Starting /dee2/code/volunteer_pipeline.sh SRR7230779 current disk space = 3056955146240 free memory = 1580036440 SRR7230779 SRAfilesize 2d02a6318f05eac854147dfb2af2521c SRR7230779.sra SRR7230779.sra file validated SRR7230779 is paired end SRR7230779 is conventional basespace SRR7230779 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230779_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.35225 34.0 33.0 34.0 33.0 34.0 2 33.44875 34.0 33.0 34.0 33.0 34.0 3 33.438 34.0 34.0 34.0 33.0 34.0 4 33.45375 34.0 34.0 34.0 33.0 34.0 5 33.42825 34.0 34.0 34.0 33.0 34.0 6 37.23775 38.0 38.0 38.0 36.0 38.0 7 37.54475 38.0 38.0 38.0 37.0 38.0 8 37.364 38.0 38.0 38.0 37.0 38.0 9 37.45575 38.0 38.0 38.0 37.0 38.0 10-14 37.55825 38.0 38.0 38.0 38.0 38.0 15-19 37.46939999999999 38.0 38.0 38.0 37.6 38.0 20-24 37.590500000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.4723 38.0 38.0 38.0 37.6 38.0 30-34 37.3328 38.0 38.0 38.0 37.2 38.0 35-39 37.25365000000001 38.0 38.0 38.0 37.0 38.0 40-44 36.91105 38.0 38.0 38.0 35.6 38.0 45-49 37.188550000000006 38.0 38.0 38.0 36.6 38.0 50-54 37.25320000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.22725 38.0 38.0 38.0 36.8 38.0 60-64 37.13385 38.0 38.0 38.0 36.2 38.0 65-69 37.1633 38.0 38.0 38.0 36.2 38.0 70-74 31.348749999999995 38.0 24.4 38.0 15.6 38.0 75-79 32.254949999999994 38.0 34.0 38.0 4.8 38.0 80-84 34.890049999999995 38.0 37.4 38.0 28.0 38.0 85-89 36.0483 38.0 38.0 38.0 33.2 38.0 90-94 36.4345 38.0 38.0 38.0 34.0 38.0 95-99 36.5279 38.0 38.0 38.0 34.2 38.0 100-104 36.3794 38.0 38.0 38.0 34.0 38.0 105-109 35.766149999999996 38.0 37.2 38.0 30.2 38.0 110-114 35.9399 38.0 36.8 38.0 32.2 38.0 115-119 35.8208 38.0 37.0 38.0 32.4 38.0 120-124 35.66015 38.0 36.8 38.0 31.0 38.0 125-129 35.0124 38.0 35.6 38.0 27.0 38.0 130-134 35.19775 38.0 35.8 38.0 28.4 38.0 135-139 35.141949999999994 38.0 36.0 38.0 28.8 38.0 140-144 34.90345 38.0 35.6 38.0 28.6 38.0 145-149 33.92965 38.0 33.8 38.0 24.0 38.0 150-151 30.45275 35.5 28.5 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 1.0 14 2.0 15 0.0 16 2.0 17 2.0 18 3.0 19 3.0 20 6.0 21 5.0 22 2.0 23 7.0 24 9.0 25 13.0 26 23.0 27 30.0 28 28.0 29 46.0 30 70.0 31 77.0 32 83.0 33 167.0 34 299.0 35 392.0 36 777.0 37 1952.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.74687343671836 16.283141570785393 7.453726863431716 32.51625812906453 2 19.75 20.7 37.05 22.5 3 18.224999999999998 26.400000000000002 28.349999999999998 27.025 4 21.95 33.7 22.575 21.775 5 20.349999999999998 37.125 25.35 17.175 6 16.6 36.475 25.900000000000002 21.025 7 14.399999999999999 21.15 44.4 20.05 8 18.525 22.775000000000002 30.599999999999998 28.1 9 17.724999999999998 21.55 33.0 27.725 10-14 19.975 29.549999999999997 26.8 23.674999999999997 15-19 20.03 28.294999999999998 27.79 23.885 20-24 19.994999999999997 29.020000000000003 27.265 23.72 25-29 20.669999999999998 28.67 27.425 23.235 30-34 20.560000000000002 28.655 27.500000000000004 23.285 35-39 20.223033455018253 27.989198379756964 27.78916837525629 23.998599789968495 40-44 19.623548257909494 28.41910292350821 28.364036844213054 23.593311974369243 45-49 20.150000000000002 28.68 27.650000000000002 23.52 50-54 20.25 28.17 28.15 23.43 55-59 20.200000000000003 28.27 28.17 23.36 60-64 20.526157847354206 28.078423527058117 27.968390517155147 23.42702810843253 65-69 20.7 27.99 27.92 23.39 70-74 20.21295370315901 28.74286722748397 27.3604329666451 23.683746102711925 75-79 19.799414018480956 28.825783186837956 27.558034708136127 23.81676808654496 80-84 20.036639623135304 28.00314053912588 28.212509814184767 23.747710023554045 85-89 20.528022701935743 28.81321576973751 27.318333840072974 23.340427688253776 90-94 20.18546365914787 27.774436090225564 28.30075187969925 23.739348370927317 95-99 20.50485825904037 28.5936091355304 27.39156566162476 23.509966943804468 100-104 20.178472953326317 28.776257081265356 27.392590364465836 23.6526796009425 105-109 20.552469599159284 27.663513986888855 28.058850022519145 23.725166391432715 110-114 20.477047704770477 28.252825282528253 27.662766276627664 23.607360736073606 115-119 21.012493101199137 28.212332547288142 27.33430334654558 23.440871004967136 120-124 20.92462311557789 28.236180904522612 27.17085427135678 23.668341708542716 125-129 20.919999999999998 28.34 27.139999999999997 23.599999999999998 130-134 21.14 28.395 27.310000000000002 23.155 135-139 20.9 28.310000000000002 27.32 23.47 140-144 21.68108405420271 28.32141607080354 26.75133756687834 23.246162308115405 145-149 20.88341346153846 28.971354166666668 26.37219551282051 23.773036858974358 150-151 20.730182545636406 28.482120530132534 26.819204801200303 23.968492123030757 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.5 22 2.0 23 1.5 24 3.5 25 4.5 26 5.5 27 12.0 28 13.5 29 17.5 30 27.5 31 40.5 32 47.5 33 57.5 34 78.5 35 94.0 36 121.0 37 143.5 38 163.5 39 177.5 40 199.0 41 225.5 42 219.5 43 233.0 44 262.5 45 258.0 46 255.5 47 232.0 48 194.5 49 176.5 50 148.0 51 137.0 52 108.0 53 76.0 54 65.5 55 53.0 56 40.5 57 29.5 58 22.0 59 15.0 60 11.0 61 7.0 62 6.5 63 3.5 64 2.0 65 1.0 66 0.0 67 0.5 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.015 40-44 0.12 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.03 65-69 0.0 70-74 15.004999999999999 75-79 11.26 80-84 4.475 85-89 1.3299999999999998 90-94 0.25 95-99 0.16999999999999998 100-104 0.265 105-109 0.08499999999999999 110-114 0.01 115-119 0.345 120-124 0.5 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.16 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42050894431847 98.65 2 0.4283194759385236 0.8500000000000001 3 0.12597631645250693 0.375 4 0.0 0.0 5 0.02519526329050139 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0125 0.0 0.0 0.0 74-75 0.05 0.025 0.0 0.0 0.0 76-77 0.05 0.025 0.0 0.0 0.0 78-79 0.05 0.025 0.0 0.0 0.0 80-81 0.05 0.025 0.0 0.0 0.0 82-83 0.075 0.025 0.0 0.0 0.0 84-85 0.1125 0.025 0.0 0.0 0.0 86-87 0.1875 0.025 0.0 0.0 0.0 88-89 0.2625 0.025 0.0 0.0 0.0 90-91 0.35 0.025 0.0 0.0 0.0 92-93 0.4 0.025 0.0 0.0 0.0 94-95 0.5 0.025 0.0 0.0 0.0 96-97 0.6125 0.025 0.0 0.0 0.0 98-99 0.7375 0.025 0.0 0.0 0.0 100-101 0.8999999999999999 0.025 0.0 0.0 0.0 102-103 1.0875 0.025 0.0 0.0 0.0 104-105 1.2 0.025 0.0 0.0 0.0 106-107 1.4625 0.025 0.0 0.0 0.0 108-109 1.675 0.025 0.0 0.0 0.0 110-111 1.95 0.025 0.0 0.0 0.0 112-113 2.1625 0.025 0.0 0.0 0.0 114-115 2.3499999999999996 0.025 0.0 0.0 0.0 116-117 2.7249999999999996 0.025 0.0 0.0 0.0 118-119 2.975 0.025 0.0 0.0 0.0 120-121 3.4375 0.025 0.0 0.0 0.0 122-123 3.9124999999999996 0.025 0.0 0.0 0.0 124-125 4.300000000000001 0.025 0.0 0.0 0.0 126-127 4.6875 0.025 0.0 0.0 0.0 128-129 5.1 0.025 0.0 0.0 0.0 130-131 5.7 0.025 0.0 0.0 0.0 132-133 6.35 0.025 0.0 0.0 0.0 134-135 6.9125 0.025 0.0 0.0 0.0 136-137 7.4 0.025 0.0 0.0 0.0 138-139 8.0125 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7230779 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230779_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.34175 33.0 33.0 34.0 32.0 34.0 2 32.84775 34.0 33.0 34.0 32.0 34.0 3 32.9285 34.0 33.0 34.0 32.0 34.0 4 32.92275 34.0 33.0 34.0 32.0 34.0 5 32.923 34.0 33.0 34.0 32.0 34.0 6 37.058 38.0 38.0 38.0 37.0 38.0 7 37.01325 38.0 38.0 38.0 37.0 38.0 8 36.972 38.0 38.0 38.0 37.0 38.0 9 36.86875 38.0 38.0 38.0 36.0 38.0 10-14 36.76649999999999 38.0 38.0 38.0 36.2 38.0 15-19 36.98415 38.0 38.0 38.0 37.0 38.0 20-24 36.92085 38.0 38.0 38.0 37.0 38.0 25-29 36.846050000000005 38.0 38.0 38.0 37.0 38.0 30-34 36.82905 38.0 38.0 38.0 37.0 38.0 35-39 36.58485 38.0 38.0 38.0 35.8 38.0 40-44 36.3741 38.0 38.0 38.0 34.8 38.0 45-49 36.54975 38.0 38.0 38.0 35.6 38.0 50-54 36.4981 38.0 38.0 38.0 35.0 38.0 55-59 36.50840000000001 38.0 38.0 38.0 35.4 38.0 60-64 36.61 38.0 38.0 38.0 36.0 38.0 65-69 36.57045000000001 38.0 38.0 38.0 35.8 38.0 70-74 36.49845 38.0 38.0 38.0 35.8 38.0 75-79 36.5063 38.0 38.0 38.0 35.8 38.0 80-84 36.5038 38.0 38.0 38.0 35.8 38.0 85-89 36.428399999999996 38.0 38.0 38.0 35.2 38.0 90-94 36.296350000000004 38.0 38.0 38.0 35.0 38.0 95-99 36.1074 38.0 38.0 38.0 33.8 38.0 100-104 35.470749999999995 38.0 37.4 38.0 30.8 38.0 105-109 35.7755 38.0 38.0 38.0 33.0 38.0 110-114 35.7861 38.0 38.0 38.0 33.4 38.0 115-119 35.76845 38.0 38.0 38.0 33.4 38.0 120-124 35.41994999999999 38.0 37.4 38.0 31.4 38.0 125-129 35.0303 38.0 36.6 38.0 29.0 38.0 130-134 34.7762 38.0 36.0 38.0 27.2 38.0 135-139 34.5857 38.0 35.8 38.0 27.2 38.0 140-144 34.2126 38.0 35.2 38.0 24.4 38.0 145-149 33.609350000000006 38.0 33.8 38.0 21.0 38.0 150-151 29.130625000000002 35.5 25.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 4.0 4 8.0 5 5.0 6 3.0 7 3.0 8 0.0 9 3.0 10 6.0 11 1.0 12 6.0 13 4.0 14 11.0 15 3.0 16 3.0 17 4.0 18 6.0 19 7.0 20 10.0 21 12.0 22 3.0 23 7.0 24 11.0 25 14.0 26 21.0 27 26.0 28 33.0 29 34.0 30 35.0 31 47.0 32 62.0 33 96.0 34 128.0 35 222.0 36 474.0 37 2673.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.33672431332655 20.574771108850456 11.164801627670396 24.92370295015259 2 24.375 25.374999999999996 33.074999999999996 17.175 3 19.775000000000002 27.775 31.775 20.674999999999997 4 23.5 35.4 22.875 18.224999999999998 5 22.95 39.175 20.200000000000003 17.675 6 20.45 36.25 24.349999999999998 18.95 7 17.549999999999997 20.175 41.275 21.0 8 20.424999999999997 22.75 28.299999999999997 28.525 9 21.275 24.675 28.299999999999997 25.75 10-14 23.444928188960617 28.249011659910924 26.212280438372616 22.093779712755843 15-19 22.7 27.839999999999996 28.16 21.3 20-24 22.694751588532547 28.408465502576675 27.768049232000802 21.12873367688998 25-29 22.97919167667067 28.13625450180072 27.526010404161667 21.358543417366946 30-34 22.20443288137289 27.953169560214143 28.7887126632311 21.053684895181867 35-39 22.765244359961983 28.467810514731628 27.68745935671052 21.07948576859587 40-44 22.95606924847393 28.23976783748624 27.694386070249173 21.109776843790655 45-49 22.581129807692307 28.495592948717945 27.659254807692307 21.264022435897438 50-54 23.10118660191258 27.33690482150904 28.34827016472238 21.213638411856007 55-59 23.078851070229085 27.891122362023157 27.92621184019249 21.103814727555264 60-64 22.810264619078584 27.772497623930768 28.027612425591514 21.389625331399127 65-69 23.534422286802283 27.15201924040485 27.983765908407655 21.329792564385208 70-74 23.459632614244956 27.593973672355975 28.094499224185395 20.851894489213674 75-79 22.640092142821373 27.788071510841807 27.908257799589364 21.66357854674746 80-84 23.42139497648354 27.434203942759932 28.234764335034523 20.909636745722004 85-89 23.75012523795211 27.57739705440337 27.787796813946496 20.884680893698025 90-94 23.47020530796194 27.82674011016525 27.931897846770156 20.771156735102654 95-99 23.158105336867905 28.194868203871355 27.619666883409195 21.02735957585155 100-104 23.903585537830672 27.124068610291545 28.254238135720357 20.718107716157423 105-109 23.11540193086889 27.837526887099195 28.547846530938926 20.49922465109299 110-114 22.82 28.199999999999996 28.13 20.849999999999998 115-119 23.990000000000002 28.405 27.36 20.244999999999997 120-124 23.674469787915168 28.336334533813524 27.78111244497799 20.208083233293316 125-129 24.33054707442815 28.194604334551276 27.328695129886384 20.14615346113419 130-134 24.8012400620031 27.816390819540977 27.366368318415923 20.01600080004 135-139 24.57860251087881 27.849747411594056 27.629670384634625 19.941979692892513 140-144 24.953696751263955 27.721880162186512 27.661811082745157 19.662612003804377 145-149 25.86888033204981 27.99419912986948 26.16892533880082 19.96799519927989 150-151 26.403300412551566 26.978372296537067 27.315914489311165 19.302412801600198 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.5 13 1.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 1.0 22 2.0 23 4.5 24 4.5 25 2.5 26 5.0 27 6.0 28 5.5 29 9.5 30 16.0 31 22.5 32 32.5 33 38.0 34 43.0 35 56.5 36 72.5 37 102.5 38 142.5 39 174.5 40 182.5 41 201.0 42 227.0 43 245.5 44 292.5 45 293.5 46 270.0 47 258.5 48 231.5 49 196.0 50 164.0 51 141.0 52 114.0 53 99.5 54 89.0 55 68.0 56 46.5 57 36.0 58 25.0 59 20.0 60 19.0 61 12.5 62 5.5 63 2.5 64 2.5 65 1.5 66 1.5 67 1.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7000000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.08499999999999999 15-19 0.0 20-24 0.065 25-29 0.04 30-34 0.065 35-39 0.045 40-44 0.06999999999999999 45-49 0.16 50-54 0.135 55-59 0.255 60-64 0.045 65-69 0.21 70-74 0.105 75-79 0.155 80-84 0.06999999999999999 85-89 0.19 90-94 0.15 95-99 0.034999999999999996 100-104 0.015 105-109 0.045 110-114 0.0 115-119 0.0 120-124 0.04 125-129 0.105 130-134 0.005 135-139 0.034999999999999996 140-144 0.11499999999999999 145-149 0.015 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24357034795764 98.4 2 0.6555723651033787 1.3 3 0.10085728693898136 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.1124999999999998 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.5125000000000002 0.0 0.0 0.0 0.0 108-109 1.7 0.0 0.0 0.0 0.0 110-111 2.0 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.7249999999999996 0.0 0.0 0.0 0.0 118-119 2.9875 0.0 0.0 0.0 0.0 120-121 3.4625 0.0 0.0 0.0 0.0 122-123 3.9499999999999997 0.0 0.0 0.0 0.0 124-125 4.35 0.0 0.0 0.0 0.0 126-127 4.7125 0.0 0.0 0.0 0.0 128-129 5.15 0.0 0.0 0.0 0.0 130-131 5.7625 0.0 0.0 0.0 0.0 132-133 6.449999999999999 0.0 0.0 0.0 0.0 134-135 7.05 0.0 0.0 0.0 0.0 136-137 7.5625 0.0 0.0 0.0 0.0 138-139 8.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 801383 spots for SRR7230779.sra Written 801383 spots for SRR7230779.sra Read 801383 spots for SRR7230779.sra Written 801383 spots for SRR7230779.sra Read 801383 spots for SRR7230779.sra Written 801383 spots for SRR7230779.sra Read 801383 spots for SRR7230779.sra Written 801383 spots for SRR7230779.sra Read 801383 spots for SRR7230779.sra Written 801383 spots for SRR7230779.sra Read 801383 spots for SRR7230779.sra Written 801383 spots for SRR7230779.sra Read 801383 spots for SRR7230779.sra Written 801383 spots for SRR7230779.sra Read 801383 spots for SRR7230779.sra Written 801383 spots for SRR7230779.sra Read 801383 spots for SRR7230779.sra Written 801383 spots for SRR7230779.sra Read 801383 spots for SRR7230779.sra Written 801383 spots for SRR7230779.sra Read 801383 spots for SRR7230779.sra Written 801383 spots for SRR7230779.sra Read 801383 spots for SRR7230779.sra Written 801383 spots for SRR7230779.sra Read 801383 spots for SRR7230779.sra Written 801383 spots for SRR7230779.sra Read 801383 spots for SRR7230779.sra Written 801383 spots for SRR7230779.sra Read 801383 spots for SRR7230779.sra Written 801383 spots for SRR7230779.sra Read 801383 spots for SRR7230779.sra Written 801383 spots for SRR7230779.sra Read 801383 spots for SRR7230779.sra Written 801383 spots for SRR7230779.sra Read 801383 spots for SRR7230779.sra Written 801383 spots for SRR7230779.sra Read 801398 spots for SRR7230779.sra Written 801398 spots for SRR7230779.sra Read 801383 spots for SRR7230779.sra Written 801383 spots for SRR7230779.sra SRR ids: ['SRR7230779.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kssmjnwl SRR7230779.sra spots: 16027675 blocks: [[1, 801383], [801384, 1602766], [1602767, 2404149], [2404150, 3205532], [3205533, 4006915], [4006916, 4808298], [4808299, 5609681], [5609682, 6411064], [6411065, 7212447], [7212448, 8013830], [8013831, 8815213], [8815214, 9616596], [9616597, 10417979], [10417980, 11219362], [11219363, 12020745], [12020746, 12822128], [12822129, 13623511], [13623512, 14424894], [14424895, 15226277], [15226278, 16027675]] SRR7230779 file size 5409552 SRR7230779 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230779 SRR7230779_1.fastq SRR7230779_2.fastq Input file: SRR7230779_1.fastq Paired file: SRR7230779_2.fastq trimmed: SRR7230779-trimmed-pair1.fastq, SRR7230779-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 03:06:01 2025 >> started Tue Feb 11 03:13:42 2025 >> done (460.597s) 16027675 read pairs processed; of these: 19825 ( 0.12%) short read pairs filtered out after trimming by size control 14510 ( 0.09%) empty read pairs filtered out after trimming by size control 15993340 (99.79%) read pairs available; of these: 7682088 (48.03%) trimmed read pairs available after processing 8311252 (51.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 6 0.00% 21 4 0.00% 22 5 0.00% 23 7 0.00% 24 6 0.00% 25 2 0.00% 26 13 0.00% 27 7 0.00% 28 9 0.00% 29 5 0.00% 30 12 0.00% 31 9 0.00% 32 11 0.00% 33 9 0.00% 34 10 0.00% 35 16 0.00% 36 10 0.00% 37 18 0.00% 38 24 0.00% 39 23 0.00% 40 21 0.00% 41 32 0.00% 42 31 0.00% 43 27 0.00% 44 33 0.00% 45 46 0.00% 46 44 0.00% 47 49 0.00% 48 50 0.00% 49 66 0.00% 50 73 0.00% 51 77 0.00% 52 96 0.00% 53 117 0.00% 54 99 0.00% 55 119 0.00% 56 143 0.00% 57 148 0.00% 58 178 0.00% 59 206 0.00% 60 236 0.00% 61 274 0.00% 62 312 0.00% 63 329 0.00% 64 368 0.00% 65 419 0.00% 66 521 0.00% 67 558 0.00% 68 660 0.00% 69 883 0.01% 70 1110 0.01% 71 998 0.01% 72 1134 0.01% 73 1241 0.01% 74 1314 0.01% 75 1517 0.01% 76 1606 0.01% 77 1862 0.01% 78 2003 0.01% 79 2330 0.01% 80 2685 0.02% 81 2949 0.02% 82 3475 0.02% 83 3797 0.02% 84 5143 0.03% 85 6067 0.04% 86 6106 0.04% 87 6789 0.04% 88 7295 0.05% 89 7738 0.05% 90 8277 0.05% 91 8863 0.06% 92 9723 0.06% 93 10458 0.07% 94 11309 0.07% 95 11871 0.07% 96 12503 0.08% 97 13173 0.08% 98 13900 0.09% 99 14893 0.09% 100 15925 0.10% 101 16725 0.10% 102 18019 0.11% 103 19102 0.12% 104 19946 0.12% 105 21342 0.13% 106 22001 0.14% 107 23108 0.14% 108 24017 0.15% 109 25408 0.16% 110 26177 0.16% 111 27755 0.17% 112 29264 0.18% 113 30494 0.19% 114 31905 0.20% 115 33146 0.21% 116 35036 0.22% 117 35749 0.22% 118 36764 0.23% 119 37900 0.24% 120 39706 0.25% 121 41137 0.26% 122 42718 0.27% 123 44752 0.28% 124 46494 0.29% 125 47929 0.30% 126 49776 0.31% 127 51029 0.32% 128 52552 0.33% 129 54621 0.34% 130 56576 0.35% 131 58484 0.37% 132 60984 0.38% 133 64823 0.41% 134 67499 0.42% 135 71169 0.44% 136 74205 0.46% 137 78026 0.49% 138 81587 0.51% 139 86331 0.54% 140 90375 0.57% 141 97796 0.61% 142 105270 0.66% 143 117432 0.73% 144 134049 0.84% 145 156100 0.98% 146 195736 1.22% 147 245081 1.53% 148 380790 2.38% 149 708427 4.43% 150 3562288 22.27% 151 8311252 51.97% 15993340 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.86 fanout-score-rank=5 prefix-density=0.69 prefix-fanout=3.1 sequence=CCATTGCTTGCAATGGAAGTAATGTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=533.89 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=18.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=21 prefix-density=0.72 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=166.15 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=10.6 sequence=AAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7230779 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 03:40:52 Started mapping on | Feb 11 03:41:06 Finished on | Feb 11 05:15:58 Mapping speed, Million of reads per hour | 10.12 Number of input reads | 15993340 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14718322 Uniquely mapped reads % | 92.03% Average mapped length | 292.52 Number of splices: Total | 14033587 Number of splices: Annotated (sjdb) | 13722138 Number of splices: GT/AG | 13754885 Number of splices: GC/AG | 231106 Number of splices: AT/AC | 7346 Number of splices: Non-canonical | 40250 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 422318 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 90000 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.60% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 874401 874401 874401 N_multimapping 422318 422318 422318 N_noFeature 600254 14467452 714258 N_ambiguous 240973 997 103420 UnstrandedReadsAssigned:13877095 PositiveStrandReadsAssigned:249873 NegativeStrandReadsAssigned:13900644 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7230779 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230779-trimmed-pair1.fastq SRR7230779-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,993,340 reads, 14,021,212 reads pseudoaligned [quant] estimated average fragment length: 239.968 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52401 SRR7230779.ke.tsv 34699 SRR7230779.se.tsv 87100 total ==> SRR7230779.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.03 585 22.7649 Potri.005G024800.1.v4.1 1035 796.032 148 12.8713 Potri.004G059700.1.v4.1 961 722.115 3 0.287612 Potri.007G009000.2.v4.1 1416 1177.03 0 0 Potri.003G141000.2.v4.1 2943 2704.03 689 17.6401 Potri.016G087400.1.v4.1 270 86.2219 609 488.981 Potri.015G069301.1.v4.1 564 333.112 0 0 Potri.010G195200.1.v4.1 1773 1534.03 24 1.0831 Potri.012G127500.1.v4.1 977 738.06 202 18.9475 ==> SRR7230779.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 526 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 240 Potri.001G212900.v4.1 63 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 30 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR7230779 completed mapping pipeline successfully