Starting /dee2/code/volunteer_pipeline.sh SRR7230780 current disk space = 3057393606656 free memory = 1277630716 SRR7230780 SRAfilesize 02f39fff10bdb157a1ede8d0632513d1 SRR7230780.sra SRR7230780.sra file validated SRR7230780 is paired end SRR7230780 is conventional basespace SRR7230780 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230780_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.33625 34.0 33.0 34.0 33.0 34.0 2 33.42475 34.0 33.0 34.0 33.0 34.0 3 33.454 34.0 34.0 34.0 33.0 34.0 4 33.467 34.0 34.0 34.0 33.0 34.0 5 33.452 34.0 34.0 34.0 33.0 34.0 6 37.2375 38.0 38.0 38.0 36.0 38.0 7 37.493 38.0 38.0 38.0 37.0 38.0 8 37.5995 38.0 38.0 38.0 38.0 38.0 9 37.60825 38.0 38.0 38.0 38.0 38.0 10-14 37.533699999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.526650000000004 38.0 38.0 38.0 37.8 38.0 20-24 37.28744999999999 38.0 38.0 38.0 36.8 38.0 25-29 37.38715 38.0 38.0 38.0 37.6 38.0 30-34 37.4952 38.0 38.0 38.0 37.8 38.0 35-39 37.388099999999994 38.0 38.0 38.0 37.4 38.0 40-44 36.92115 38.0 38.0 38.0 36.0 38.0 45-49 37.05215 38.0 38.0 38.0 35.8 38.0 50-54 37.32455 38.0 38.0 38.0 37.0 38.0 55-59 37.2543 38.0 38.0 38.0 37.0 38.0 60-64 37.165350000000004 38.0 38.0 38.0 36.6 38.0 65-69 37.135149999999996 38.0 38.0 38.0 36.2 38.0 70-74 32.58365 38.0 26.8 38.0 15.4 38.0 75-79 33.27804999999999 38.0 36.0 38.0 17.0 38.0 80-84 35.35985 38.0 37.4 38.0 29.2 38.0 85-89 36.40855 38.0 38.0 38.0 33.8 38.0 90-94 36.4521 38.0 38.0 38.0 34.0 38.0 95-99 36.422900000000006 38.0 38.0 38.0 34.0 38.0 100-104 36.33575 38.0 38.0 38.0 34.0 38.0 105-109 36.328900000000004 38.0 38.0 38.0 34.0 38.0 110-114 34.8563 38.0 35.6 38.0 26.0 38.0 115-119 34.579550000000005 38.0 35.0 38.0 24.0 38.0 120-124 35.161500000000004 38.0 35.8 38.0 28.8 38.0 125-129 34.5759 38.0 35.2 38.0 25.0 38.0 130-134 34.438100000000006 38.0 34.8 38.0 24.6 38.0 135-139 33.88085 38.0 34.4 38.0 21.8 38.0 140-144 34.0613 38.0 34.2 38.0 23.8 38.0 145-149 33.180600000000005 38.0 33.8 38.0 18.6 38.0 150-151 28.8085 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 5.0 15 3.0 16 2.0 17 4.0 18 1.0 19 4.0 20 8.0 21 7.0 22 8.0 23 12.0 24 12.0 25 12.0 26 20.0 27 32.0 28 34.0 29 49.0 30 55.0 31 76.0 32 86.0 33 153.0 34 274.0 35 441.0 36 856.0 37 1844.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.65 16.375 10.95 37.025000000000006 2 20.325 21.375 36.775000000000006 21.525 3 19.35 27.1 26.625 26.924999999999997 4 22.375 34.300000000000004 21.95 21.375 5 20.65 37.275000000000006 23.974999999999998 18.099999999999998 6 17.224999999999998 36.925000000000004 26.075 19.775000000000002 7 12.725 21.8 46.375 19.1 8 17.625 22.425 30.775000000000002 29.175 9 18.025 23.674999999999997 31.95 26.35 10-14 19.91099554977749 29.556477823891193 26.79133956697835 23.741187059352967 15-19 20.235 28.425 27.79 23.549999999999997 20-24 19.515 29.285 28.17 23.03 25-29 20.164114880416292 28.75012508756129 27.68938256779746 23.39637746422496 30-34 19.975998799939997 28.88144407220361 27.66638331916596 23.476173808690433 35-39 20.46602330116506 28.781439071953596 27.211360568028404 23.541177058852945 40-44 20.11609287429944 28.873098478783028 27.426941553242596 23.58386709367494 45-49 20.225 28.9 27.165 23.71 50-54 20.44 29.054999999999996 27.544999999999998 22.96 55-59 19.71880316221355 28.294806364455116 28.299809866906834 23.6865806064245 60-64 19.91393975783048 28.564995496847796 28.354848393875713 23.16621635144601 65-69 19.900970291087326 28.71361408422527 27.993398019405824 23.392017605281584 70-74 19.967211261235796 28.77494488099949 27.33337102153881 23.924472836225902 75-79 19.938650306748464 28.60429447852761 27.525197195442598 23.931858019281332 80-84 19.909222199298533 27.83680627192078 28.357747060037138 23.89622446874355 85-89 19.88362760834671 29.740168539325847 27.07664526484751 23.299558587479936 90-94 20.333049957493625 28.794319147872184 27.279091863779563 23.59353903085463 95-99 20.351017550877543 28.34141707085354 28.041402070103505 23.266163308165407 100-104 20.447044704470446 28.06280628062806 27.807780778077806 23.682368236823685 105-109 20.630000000000003 28.634999999999998 27.16 23.575 110-114 20.62 28.82 27.400000000000002 23.16 115-119 20.607060706070605 28.762876287628764 27.04770477047705 23.582358235823584 120-124 20.519233655144813 28.81296583462558 26.9421239557801 23.7256765544495 125-129 20.79 27.875 27.639999999999997 23.695 130-134 20.745 28.775000000000002 26.99 23.49 135-139 20.785 28.449999999999996 27.11 23.655 140-144 20.945 28.465 27.18 23.41 145-149 20.908136220433065 29.03435515327299 26.754013101965295 23.30349552432865 150-151 21.125 28.875 26.450000000000003 23.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 2.5 22 3.5 23 4.0 24 4.0 25 4.5 26 9.0 27 12.0 28 13.5 29 18.5 30 23.5 31 33.5 32 46.0 33 54.5 34 65.0 35 83.5 36 109.5 37 126.5 38 152.5 39 182.0 40 206.0 41 225.5 42 234.0 43 270.0 44 286.0 45 275.0 46 266.5 47 238.5 48 210.0 49 172.0 50 146.0 51 125.0 52 101.5 53 76.5 54 55.0 55 44.5 56 32.5 57 28.0 58 18.0 59 13.0 60 9.5 61 4.5 62 3.0 63 1.0 64 0.5 65 1.0 66 1.5 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.06999999999999999 30-34 0.005 35-39 0.005 40-44 0.08 45-49 0.0 50-54 0.0 55-59 0.06999999999999999 60-64 0.06999999999999999 65-69 0.03 70-74 11.555 75-79 8.72 80-84 3.06 85-89 0.32 90-94 0.015 95-99 0.005 100-104 0.01 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.045 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.015 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.5125 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.2875 0.0 0.0 0.0 0.0 116-117 2.425 0.0 0.0 0.0 0.0 118-119 2.7375 0.0 0.0 0.0 0.0 120-121 2.9749999999999996 0.0 0.0 0.0 0.0 122-123 3.1500000000000004 0.0 0.0 0.0 0.0 124-125 3.4875 0.0 0.0 0.0 0.0 126-127 3.9 0.0 0.0 0.0 0.0 128-129 4.199999999999999 0.0 0.0 0.0 0.0 130-131 4.6 0.0 0.0 0.0 0.0 132-133 5.0875 0.0 0.0 0.0 0.0 134-135 5.5625 0.0 0.0 0.0 0.0 136-137 6.0125 0.0 0.0 0.0 0.0 138-139 6.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTACAT 10 0.007225711 142.3 5 >>END_MODULE SRR7230780 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230780_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9235 33.0 33.0 34.0 32.0 34.0 2 33.06525 34.0 33.0 34.0 32.0 34.0 3 33.054 34.0 33.0 34.0 32.0 34.0 4 33.054 34.0 33.0 34.0 33.0 34.0 5 33.028 34.0 33.0 34.0 32.0 34.0 6 37.068 38.0 38.0 38.0 37.0 38.0 7 37.07025 38.0 38.0 38.0 37.0 38.0 8 37.02725 38.0 38.0 38.0 37.0 38.0 9 37.0495 38.0 38.0 38.0 37.0 38.0 10-14 37.04455 38.0 38.0 38.0 37.0 38.0 15-19 37.089749999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.1221 38.0 38.0 38.0 37.0 38.0 25-29 37.09805 38.0 38.0 38.0 37.0 38.0 30-34 37.04485 38.0 38.0 38.0 37.0 38.0 35-39 36.8313 38.0 38.0 38.0 36.2 38.0 40-44 36.630100000000006 38.0 38.0 38.0 35.4 38.0 45-49 36.922000000000004 38.0 38.0 38.0 36.6 38.0 50-54 36.91225 38.0 38.0 38.0 36.4 38.0 55-59 36.5321 38.0 38.0 38.0 35.2 38.0 60-64 36.854699999999994 38.0 38.0 38.0 36.0 38.0 65-69 36.6635 38.0 38.0 38.0 35.8 38.0 70-74 36.6125 38.0 38.0 38.0 35.6 38.0 75-79 36.6366 38.0 38.0 38.0 35.6 38.0 80-84 36.56815 38.0 38.0 38.0 35.2 38.0 85-89 36.49655 38.0 38.0 38.0 35.0 38.0 90-94 36.48295 38.0 38.0 38.0 34.8 38.0 95-99 35.9012 38.0 37.4 38.0 31.8 38.0 100-104 36.0824 38.0 38.0 38.0 33.8 38.0 105-109 35.67445 38.0 37.4 38.0 31.6 38.0 110-114 35.7976 38.0 37.8 38.0 32.4 38.0 115-119 35.8476 38.0 37.8 38.0 33.2 38.0 120-124 35.586999999999996 38.0 37.2 38.0 31.8 38.0 125-129 35.2418 38.0 36.4 38.0 30.2 38.0 130-134 35.09795 38.0 36.0 38.0 28.8 38.0 135-139 34.717650000000006 38.0 36.0 38.0 27.6 38.0 140-144 34.18045 38.0 35.0 38.0 24.8 38.0 145-149 33.406549999999996 38.0 33.2 38.0 19.8 38.0 150-151 27.4595 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 6.0 4 2.0 5 2.0 6 4.0 7 1.0 8 1.0 9 4.0 10 1.0 11 1.0 12 2.0 13 4.0 14 2.0 15 2.0 16 5.0 17 4.0 18 7.0 19 10.0 20 5.0 21 3.0 22 8.0 23 11.0 24 11.0 25 19.0 26 22.0 27 22.0 28 27.0 29 40.0 30 53.0 31 56.0 32 71.0 33 95.0 34 122.0 35 253.0 36 569.0 37 2549.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.05 17.474999999999998 13.8 30.675 2 24.275 25.424999999999997 34.65 15.65 3 20.175 28.349999999999998 31.175000000000004 20.3 4 23.775 35.525 22.125 18.575 5 23.625 36.675000000000004 22.900000000000002 16.8 6 18.3 36.4 26.174999999999997 19.125 7 17.724999999999998 17.849999999999998 43.025000000000006 21.4 8 20.275000000000002 23.599999999999998 28.499999999999996 27.625 9 20.05 23.75 29.4 26.8 10-14 23.575 28.634999999999998 26.445 21.345 15-19 22.81 28.405 27.82 20.965 20-24 22.759999999999998 28.410000000000004 28.425 20.405 25-29 22.415 28.665000000000003 27.93 20.990000000000002 30-34 23.025000000000002 28.249999999999996 27.915 20.810000000000002 35-39 22.21499674853684 27.822520134060326 28.69291181031464 21.26957130708819 40-44 22.30111505575279 27.951397569878495 28.54142707135357 21.20606030301515 45-49 22.63226322632263 28.20782078207821 28.38783878387839 20.77207720772077 50-54 22.8 28.37 28.205000000000002 20.625 55-59 23.015196348864038 27.885049400672052 27.945232960529616 21.1545212899343 60-64 23.442344234423445 27.29272927292729 28.312831283128315 20.95209520952095 65-69 22.763369521511862 27.86992360273422 28.3021712907117 21.06453558504222 70-74 23.271450075263424 27.616658304064224 27.962870045158056 21.1490215755143 75-79 23.365 27.744999999999997 27.67 21.22 80-84 23.461422996097266 27.684379065345745 28.234764335034523 20.619433603522467 85-89 23.794999999999998 27.43 28.13 20.645 90-94 23.24 27.775 28.389999999999997 20.595 95-99 23.36 27.615000000000002 28.095 20.93 100-104 23.27 28.035 27.715 20.979999999999997 105-109 23.71 27.495000000000005 28.43 20.365 110-114 23.24 28.275 28.144999999999996 20.34 115-119 23.72 27.944999999999997 27.66 20.674999999999997 120-124 23.565 27.794999999999998 28.21 20.43 125-129 23.485 28.205000000000002 27.875 20.435 130-134 24.45 28.325 27.185 20.04 135-139 23.836191809590478 28.066403320166007 27.821391069553474 20.276013800690034 140-144 24.508578002300805 28.309908467963783 27.279547841744613 19.901965687990796 145-149 25.705 27.810000000000002 27.155 19.33 150-151 25.5375 28.0625 26.900000000000002 19.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 2.5 25 3.5 26 5.0 27 7.5 28 9.5 29 12.0 30 20.0 31 25.0 32 30.5 33 38.0 34 49.0 35 73.0 36 95.0 37 112.5 38 133.5 39 167.5 40 200.0 41 223.0 42 239.5 43 262.0 44 279.5 45 275.5 46 263.0 47 239.5 48 223.5 49 201.0 50 174.5 51 146.5 52 113.0 53 87.5 54 64.0 55 59.0 56 54.0 57 35.0 58 26.0 59 19.5 60 10.5 61 6.5 62 4.0 63 2.0 64 1.5 65 1.0 66 0.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.045 40-44 0.005 45-49 0.01 50-54 0.0 55-59 0.305 60-64 0.01 65-69 0.52 70-74 0.35000000000000003 75-79 0.0 80-84 0.06999999999999999 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.034999999999999996 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52225295448831 98.95 2 0.4023133014835303 0.8 3 0.050289162685441285 0.15 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.05 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.4875 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.9875 0.0 0.0 0.0 0.0 114-115 2.2625 0.0 0.0 0.0 0.0 116-117 2.45 0.0 0.0 0.0 0.0 118-119 2.7750000000000004 0.0 0.0 0.0 0.0 120-121 3.0250000000000004 0.0 0.0 0.0 0.0 122-123 3.2375 0.0 0.0 0.0 0.0 124-125 3.575 0.0 0.0 0.0 0.0 126-127 3.9875000000000003 0.0 0.0 0.0 0.0 128-129 4.324999999999999 0.0 0.0 0.0 0.0 130-131 4.75 0.0 0.0 0.0 0.0 132-133 5.3 0.0 0.0 0.0 0.0 134-135 5.8 0.0 0.0 0.0 0.0 136-137 6.3125 0.0 0.0 0.0 0.0 138-139 6.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCCTC 10 0.0068555363 144.825 1 >>END_MODULE Read 650997 spots for SRR7230780.sra Written 650997 spots for SRR7230780.sra Read 650997 spots for SRR7230780.sra Written 650997 spots for SRR7230780.sra Read 650997 spots for SRR7230780.sra Written 650997 spots for SRR7230780.sra Read 650997 spots for SRR7230780.sra Written 650997 spots for SRR7230780.sra Read 650997 spots for SRR7230780.sra Written 650997 spots for SRR7230780.sra Read 650997 spots for SRR7230780.sra Written 650997 spots for SRR7230780.sra Read 650997 spots for SRR7230780.sra Written 650997 spots for SRR7230780.sra Read 650997 spots for SRR7230780.sra Written 650997 spots for SRR7230780.sra Read 650997 spots for SRR7230780.sra Written 650997 spots for SRR7230780.sra Read 650997 spots for SRR7230780.sra Written 650997 spots for SRR7230780.sra Read 650997 spots for SRR7230780.sra Written 650997 spots for SRR7230780.sra Read 651016 spots for SRR7230780.sra Written 651016 spots for SRR7230780.sra Read 650997 spots for SRR7230780.sra Written 650997 spots for SRR7230780.sra Read 650997 spots for SRR7230780.sra Written 650997 spots for SRR7230780.sra Read 650997 spots for SRR7230780.sra Written 650997 spots for SRR7230780.sra Read 650997 spots for SRR7230780.sra Written 650997 spots for SRR7230780.sra Read 650997 spots for SRR7230780.sra Written 650997 spots for SRR7230780.sra Read 650997 spots for SRR7230780.sra Written 650997 spots for SRR7230780.sra Read 650997 spots for SRR7230780.sra Written 650997 spots for SRR7230780.sra Read 650997 spots for SRR7230780.sra Written 650997 spots for SRR7230780.sra SRR ids: ['SRR7230780.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5jcg5zao SRR7230780.sra spots: 13019959 blocks: [[1, 650997], [650998, 1301994], [1301995, 1952991], [1952992, 2603988], [2603989, 3254985], [3254986, 3905982], [3905983, 4556979], [4556980, 5207976], [5207977, 5858973], [5858974, 6509970], [6509971, 7160967], [7160968, 7811964], [7811965, 8462961], [8462962, 9113958], [9113959, 9764955], [9764956, 10415952], [10415953, 11066949], [11066950, 11717946], [11717947, 12368943], [12368944, 13019959]] SRR7230780 file size 4390336 SRR7230780 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230780 SRR7230780_1.fastq SRR7230780_2.fastq Input file: SRR7230780_1.fastq Paired file: SRR7230780_2.fastq trimmed: SRR7230780-trimmed-pair1.fastq, SRR7230780-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:48:58 2025 >> started Tue Feb 11 00:49:12 2025 >> done (14.338s) 13019959 read pairs processed; of these: 16739 ( 0.13%) short read pairs filtered out after trimming by size control 18749 ( 0.14%) empty read pairs filtered out after trimming by size control 12984471 (99.73%) read pairs available; of these: 6008979 (46.28%) trimmed read pairs available after processing 6975492 (53.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 0 0.00% 21 0 0.00% 22 2 0.00% 23 1 0.00% 24 4 0.00% 25 2 0.00% 26 6 0.00% 27 7 0.00% 28 1 0.00% 29 3 0.00% 30 6 0.00% 31 7 0.00% 32 8 0.00% 33 7 0.00% 34 10 0.00% 35 10 0.00% 36 7 0.00% 37 12 0.00% 38 15 0.00% 39 16 0.00% 40 23 0.00% 41 12 0.00% 42 17 0.00% 43 29 0.00% 44 31 0.00% 45 26 0.00% 46 21 0.00% 47 29 0.00% 48 41 0.00% 49 44 0.00% 50 56 0.00% 51 52 0.00% 52 73 0.00% 53 82 0.00% 54 72 0.00% 55 84 0.00% 56 85 0.00% 57 115 0.00% 58 141 0.00% 59 143 0.00% 60 160 0.00% 61 196 0.00% 62 208 0.00% 63 253 0.00% 64 274 0.00% 65 310 0.00% 66 330 0.00% 67 408 0.00% 68 505 0.00% 69 581 0.00% 70 653 0.01% 71 683 0.01% 72 684 0.01% 73 815 0.01% 74 917 0.01% 75 982 0.01% 76 1162 0.01% 77 1293 0.01% 78 1409 0.01% 79 1548 0.01% 80 1704 0.01% 81 2113 0.02% 82 2612 0.02% 83 2518 0.02% 84 3613 0.03% 85 4174 0.03% 86 4422 0.03% 87 4788 0.04% 88 4998 0.04% 89 5341 0.04% 90 5707 0.04% 91 6094 0.05% 92 6513 0.05% 93 7191 0.06% 94 7772 0.06% 95 8294 0.06% 96 8722 0.07% 97 9309 0.07% 98 9734 0.07% 99 10289 0.08% 100 11001 0.08% 101 11495 0.09% 102 12419 0.10% 103 13117 0.10% 104 13657 0.11% 105 14886 0.11% 106 15383 0.12% 107 16167 0.12% 108 16889 0.13% 109 17788 0.14% 110 18693 0.14% 111 19688 0.15% 112 20510 0.16% 113 21165 0.16% 114 22572 0.17% 115 23492 0.18% 116 24265 0.19% 117 25393 0.20% 118 26138 0.20% 119 27235 0.21% 120 28239 0.22% 121 29564 0.23% 122 30835 0.24% 123 32464 0.25% 124 33264 0.26% 125 34830 0.27% 126 35743 0.28% 127 37082 0.29% 128 38361 0.30% 129 40383 0.31% 130 41774 0.32% 131 43828 0.34% 132 45804 0.35% 133 48278 0.37% 134 50134 0.39% 135 52797 0.41% 136 55656 0.43% 137 58507 0.45% 138 61433 0.47% 139 65363 0.50% 140 69881 0.54% 141 75675 0.58% 142 82827 0.64% 143 91315 0.70% 144 104195 0.80% 145 120744 0.93% 146 147817 1.14% 147 193772 1.49% 148 282914 2.18% 149 538038 4.14% 150 2934925 22.60% 151 6975492 53.72% 12984471 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=9 prefix-density=0.46 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=21 fanout-score=8.95 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=2.7 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGT criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=24 prefix-density=0.67 prefix-fanout=2.0 sequence=AACCGCACCCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=167.79 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=11.3 sequence=GGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTT SRR7230780 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:49:58 Started mapping on | Feb 11 00:49:59 Finished on | Feb 11 00:51:23 Mapping speed, Million of reads per hour | 556.48 Number of input reads | 12984471 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12258855 Uniquely mapped reads % | 94.41% Average mapped length | 293.57 Number of splices: Total | 11778667 Number of splices: Annotated (sjdb) | 11518830 Number of splices: GT/AG | 11541163 Number of splices: GC/AG | 196711 Number of splices: AT/AC | 6558 Number of splices: Non-canonical | 34235 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 358609 % of reads mapped to multiple loci | 2.76% Number of reads mapped to too many loci | 21782 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.56% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 382706 382706 382706 N_multimapping 358609 358609 358609 N_noFeature 494728 12055864 588346 N_ambiguous 191559 951 81525 UnstrandedReadsAssigned:11572568 PositiveStrandReadsAssigned:202040 NegativeStrandReadsAssigned:11588984 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7230780 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230780-trimmed-pair1.fastq SRR7230780-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,984,471 reads, 11,595,356 reads pseudoaligned [quant] estimated average fragment length: 240.337 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,003 rounds 52401 SRR7230780.ke.tsv 34699 SRR7230780.se.tsv 87100 total ==> SRR7230780.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.66 456 21.6007 Potri.005G024800.1.v4.1 1035 795.663 80 8.47145 Potri.004G059700.1.v4.1 961 721.706 26 3.03536 Potri.007G009000.2.v4.1 1416 1176.66 0 0 Potri.003G141000.2.v4.1 2943 2703.66 698 21.752 Potri.016G087400.1.v4.1 270 82.7723 616 627.036 Potri.015G069301.1.v4.1 564 331.256 0 0 Potri.010G195200.1.v4.1 1773 1533.66 33 1.81293 Potri.012G127500.1.v4.1 977 737.687 55 6.28184 ==> SRR7230780.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 989 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 204 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7230780 completed mapping pipeline successfully