38.0 75-79 33.0298 38.0 34.8 38.0 11.4 38.0 80-84 35.397149999999996 38.0 37.6 38.0 30.8 38.0 85-89 36.308400000000006 38.0 38.0 38.0 34.0 38.0 90-94 36.43555 38.0 38.0 38.0 34.2 38.0 95-99 36.537099999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.410849999999996 38.0 38.0 38.0 34.0 38.0 105-109 35.90745 38.0 37.2 38.0 30.2 38.0 110-114 36.0022 38.0 37.0 38.0 32.6 38.0 115-119 35.892 38.0 37.0 38.0 32.0 38.0 120-124 35.5786 38.0 36.4 38.0 30.6 38.0 125-129 34.95635 38.0 35.6 38.0 27.4 38.0 130-134 35.20165 38.0 36.0 38.0 29.4 38.0 135-139 35.15155 38.0 36.0 38.0 29.6 38.0 140-144 34.839 38.0 35.2 38.0 28.4 38.0 145-149 34.00485 38.0 33.8 38.0 24.6 38.0 150-151 30.610125 35.5 29.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 2.0 16 2.0 17 3.0 18 3.0 19 3.0 20 3.0 21 6.0 22 10.0 23 2.0 24 7.0 25 8.0 26 17.0 27 31.0 28 23.0 29 52.0 30 40.0 31 73.0 32 86.0 33 158.0 34 259.0 35 407.0 36 805.0 37 1997.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.85 13.975000000000001 10.4 42.775 2 20.7 20.95 36.325 22.025 3 19.400000000000002 25.2 24.675 30.725 4 22.175 34.699999999999996 21.7 21.425 5 21.7 37.375 22.975 17.95 6 16.775000000000002 37.574999999999996 26.325 19.325 7 13.450000000000001 23.225 44.7 18.625 8 18.075 23.075000000000003 32.45 26.400000000000002 9 17.974999999999998 22.35 33.225 26.450000000000003 10-14 20.09 29.904999999999998 26.52 23.485 15-19 19.96 28.665000000000003 28.26 23.115 20-24 19.85 28.439999999999998 28.060000000000002 23.65 25-29 19.36 28.82 28.244999999999997 23.575 30-34 19.49 29.104999999999997 27.875 23.53 35-39 20.25 28.765 27.544999999999998 23.44 40-44 20.266013300665033 29.381469073453676 27.2163608180409 23.13615680784039 45-49 20.21 28.925 27.27 23.595 50-54 19.99 29.265 27.55 23.195 55-59 20.04 28.22 27.68 24.060000000000002 60-64 19.98999749937484 28.79219804951238 27.846961740435113 23.37084271067767 65-69 20.74 28.165000000000003 27.794999999999998 23.3 70-74 19.852475076355674 29.147697804414225 26.94058664207918 24.059240477150926 75-79 20.3584229390681 28.431210366694238 28.260270195754067 22.950096498483596 80-84 20.33573389979794 28.76534894565048 27.418268483498267 23.480648671053313 85-89 20.496894409937887 28.813816088471444 27.394839165782965 23.294450335807706 90-94 20.643351037178075 28.549954905301135 27.447640044092598 23.3590540134282 95-99 20.162137817144572 28.61432217384777 27.858679877896215 23.364860131111445 100-104 20.391606990835793 28.25880114176974 28.008413040212325 23.341178827182134 105-109 20.76934620579261 28.462808263718674 27.56240308138662 23.205442449102094 110-114 20.172017201720173 28.69286928692869 26.927692769276927 24.207420742074206 115-119 21.053158975900597 28.272959567112583 27.235833458590108 23.438047998396712 120-124 20.71371210600281 28.58361774744027 26.816904236097166 23.885765910459746 125-129 20.72 28.925 26.384999999999998 23.97 130-134 20.355 28.62 27.150000000000002 23.875 135-139 21.240000000000002 28.144999999999996 26.484999999999996 24.13 140-144 20.8010400520026 27.9813990699535 26.88134406720336 24.33621681084054 145-149 20.714857829395275 28.33400080096115 26.431718061674008 24.51942330796956 150-151 20.817704426106527 27.994498624656167 26.44411102775694 24.74368592148037 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.0 19 0.5 20 0.5 21 1.5 22 3.0 23 4.0 24 6.0 25 6.0 26 8.0 27 11.5 28 14.5 29 22.5 30 32.5 31 34.0 32 48.5 33 65.0 34 76.5 35 99.5 36 115.5 37 137.0 38 154.5 39 169.5 40 190.0 41 223.0 42 250.0 43 248.5 44 249.0 45 240.5 46 241.0 47 232.5 48 197.5 49 179.5 50 163.0 51 126.5 52 97.5 53 86.5 54 72.5 55 49.5 56 35.5 57 28.0 58 21.0 59 16.5 60 11.5 61 9.0 62 3.5 63 3.0 64 4.0 65 2.5 66 1.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.025 65-69 0.0 70-74 13.235 75-79 9.325 80-84 3.495 85-89 0.985 90-94 0.21 95-99 0.08499999999999999 100-104 0.155 105-109 0.045 110-114 0.01 115-119 0.20500000000000002 120-124 0.38 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.12 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19253091092607 98.275 2 0.6813020439061317 1.35 3 0.12616704516780217 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.7250000000000001 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 1.1749999999999998 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.6 0.0 0.0 0.0 0.0 104-105 1.8875000000000002 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.3625 0.0 0.0 0.0 0.0 110-111 2.5625 0.0 0.0 0.0 0.0 112-113 2.7875 0.0 0.0 0.0 0.0 114-115 3.0375 0.0 0.0 0.0 0.0 116-117 3.425 0.0 0.0 0.0 0.0 118-119 3.8 0.0 0.0 0.0 0.0 120-121 4.125 0.0 0.0 0.0 0.0 122-123 4.4 0.0 0.0 0.0 0.0 124-125 4.7 0.0 0.0 0.0 0.0 126-127 5.199999999999999 0.0 0.0 0.0 0.0 128-129 5.65 0.0 0.0 0.0 0.0 130-131 5.9625 0.0 0.0 0.0 0.0 132-133 6.3875 0.0 0.0 0.0 0.0 134-135 7.1375 0.0 0.0 0.0 0.0 136-137 7.75 0.0 0.0 0.0 0.0 138-139 8.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7230778 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230778_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6035 34.0 33.0 34.0 32.0 34.0 2 33.0265 34.0 33.0 34.0 32.0 34.0 3 33.133 34.0 33.0 34.0 32.0 34.0 4 33.11025 34.0 33.0 34.0 32.0 34.0 5 33.10525 34.0 33.0 34.0 33.0 34.0 6 37.2505 38.0 38.0 38.0 37.0 38.0 7 37.17475 38.0 38.0 38.0 37.0 38.0 8 37.2275 38.0 38.0 38.0 37.0 38.0 9 37.14475 38.0 38.0 38.0 37.0 38.0 10-14 36.9891 38.0 38.0 38.0 36.4 38.0 15-19 37.18955 38.0 38.0 38.0 37.0 38.0 20-24 37.11255 38.0 38.0 38.0 37.0 38.0 25-29 37.07075 38.0 38.0 38.0 37.0 38.0 30-34 37.11130000000001 38.0 38.0 38.0 37.0 38.0 35-39 36.877449999999996 38.0 38.0 38.0 36.2 38.0 40-44 36.63945 38.0 38.0 38.0 35.4 38.0 45-49 36.823350000000005 38.0 38.0 38.0 35.8 38.0 50-54 36.82455 38.0 38.0 38.0 36.2 38.0 55-59 36.873799999999996 38.0 38.0 38.0 36.4 38.0 60-64 36.95115 38.0 38.0 38.0 36.4 38.0 65-69 36.9125 38.0 38.0 38.0 36.2 38.0 70-74 36.8801 38.0 38.0 38.0 36.0 38.0 75-79 36.8629 38.0 38.0 38.0 36.0 38.0 80-84 36.791000000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.699400000000004 38.0 38.0 38.0 35.6 38.0 90-94 36.588499999999996 38.0 38.0 38.0 35.4 38.0 95-99 36.502050000000004 38.0 38.0 38.0 34.8 38.0 100-104 35.83749999999999 38.0 37.4 38.0 31.8 38.0 105-109 36.217499999999994 38.0 38.0 38.0 34.0 38.0 110-114 36.2047 38.0 38.0 38.0 34.0 38.0 115-119 36.1518 38.0 38.0 38.0 33.8 38.0 120-124 35.80825 38.0 37.6 38.0 32.4 38.0 125-129 35.3315 38.0 36.6 38.0 30.0 38.0 130-134 35.329600000000006 38.0 36.2 38.0 31.0 38.0 135-139 35.02675 38.0 36.0 38.0 29.2 38.0 140-144 34.495549999999994 38.0 35.4 38.0 27.0 38.0 145-149 34.0888 38.0 35.0 38.0 26.4 38.0 150-151 29.3005 35.5 26.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 1.0 5 4.0 6 3.0 7 2.0 8 0.0 9 0.0 10 0.0 11 2.0 12 2.0 13 1.0 14 2.0 15 6.0 16 2.0 17 2.0 18 2.0 19 8.0 20 5.0 21 11.0 22 6.0 23 12.0 24 12.0 25 23.0 26 17.0 27 25.0 28 26.0 29 26.0 30 48.0 31 53.0 32 70.0 33 87.0 34 125.0 35 220.0 36 496.0 37 2695.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.52231237322515 17.748478701825558 14.426977687626774 32.302231237322516 2 25.124999999999996 24.525 34.875 15.475 3 21.0 27.250000000000004 31.2 20.549999999999997 4 23.825 32.975 24.85 18.35 5 24.775 35.525 22.1 17.599999999999998 6 19.15 37.95 24.925 17.974999999999998 7 19.425 17.974999999999998 41.8 20.8 8 21.05 23.75 28.875 26.325 9 21.224999999999998 22.55 30.75 25.474999999999998 10-14 23.454936696191766 28.534254115998596 26.407446329379976 21.603362858429666 15-19 23.265 27.439999999999998 28.860000000000003 20.435 20-24 22.958775265159094 27.846708024814887 28.306984190514306 20.887532519511705 25-29 23.096548274137067 28.479239619809903 27.77888944472236 20.645322661330663 30-34 22.801661578499573 27.906511185626343 28.286872528902457 21.004954706971624 35-39 23.625631534190386 28.242709219148615 27.43234455504977 20.699314691611225 40-44 23.08231173380035 28.10607955966975 27.575681761320993 21.23592694520891 45-49 23.42811373648378 27.828394072887463 27.953544253103722 20.78994793752503 50-54 23.3395064818059 27.864257470343862 27.588968416837677 21.207267631012563 55-59 22.997597116539847 27.47797356828194 27.83840608730477 21.68602322787345 60-64 23.133880328196916 27.211326796077646 28.301981188713228 21.352811687012206 65-69 23.485834417859646 27.22995294824307 28.381219341275404 20.902993292621886 70-74 24.055825121304586 27.357310789855433 27.787504376969636 20.79935971187034 75-79 23.040344378816698 28.611472619881873 27.785564120532584 20.562618880768845 80-84 23.69421652991795 27.826696017610566 27.891735041024614 20.58735241144687 85-89 23.46519779669504 27.346019028542813 28.12719078617927 21.061592388582877 90-94 23.517925095133187 27.538553975565794 27.909072701782495 21.034448227518528 95-99 23.705926481620406 27.76194048512128 27.9869967491873 20.545136284071017 100-104 24.216054013503378 27.021755438859714 27.9869967491873 20.775193798449614 105-109 23.718301405491925 28.204871705096785 27.89476316710849 20.182063722302807 110-114 24.015 27.555000000000003 27.915 20.515 115-119 24.62 27.395000000000003 27.665 20.32 120-124 24.819927971188473 27.881152460984392 27.69107643057223 19.607843137254903 125-129 24.27548926372691 27.784173382051154 27.548926372691323 20.39141098153061 130-134 24.39121956097805 27.896394819740987 27.496374818740936 20.216010800540026 135-139 25.131282820705174 27.89697424356089 27.45686421605401 19.51487871967992 140-144 25.3141112279121 27.912098913750818 27.436552034840066 19.337237823497023 145-149 25.27884759665883 28.219876956934925 26.804381533536738 19.696893912869502 150-151 25.315664458057256 28.166020752594072 26.990873859232405 19.527440930116263 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 1.0 14 0.5 15 0.5 16 1.0 17 0.5 18 2.0 19 2.0 20 0.5 21 2.0 22 3.0 23 2.5 24 1.5 25 6.0 26 9.0 27 6.5 28 9.0 29 12.0 30 15.5 31 20.0 32 23.5 33 31.0 34 41.0 35 57.5 36 79.5 37 103.0 38 143.5 39 174.5 40 185.5 41 217.0 42 241.0 43 256.5 44 263.0 45 256.0 46 256.5 47 248.5 48 238.5 49 208.5 50 168.5 51 144.5 52 126.0 53 103.5 54 76.5 55 63.5 56 54.0 57 39.5 58 30.0 59 22.0 60 16.0 61 10.5 62 6.5 63 4.5 64 4.0 65 3.0 66 1.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.08499999999999999 15-19 0.0 20-24 0.06 25-29 0.05 30-34 0.095 35-39 0.045 40-44 0.075 45-49 0.12 50-54 0.105 55-59 0.12 60-64 0.06 65-69 0.11 70-74 0.045 75-79 0.11 80-84 0.06 85-89 0.15 90-94 0.13999999999999999 95-99 0.025 100-104 0.025 105-109 0.034999999999999996 110-114 0.0 115-119 0.0 120-124 0.04 125-129 0.105 130-134 0.005 135-139 0.025 140-144 0.11499999999999999 145-149 0.034999999999999996 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26823113802675 98.35000000000001 2 0.6056018168054504 1.2 3 0.0757002271006813 0.22499999999999998 4 0.025233409033560434 0.1 5 0.025233409033560434 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.45 0.0 0.0 0.0 0.0 102-103 1.65 0.0 0.0 0.0 0.0 104-105 1.9375 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.3625 0.0 0.0 0.0 0.0 110-111 2.5999999999999996 0.0 0.0 0.0 0.0 112-113 2.8375 0.0 0.0 0.0 0.0 114-115 3.1125 0.0 0.0 0.0 0.0 116-117 3.475 0.0 0.0 0.0 0.0 118-119 3.875 0.0 0.0 0.0 0.0 120-121 4.175 0.0 0.0 0.0 0.0 122-123 4.5 0.0 0.0 0.0 0.0 124-125 4.8375 0.0 0.0 0.0 0.0 126-127 5.35 0.0 0.0 0.0 0.0 128-129 5.7875 0.0 0.0 0.0 0.0 130-131 6.125 0.0 0.0 0.0 0.0 132-133 6.5875 0.0 0.0 0.0 0.0 134-135 7.3375 0.0 0.0 0.0 0.0 136-137 7.9625 0.0 0.0 0.0 0.0 138-139 8.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 699731 spots for SRR7230778.sra Written 699731 spots for SRR7230778.sra Read 699731 spots for SRR7230778.sra Written 699731 spots for SRR7230778.sra Read 699731 spots for SRR7230778.sra Written 699731 spots for SRR7230778.sra Read 699731 spots for SRR7230778.sra Written 699731 spots for SRR7230778.sra Read 699731 spots for SRR7230778.sra Written 699731 spots for SRR7230778.sra Read 699731 spots for SRR7230778.sra Written 699731 spots for SRR7230778.sra Read 699731 spots for SRR7230778.sra Written 699731 spots for SRR7230778.sra Read 699731 spots for SRR7230778.sra Written 699731 spots for SRR7230778.sra Read 699731 spots for SRR7230778.sra Written 699731 spots for SRR7230778.sra Read 699731 spots for SRR7230778.sra Written 699731 spots for SRR7230778.sra Read 699731 spots for SRR7230778.sra Written 699731 spots for SRR7230778.sra Read 699731 spots for SRR7230778.sra Written 699731 spots for SRR7230778.sra Read 699731 spots for SRR7230778.sra Written 699731 spots for SRR7230778.sra Read 699739 spots for SRR7230778.sra Written 699739 spots for SRR7230778.sra Read 699731 spots for SRR7230778.sra Written 699731 spots for SRR7230778.sra Read 699731 spots for SRR7230778.sra Written 699731 spots for SRR7230778.sra Read 699731 spots for SRR7230778.sra Written 699731 spots for SRR7230778.sra Read 699731 spots for SRR7230778.sra Written 699731 spots for SRR7230778.sra Read 699731 spots for SRR7230778.sra Written 699731 spots for SRR7230778.sra Read 699731 spots for SRR7230778.sra Written 699731 spots for SRR7230778.sra SRR ids: ['SRR7230778.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ecp7t0qo SRR7230778.sra spots: 13994628 blocks: [[1, 699731], [699732, 1399462], [1399463, 2099193], [2099194, 2798924], [2798925, 3498655], [3498656, 4198386], [4198387, 4898117], [4898118, 5597848], [5597849, 6297579], [6297580, 6997310], [6997311, 7697041], [7697042, 8396772], [8396773, 9096503], [9096504, 9796234], [9796235, 10495965], [10495966, 11195696], [11195697, 11895427], [11895428, 12595158], [12595159, 13294889], [13294890, 13994628]] SRR7230778 file size 4720619 SRR7230778 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230778 SRR7230778_1.fastq SRR7230778_2.fastq Input file: SRR7230778_1.fastq Paired file: SRR7230778_2.fastq trimmed: SRR7230778-trimmed-pair1.fastq, SRR7230778-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:46:30 2025 >> started Tue Feb 11 00:46:45 2025 >> done (14.555s) 13994628 read pairs processed; of these: 11681 ( 0.08%) short read pairs filtered out after trimming by size control 14227 ( 0.10%) empty read pairs filtered out after trimming by size control 13968720 (99.81%) read pairs available; of these: 6676617 (47.80%) trimmed read pairs available after processing 7292103 (52.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 1 0.00% 21 3 0.00% 22 1 0.00% 23 0 0.00% 24 6 0.00% 25 6 0.00% 26 6 0.00% 27 7 0.00% 28 4 0.00% 29 3 0.00% 30 9 0.00% 31 7 0.00% 32 9 0.00% 33 7 0.00% 34 12 0.00% 35 11 0.00% 36 12 0.00% 37 12 0.00% 38 18 0.00% 39 21 0.00% 40 21 0.00% 41 24 0.00% 42 27 0.00% 43 27 0.00% 44 35 0.00% 45 43 0.00% 46 35 0.00% 47 46 0.00% 48 33 0.00% 49 54 0.00% 50 53 0.00% 51 72 0.00% 52 77 0.00% 53 88 0.00% 54 103 0.00% 55 100 0.00% 56 147 0.00% 57 119 0.00% 58 162 0.00% 59 171 0.00% 60 185 0.00% 61 221 0.00% 62 267 0.00% 63 288 0.00% 64 310 0.00% 65 391 0.00% 66 453 0.00% 67 578 0.00% 68 755 0.01% 69 930 0.01% 70 869 0.01% 71 780 0.01% 72 933 0.01% 73 975 0.01% 74 1161 0.01% 75 1303 0.01% 76 1462 0.01% 77 1640 0.01% 78 1865 0.01% 79 2092 0.01% 80 2472 0.02% 81 2605 0.02% 82 3031 0.02% 83 3431 0.02% 84 4175 0.03% 85 4990 0.04% 86 5261 0.04% 87 5797 0.04% 88 6324 0.05% 89 6604 0.05% 90 6961 0.05% 91 7665 0.05% 92 8332 0.06% 93 9047 0.06% 94 9691 0.07% 95 10514 0.08% 96 11231 0.08% 97 11714 0.08% 98 12629 0.09% 99 13369 0.10% 100 14272 0.10% 101 14953 0.11% 102 15829 0.11% 103 17155 0.12% 104 17931 0.13% 105 18906 0.14% 106 20045 0.14% 107 20858 0.15% 108 21990 0.16% 109 23251 0.17% 110 23981 0.17% 111 24915 0.18% 112 25982 0.19% 113 27219 0.19% 114 28429 0.20% 115 30040 0.22% 116 31179 0.22% 117 32091 0.23% 118 32989 0.24% 119 34122 0.24% 120 35829 0.26% 121 36803 0.26% 122 38539 0.28% 123 39694 0.28% 124 41368 0.30% 125 42443 0.30% 126 43783 0.31% 127 45452 0.33% 128 47107 0.34% 129 49150 0.35% 130 50566 0.36% 131 51952 0.37% 132 53861 0.39% 133 56978 0.41% 134 59264 0.42% 135 62082 0.44% 136 64830 0.46% 137 68560 0.49% 138 71937 0.51% 139 75959 0.54% 140 79364 0.57% 141 84239 0.60% 142 91031 0.65% 143 101378 0.73% 144 114943 0.82% 145 133436 0.96% 146 166472 1.19% 147 208765 1.49% 148 325593 2.33% 149 605232 4.33% 150 3088969 22.11% 151 7292103 52.20% 13968720 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=17 prefix-density=0.41 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=289.67 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCT criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=30 prefix-density=0.39 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=78.43 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.1 sequence=CCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR7230778 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:47:32 Started mapping on | Feb 11 00:47:33 Finished on | Feb 11 00:50:16 Mapping speed, Million of reads per hour | 308.51 Number of input reads | 13968720 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12603143 Uniquely mapped reads % | 90.22% Average mapped length | 292.51 Number of splices: Total | 11746840 Number of splices: Annotated (sjdb) | 11472980 Number of splices: GT/AG | 11513498 Number of splices: GC/AG | 190219 Number of splices: AT/AC | 6801 Number of splices: Non-canonical | 36322 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 408042 % of reads mapped to multiple loci | 2.92% Number of reads mapped to too many loci | 24460 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.60% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 969081 969081 969081 N_multimapping 408042 408042 408042 N_noFeature 450418 12373526 542661 N_ambiguous 231488 902 93596 UnstrandedReadsAssigned:11921237 PositiveStrandReadsAssigned:228715 NegativeStrandReadsAssigned:11966886 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7230778 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230778-trimmed-pair1.fastq SRR7230778-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,968,720 reads, 12,002,982 reads pseudoaligned [quant] estimated average fragment length: 233.065 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52401 SRR7230778.ke.tsv 34699 SRR7230778.se.tsv 87100 total ==> SRR7230778.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.94 451 18.8731 Potri.005G024800.1.v4.1 1035 802.935 140 13.0311 Potri.004G059700.1.v4.1 961 728.993 14 1.43528 Potri.007G009000.2.v4.1 1416 1183.94 0 0 Potri.003G141000.2.v4.1 2943 2710.94 688 18.9671 Potri.016G087400.1.v4.1 270 86.76 621 534.939 Potri.015G069301.1.v4.1 564 337.091 0 0 Potri.010G195200.1.v4.1 1773 1540.94 38 1.84303 Potri.012G127500.1.v4.1 977 744.977 69 6.92211 ==> SRR7230778.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1133 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 277 Potri.001G212900.v4.1 343 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7230778 completed mapping pipeline successfully