Starting /dee2/code/volunteer_pipeline.sh SRR7230781 current disk space = 3056964435968 free memory = 1580079656 SRR7230781 SRAfilesize 5c55f23d164f0e00b3bd6d1eca4ca755 SRR7230781.sra SRR7230781.sra file validated SRR7230781 is paired end SRR7230781 is conventional basespace SRR7230781 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230781_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6835 33.0 33.0 34.0 32.0 34.0 2 33.07425 34.0 33.0 34.0 32.0 34.0 3 33.26425 34.0 33.0 34.0 33.0 34.0 4 33.288 34.0 33.0 34.0 33.0 34.0 5 31.82525 33.0 33.0 34.0 27.0 34.0 6 36.48575 38.0 37.0 38.0 33.0 38.0 7 37.1395 38.0 38.0 38.0 36.0 38.0 8 37.4445 38.0 38.0 38.0 37.0 38.0 9 37.435 38.0 38.0 38.0 37.0 38.0 10-14 37.40605 38.0 38.0 38.0 37.2 38.0 15-19 37.3879 38.0 38.0 38.0 37.4 38.0 20-24 36.84054999999999 38.0 38.0 38.0 35.6 38.0 25-29 37.2938 38.0 38.0 38.0 37.0 38.0 30-34 37.2384 38.0 38.0 38.0 36.8 38.0 35-39 36.953649999999996 38.0 38.0 38.0 35.8 38.0 40-44 36.632099999999994 38.0 38.0 38.0 34.6 38.0 45-49 37.11445 38.0 38.0 38.0 36.6 38.0 50-54 37.110200000000006 38.0 38.0 38.0 36.6 38.0 55-59 37.015 38.0 38.0 38.0 36.0 38.0 60-64 37.08015 38.0 38.0 38.0 36.0 38.0 65-69 37.056200000000004 38.0 38.0 38.0 36.0 38.0 70-74 30.1333 38.0 19.2 38.0 15.4 38.0 75-79 31.3545 38.0 30.8 38.0 7.2 38.0 80-84 34.716 38.0 36.8 38.0 25.6 38.0 85-89 36.0606 38.0 38.0 38.0 32.2 38.0 90-94 36.2881 38.0 38.0 38.0 33.8 38.0 95-99 36.29505 38.0 38.0 38.0 34.0 38.0 100-104 36.3482 38.0 38.0 38.0 34.0 38.0 105-109 36.36685 38.0 38.0 38.0 34.0 38.0 110-114 36.2333 38.0 38.0 38.0 33.8 38.0 115-119 35.830600000000004 38.0 37.0 38.0 32.4 38.0 120-124 35.47285 38.0 36.4 38.0 30.4 38.0 125-129 35.1392 38.0 36.0 38.0 29.0 38.0 130-134 34.950300000000006 38.0 35.6 38.0 27.8 38.0 135-139 34.7924 38.0 35.2 38.0 27.8 38.0 140-144 34.312149999999995 38.0 34.8 38.0 24.8 38.0 145-149 33.5929 38.0 33.4 38.0 22.4 38.0 150-151 29.405625 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 1.0 12 1.0 13 2.0 14 1.0 15 2.0 16 0.0 17 5.0 18 5.0 19 3.0 20 9.0 21 7.0 22 5.0 23 14.0 24 9.0 25 18.0 26 21.0 27 35.0 28 38.0 29 43.0 30 79.0 31 70.0 32 105.0 33 164.0 34 280.0 35 477.0 36 871.0 37 1733.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.45 15.1 10.7 33.75 2 21.175 19.0 35.825 24.0 3 19.05 25.75 27.950000000000003 27.250000000000004 4 23.325000000000003 33.300000000000004 21.55 21.825 5 20.4 36.1 24.4 19.1 6 17.025000000000002 36.675000000000004 24.775 21.525 7 14.099999999999998 23.7 44.175 18.025 8 17.299999999999997 22.1 32.15 28.449999999999996 9 18.15 24.25 31.55 26.05 10-14 19.43 29.409999999999997 27.145000000000003 24.015 15-19 20.126006300315016 28.706435321766087 27.841392069603483 23.326166308315415 20-24 19.66 28.9 27.82 23.62 25-29 19.771977197719774 29.47794779477948 27.032703270327037 23.717371737173718 30-34 19.93 28.725 27.265 24.08 35-39 20.200000000000003 28.494999999999997 27.435 23.87 40-44 19.822796215647994 29.098463232717624 27.681834109225612 23.39690644240877 45-49 20.1 28.515 27.584999999999997 23.799999999999997 50-54 20.523078461769266 28.31924788718308 27.499124868730306 23.65854878231735 55-59 19.638747122986093 28.910237166016213 27.519263484439104 23.931752226558594 60-64 20.300150075037518 28.724362181090545 27.433716858429214 23.541770885442723 65-69 20.48331415420023 28.54355330965127 27.297743533296643 23.675389002851855 70-74 19.73948505691156 29.00359121066407 27.28102745145779 23.975896280966584 75-79 20.495896229122422 28.605865809562076 27.07340871262125 23.824829248694254 80-84 20.552677029360964 27.780394619772856 27.780394619772856 23.88653373109332 85-89 20.19734192509062 28.357833266210232 27.235199355618207 24.209625453080953 90-94 20.705000000000002 28.365000000000002 26.795 24.135 95-99 20.794999999999998 27.975 27.200000000000003 24.03 100-104 19.895 28.845 27.72 23.54 105-109 20.625 28.744999999999997 27.24 23.39 110-114 20.835 27.785 27.455000000000002 23.925 115-119 21.055 28.33 27.18 23.435 120-124 20.925 27.725 27.38 23.97 125-129 20.34 28.645 26.575 24.44 130-134 20.825 28.044999999999998 27.1 24.03 135-139 20.885 28.435 26.784999999999997 23.895 140-144 21.2 27.555000000000003 26.655 24.59 145-149 21.17 28.1 26.32 24.41 150-151 20.325 28.599999999999998 26.5375 24.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 1.5 23 2.0 24 6.0 25 8.0 26 8.5 27 10.0 28 12.5 29 20.0 30 25.5 31 38.5 32 49.0 33 61.0 34 82.0 35 95.5 36 109.0 37 132.5 38 151.5 39 182.0 40 212.0 41 212.0 42 231.0 43 245.0 44 240.5 45 252.5 46 243.5 47 219.5 48 207.5 49 189.0 50 160.5 51 128.5 52 104.0 53 88.5 54 68.5 55 45.0 56 35.5 57 30.0 58 23.0 59 20.5 60 11.5 61 5.0 62 6.5 63 5.0 64 4.0 65 3.5 66 1.5 67 1.5 68 2.5 69 3.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.01 30-34 0.0 35-39 0.0 40-44 0.11499999999999999 45-49 0.0 50-54 0.015 55-59 0.06999999999999999 60-64 0.05 65-69 0.065 70-74 17.854999999999997 75-79 12.885 80-84 4.465 85-89 0.6799999999999999 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.9125000000000001 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.55 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 2.0875000000000004 0.0 0.0 0.0 0.0 112-113 2.4625000000000004 0.0 0.0 0.0 0.0 114-115 2.85 0.0 0.0 0.0 0.0 116-117 3.3375 0.0 0.0 0.0 0.0 118-119 3.8 0.0 0.0 0.0 0.0 120-121 4.3 0.0 0.0 0.0 0.0 122-123 4.625 0.0 0.0 0.0 0.0 124-125 5.050000000000001 0.0 0.0 0.0 0.0 126-127 5.5125 0.0 0.0 0.0 0.0 128-129 5.9375 0.0 0.0 0.0 0.0 130-131 6.3875 0.0 0.0 0.0 0.0 132-133 6.8875 0.0 0.0 0.0 0.0 134-135 7.3125 0.0 0.0 0.0 0.0 136-137 7.925 0.0 0.0 0.0 0.0 138-139 8.587499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7230781 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230781_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.777 33.0 33.0 34.0 32.0 34.0 2 32.9315 34.0 33.0 34.0 32.0 34.0 3 32.94175 34.0 33.0 34.0 32.0 34.0 4 32.922 34.0 33.0 34.0 32.0 34.0 5 32.4835 34.0 33.0 34.0 32.0 34.0 6 36.67625 38.0 38.0 38.0 35.0 38.0 7 36.7335 38.0 38.0 38.0 35.0 38.0 8 36.91475 38.0 38.0 38.0 36.0 38.0 9 36.79475 38.0 38.0 38.0 36.0 38.0 10-14 36.51335 38.0 38.0 38.0 34.2 38.0 15-19 37.006150000000005 38.0 38.0 38.0 36.8 38.0 20-24 36.901650000000004 38.0 38.0 38.0 36.6 38.0 25-29 36.621849999999995 38.0 38.0 38.0 35.0 38.0 30-34 36.79469999999999 38.0 38.0 38.0 36.0 38.0 35-39 36.497699999999995 38.0 38.0 38.0 35.0 38.0 40-44 36.16925 38.0 38.0 38.0 33.0 38.0 45-49 36.49975 38.0 38.0 38.0 35.0 38.0 50-54 36.6238 38.0 38.0 38.0 35.4 38.0 55-59 36.540049999999994 38.0 38.0 38.0 35.6 38.0 60-64 36.4658 38.0 38.0 38.0 34.6 38.0 65-69 36.083600000000004 38.0 37.8 38.0 32.8 38.0 70-74 36.36255 38.0 38.0 38.0 34.6 38.0 75-79 36.4778 38.0 38.0 38.0 35.0 38.0 80-84 36.3433 38.0 38.0 38.0 34.4 38.0 85-89 36.392399999999995 38.0 38.0 38.0 35.0 38.0 90-94 36.309900000000006 38.0 38.0 38.0 34.2 38.0 95-99 36.1242 38.0 38.0 38.0 34.0 38.0 100-104 35.4933 38.0 37.2 38.0 30.4 38.0 105-109 35.59065 38.0 37.4 38.0 31.0 38.0 110-114 35.666199999999996 38.0 37.4 38.0 32.6 38.0 115-119 35.714999999999996 38.0 37.8 38.0 32.2 38.0 120-124 35.4543 38.0 37.2 38.0 30.8 38.0 125-129 34.90245 38.0 36.0 38.0 27.8 38.0 130-134 34.81145000000001 38.0 36.0 38.0 27.4 38.0 135-139 34.5187 38.0 35.8 38.0 26.6 38.0 140-144 33.73265 38.0 33.8 38.0 21.2 38.0 145-149 32.516850000000005 38.0 33.0 38.0 10.8 38.0 150-151 25.967125000000003 34.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 6.0 4 3.0 5 3.0 6 2.0 7 2.0 8 2.0 9 5.0 10 5.0 11 1.0 12 2.0 13 2.0 14 4.0 15 4.0 16 6.0 17 7.0 18 9.0 19 5.0 20 6.0 21 7.0 22 8.0 23 17.0 24 15.0 25 20.0 26 35.0 27 18.0 28 39.0 29 40.0 30 58.0 31 65.0 32 94.0 33 99.0 34 133.0 35 262.0 36 550.0 37 2455.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.325 18.275 15.0 25.4 2 25.05 25.525 31.924999999999997 17.5 3 20.625 28.15 31.35 19.875 4 24.025 34.699999999999996 21.8 19.475 5 24.575 36.975 21.099999999999998 17.349999999999998 6 19.950000000000003 36.9 23.95 19.2 7 19.3 18.224999999999998 40.65 21.825 8 20.875 23.275000000000002 28.15 27.700000000000003 9 22.575 24.725 28.449999999999996 24.25 10-14 23.775 27.66 26.755000000000003 21.81 15-19 23.415 27.525 27.595 21.465 20-24 22.720000000000002 28.09 28.139999999999997 21.05 25-29 23.215 28.144999999999996 27.54 21.099999999999998 30-34 23.169999999999998 27.650000000000002 27.834999999999997 21.345 35-39 23.165 27.92 27.63 21.285 40-44 23.36 28.144999999999996 27.715 20.78 45-49 23.278491773766067 27.649147372105816 27.619142871430714 21.453217982697403 50-54 23.62007706550568 27.813641595356053 27.383275784416757 21.18300555472151 55-59 23.862497494487872 27.600721587492483 27.846261775906996 20.69051914211265 60-64 23.13615680784039 27.461373068653433 28.32641632081604 21.076053802690133 65-69 23.992784125075165 27.275005011024255 28.07676889156144 20.655441972339148 70-74 23.71531603726335 27.927476710407696 27.511770009015322 20.845437243313633 75-79 23.385 27.295 27.765 21.555 80-84 23.728559283892583 27.53413011951793 27.41911286693004 21.31819772965945 85-89 24.315 28.000000000000004 27.045 20.64 90-94 23.78 27.99 27.529999999999998 20.7 95-99 24.279999999999998 27.32 28.335 20.064999999999998 100-104 23.445 27.845 28.26 20.45 105-109 23.705000000000002 27.52 27.985 20.79 110-114 23.615 27.61 27.939999999999998 20.835 115-119 23.915 28.775000000000002 27.36 19.950000000000003 120-124 24.365000000000002 28.439999999999998 27.115000000000002 20.080000000000002 125-129 25.105 27.675 26.875 20.345 130-134 24.759999999999998 27.755000000000003 27.500000000000004 19.985 135-139 25.235000000000003 27.884999999999998 27.38 19.5 140-144 25.855 27.99 26.889999999999997 19.265 145-149 25.990000000000002 28.410000000000004 26.36 19.24 150-151 25.674999999999997 28.15 26.5 19.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.5 22 2.0 23 1.0 24 0.5 25 2.0 26 3.5 27 5.5 28 9.0 29 11.5 30 17.5 31 18.5 32 18.0 33 31.0 34 50.5 35 59.0 36 70.0 37 96.0 38 124.5 39 150.5 40 196.5 41 226.5 42 236.0 43 263.0 44 276.5 45 281.0 46 267.5 47 233.5 48 216.0 49 207.0 50 174.0 51 137.0 52 121.5 53 105.0 54 88.0 55 81.0 56 57.0 57 36.0 58 30.5 59 23.0 60 18.0 61 14.5 62 10.5 63 7.5 64 5.5 65 1.5 66 2.5 67 3.0 68 1.5 69 1.0 70 1.0 71 1.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.015 50-54 0.08499999999999999 55-59 0.22 60-64 0.005 65-69 0.22 70-74 0.16999999999999998 75-79 0.0 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 0.9874999999999999 0.0 0.0 0.0 0.0 102-103 1.1375 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.4500000000000002 0.0 0.0 0.0 0.0 108-109 1.625 0.0 0.0 0.0 0.0 110-111 1.9500000000000002 0.0 0.0 0.0 0.0 112-113 2.3375 0.0 0.0 0.0 0.0 114-115 2.775 0.0 0.0 0.0 0.0 116-117 3.2875 0.0 0.0 0.0 0.0 118-119 3.775 0.0 0.0 0.0 0.0 120-121 4.2375 0.0 0.0 0.0 0.0 122-123 4.55 0.0 0.0 0.0 0.0 124-125 5.0 0.0 0.0 0.0 0.0 126-127 5.475 0.0 0.0 0.0 0.0 128-129 5.875 0.0 0.0 0.0 0.0 130-131 6.3 0.0 0.0 0.0 0.0 132-133 6.8 0.0 0.0 0.0 0.0 134-135 7.275 0.0 0.0 0.0 0.0 136-137 7.8875 0.0 0.0 0.0 0.0 138-139 8.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAAGG 10 0.006875036 144.6875 2 GTTCAAG 10 0.006875036 144.6875 1 AGGCTGG 10 0.006875036 144.6875 6 AGTTTCA 10 0.006875036 144.6875 9 >>END_MODULE Read 1060828 spots for SRR7230781.sra Written 1060828 spots for SRR7230781.sra Read 1060828 spots for SRR7230781.sra Written 1060828 spots for SRR7230781.sra Read 1060834 spots for SRR7230781.sra Written 1060834 spots for SRR7230781.sra Read 1060828 spots for SRR7230781.sra Written 1060828 spots for SRR7230781.sra Read 1060828 spots for SRR7230781.sra Written 1060828 spots for SRR7230781.sra Read 1060828 spots for SRR7230781.sra Written 1060828 spots for SRR7230781.sra Read 1060828 spots for SRR7230781.sra Written 1060828 spots for SRR7230781.sra Read 1060828 spots for SRR7230781.sra Written 1060828 spots for SRR7230781.sra Read 1060828 spots for SRR7230781.sra Written 1060828 spots for SRR7230781.sra Read 1060828 spots for SRR7230781.sra Written 1060828 spots for SRR7230781.sra Read 1060828 spots for SRR7230781.sra Written 1060828 spots for SRR7230781.sra Read 1060828 spots for SRR7230781.sra Written 1060828 spots for SRR7230781.sra Read 1060828 spots for SRR7230781.sra Written 1060828 spots for SRR7230781.sra Read 1060828 spots for SRR7230781.sra Written 1060828 spots for SRR7230781.sra Read 1060828 spots for SRR7230781.sra Written 1060828 spots for SRR7230781.sra Read 1060828 spots for SRR7230781.sra Written 1060828 spots for SRR7230781.sra Read 1060828 spots for SRR7230781.sra Written 1060828 spots for SRR7230781.sra Read 1060828 spots for SRR7230781.sra Written 1060828 spots for SRR7230781.sra Read 1060828 spots for SRR7230781.sra Written 1060828 spots for SRR7230781.sra Read 1060828 spots for SRR7230781.sra Written 1060828 spots for SRR7230781.sra SRR ids: ['SRR7230781.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ra3dm8js SRR7230781.sra spots: 21216566 blocks: [[1, 1060828], [1060829, 2121656], [2121657, 3182484], [3182485, 4243312], [4243313, 5304140], [5304141, 6364968], [6364969, 7425796], [7425797, 8486624], [8486625, 9547452], [9547453, 10608280], [10608281, 11669108], [11669109, 12729936], [12729937, 13790764], [13790765, 14851592], [14851593, 15912420], [15912421, 16973248], [16973249, 18034076], [18034077, 19094904], [19094905, 20155732], [20155733, 21216566]] SRR7230781 file size 7167897 SRR7230781 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230781 SRR7230781_1.fastq SRR7230781_2.fastq Input file: SRR7230781_1.fastq Paired file: SRR7230781_2.fastq trimmed: SRR7230781-trimmed-pair1.fastq, SRR7230781-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 03:40:49 2025 >> started Tue Feb 11 03:49:16 2025 >> done (506.789s) 21216566 read pairs processed; of these: 34249 ( 0.16%) short read pairs filtered out after trimming by size control 39534 ( 0.19%) empty read pairs filtered out after trimming by size control 21142783 (99.65%) read pairs available; of these: 10112407 (47.83%) trimmed read pairs available after processing 11030376 (52.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 8 0.00% 20 1 0.00% 21 4 0.00% 22 10 0.00% 23 6 0.00% 24 10 0.00% 25 4 0.00% 26 10 0.00% 27 8 0.00% 28 16 0.00% 29 10 0.00% 30 17 0.00% 31 14 0.00% 32 13 0.00% 33 12 0.00% 34 21 0.00% 35 14 0.00% 36 27 0.00% 37 23 0.00% 38 26 0.00% 39 24 0.00% 40 43 0.00% 41 40 0.00% 42 40 0.00% 43 48 0.00% 44 64 0.00% 45 60 0.00% 46 90 0.00% 47 85 0.00% 48 99 0.00% 49 96 0.00% 50 108 0.00% 51 166 0.00% 52 152 0.00% 53 189 0.00% 54 174 0.00% 55 202 0.00% 56 246 0.00% 57 306 0.00% 58 302 0.00% 59 360 0.00% 60 394 0.00% 61 449 0.00% 62 497 0.00% 63 612 0.00% 64 648 0.00% 65 688 0.00% 66 815 0.00% 67 1183 0.01% 68 1652 0.01% 69 2531 0.01% 70 2041 0.01% 71 1554 0.01% 72 1746 0.01% 73 1993 0.01% 74 2207 0.01% 75 2416 0.01% 76 2756 0.01% 77 2937 0.01% 78 3379 0.02% 79 3869 0.02% 80 4179 0.02% 81 4802 0.02% 82 5495 0.03% 83 6316 0.03% 84 8259 0.04% 85 9554 0.05% 86 10323 0.05% 87 11154 0.05% 88 11707 0.06% 89 12512 0.06% 90 13190 0.06% 91 13972 0.07% 92 14876 0.07% 93 16094 0.08% 94 17194 0.08% 95 18372 0.09% 96 19273 0.09% 97 20441 0.10% 98 21202 0.10% 99 22653 0.11% 100 24039 0.11% 101 25079 0.12% 102 26608 0.13% 103 28098 0.13% 104 29678 0.14% 105 31384 0.15% 106 32726 0.15% 107 33966 0.16% 108 35452 0.17% 109 37380 0.18% 110 39310 0.19% 111 40422 0.19% 112 41907 0.20% 113 43749 0.21% 114 45552 0.22% 115 47743 0.23% 116 49018 0.23% 117 50346 0.24% 118 51972 0.25% 119 53965 0.26% 120 55636 0.26% 121 57319 0.27% 122 59769 0.28% 123 62631 0.30% 124 64609 0.31% 125 66625 0.32% 126 68898 0.33% 127 70907 0.34% 128 73059 0.35% 129 75785 0.36% 130 78802 0.37% 131 80467 0.38% 132 84308 0.40% 133 88748 0.42% 134 92428 0.44% 135 96430 0.46% 136 100036 0.47% 137 104965 0.50% 138 109857 0.52% 139 117065 0.55% 140 121372 0.57% 141 130125 0.62% 142 139975 0.66% 143 153463 0.73% 144 174656 0.83% 145 206721 0.98% 146 244920 1.16% 147 315860 1.49% 148 454601 2.15% 149 869112 4.11% 150 4625773 21.88% 151 11030376 52.17% 21142783 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=19 prefix-density=0.47 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=12.97 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=1.9 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=23 prefix-density=0.42 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.17 sequence-density-rank=20 fanout-score=15.75 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=5.6 sequence=AGCAATGGCAGCA SRR7230781 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 04:17:15 Started mapping on | Feb 11 04:17:26 Finished on | Feb 11 05:50:40 Mapping speed, Million of reads per hour | 13.61 Number of input reads | 21142783 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 19527522 Uniquely mapped reads % | 92.36% Average mapped length | 292.01 Number of splices: Total | 17670089 Number of splices: Annotated (sjdb) | 17233079 Number of splices: GT/AG | 17318276 Number of splices: GC/AG | 277108 Number of splices: AT/AC | 11554 Number of splices: Non-canonical | 63151 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 597930 % of reads mapped to multiple loci | 2.83% Number of reads mapped to too many loci | 161952 % of reads mapped to too many loci | 0.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.86% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1049096 1049096 1049096 N_multimapping 597930 597930 597930 N_noFeature 758094 19206526 888745 N_ambiguous 341123 1415 149883 UnstrandedReadsAssigned:18428305 PositiveStrandReadsAssigned:319581 NegativeStrandReadsAssigned:18488894 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7230781 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230781-trimmed-pair1.fastq SRR7230781-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,142,783 reads, 18,636,379 reads pseudoaligned [quant] estimated average fragment length: 226.273 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,062 rounds 52401 SRR7230781.ke.tsv 34699 SRR7230781.se.tsv 87100 total ==> SRR7230781.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.73 909 25.7309 Potri.005G024800.1.v4.1 1035 809.727 204 12.7849 Potri.004G059700.1.v4.1 961 735.752 21 1.44842 Potri.007G009000.2.v4.1 1416 1190.73 0 0 Potri.003G141000.2.v4.1 2943 2717.73 818 15.274 Potri.016G087400.1.v4.1 270 87.0645 1316 767.045 Potri.015G069301.1.v4.1 564 342.397 0 0 Potri.010G195200.1.v4.1 1773 1547.73 79 2.59023 Potri.012G127500.1.v4.1 977 751.747 310 20.9265 ==> SRR7230781.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2631 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 498 Potri.001G212900.v4.1 83 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7230781 completed mapping pipeline successfully