Starting /dee2/code/volunteer_pipeline.sh SRR7230782 current disk space = 3057027371008 free memory = 1506323588 SRR7230782 SRAfilesize c6d731635ee9a8e1ece79d9c53fd9684 SRR7230782.sra SRR7230782.sra file validated SRR7230782 is paired end SRR7230782 is conventional basespace SRR7230782 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230782_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.07225 34.0 33.0 34.0 32.0 34.0 2 32.9315 34.0 33.0 34.0 32.0 34.0 3 32.99875 34.0 33.0 34.0 32.0 34.0 4 33.105 34.0 33.0 34.0 32.0 34.0 5 33.06275 34.0 33.0 34.0 32.0 34.0 6 36.842 38.0 37.0 38.0 35.0 38.0 7 37.193 38.0 38.0 38.0 36.0 38.0 8 37.2715 38.0 38.0 38.0 37.0 38.0 9 37.411 38.0 38.0 38.0 37.0 38.0 10-14 37.357 38.0 38.0 38.0 37.0 38.0 15-19 37.201350000000005 38.0 38.0 38.0 36.8 38.0 20-24 37.0728 38.0 38.0 38.0 36.2 38.0 25-29 36.97435 38.0 38.0 38.0 35.8 38.0 30-34 36.9422 38.0 38.0 38.0 35.8 38.0 35-39 37.02405 38.0 38.0 38.0 36.0 38.0 40-44 36.9963 38.0 38.0 38.0 36.0 38.0 45-49 36.955650000000006 38.0 38.0 38.0 36.0 38.0 50-54 36.9092 38.0 38.0 38.0 35.8 38.0 55-59 36.73285 38.0 38.0 38.0 34.8 38.0 60-64 36.6759 38.0 38.0 38.0 34.6 38.0 65-69 36.6694 38.0 38.0 38.0 34.6 38.0 70-74 36.19745 38.0 37.6 38.0 32.8 38.0 75-79 36.45705 38.0 38.0 38.0 34.0 38.0 80-84 36.414100000000005 38.0 38.0 38.0 34.0 38.0 85-89 36.2314 38.0 37.8 38.0 33.8 38.0 90-94 36.0555 38.0 37.0 38.0 32.8 38.0 95-99 35.77575 38.0 36.8 38.0 31.2 38.0 100-104 35.4403 38.0 36.6 38.0 29.4 38.0 105-109 34.8414 38.0 35.8 38.0 25.8 38.0 110-114 35.23225 38.0 36.0 38.0 28.4 38.0 115-119 35.0089 38.0 35.4 38.0 27.8 38.0 120-124 34.965650000000004 38.0 35.8 38.0 27.8 38.0 125-129 34.229049999999994 38.0 34.8 38.0 23.6 38.0 130-134 33.8424 38.0 34.4 38.0 21.0 38.0 135-139 33.13635000000001 38.0 33.8 38.0 15.0 38.0 140-144 32.46825 37.8 32.6 38.0 14.0 38.0 145-149 30.9549 36.8 31.0 38.0 8.6 38.0 150-151 26.052625 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 1.0 5 0.0 6 1.0 7 2.0 8 1.0 9 0.0 10 0.0 11 1.0 12 2.0 13 0.0 14 2.0 15 1.0 16 0.0 17 3.0 18 7.0 19 6.0 20 8.0 21 5.0 22 13.0 23 15.0 24 16.0 25 27.0 26 32.0 27 31.0 28 53.0 29 65.0 30 53.0 31 89.0 32 114.0 33 150.0 34 230.0 35 374.0 36 834.0 37 1862.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.56751163993792 14.588722193481635 11.200206932229694 32.64355923435075 2 23.075000000000003 19.400000000000002 33.0 24.525 3 19.425 25.124999999999996 26.35 29.099999999999998 4 21.725 34.275 22.400000000000002 21.6 5 23.025000000000002 35.675000000000004 22.675 18.625 6 17.2 34.699999999999996 26.8 21.3 7 13.725000000000001 23.525 43.824999999999996 18.925 8 17.25 23.425 31.25 28.075 9 18.65 22.85 32.550000000000004 25.95 10-14 20.39 29.744999999999997 26.334999999999997 23.53 15-19 19.575 29.054999999999996 27.98 23.39 20-24 19.955000000000002 28.535 27.93 23.580000000000002 25-29 19.935 28.999999999999996 27.939999999999998 23.125 30-34 20.275000000000002 28.499999999999996 27.58 23.645 35-39 20.165 28.884999999999998 27.565 23.385 40-44 20.23 28.884999999999998 27.47 23.415 45-49 20.775 28.689999999999998 27.41 23.125 50-54 20.595 28.02 27.655 23.73 55-59 20.419999999999998 28.435 27.565 23.580000000000002 60-64 20.235 28.32 27.73 23.715 65-69 20.68 28.535 26.900000000000002 23.885 70-74 20.14 28.565 27.455000000000002 23.84 75-79 20.405 28.475 27.425 23.695 80-84 20.699139827965592 28.160632126425284 27.020404080816164 24.119823964792957 85-89 20.701912486232104 28.752378091518977 27.1402823670772 23.405427055171725 90-94 20.54246109192814 28.254015913526498 27.79862883450933 23.40489416003603 95-99 20.53 28.22 27.525 23.724999999999998 100-104 20.62760038097148 28.788410446638927 26.878540277708158 23.70544889468144 105-109 21.009665948815545 28.121400310512346 27.49035909250263 23.37857464816948 110-114 20.79 27.93 27.35 23.93 115-119 20.97 27.900000000000002 27.42 23.71 120-124 20.724999999999998 28.395 27.27 23.61 125-129 21.05 27.88 27.025 24.044999999999998 130-134 21.575 27.43 26.889999999999997 24.104999999999997 135-139 21.395 28.28 26.19 24.135 140-144 22.605 28.005000000000003 25.96 23.43 145-149 21.33 28.060000000000002 26.179999999999996 24.43 150-151 20.7625 28.012500000000003 26.887499999999996 24.337500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 1.0 18 1.0 19 0.5 20 0.5 21 0.0 22 1.0 23 1.5 24 3.0 25 4.5 26 4.0 27 5.5 28 8.0 29 15.5 30 21.5 31 29.5 32 44.0 33 57.5 34 64.0 35 72.0 36 94.0 37 120.0 38 138.0 39 151.5 40 185.5 41 206.5 42 223.0 43 249.0 44 257.0 45 246.5 46 237.0 47 244.0 48 224.5 49 196.0 50 170.5 51 140.5 52 122.0 53 99.0 54 78.5 55 72.0 56 56.0 57 40.5 58 32.0 59 27.0 60 22.0 61 13.0 62 7.5 63 2.5 64 1.0 65 0.5 66 1.5 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.02 85-89 0.13 90-94 0.08499999999999999 95-99 0.0 100-104 0.255 105-109 0.165 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98887765419616 97.89999999999999 2 0.910010111223458 1.7999999999999998 3 0.10111223458038424 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.11249999999999999 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.8999999999999999 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.2875 0.0 0.0 0.0 0.0 108-109 1.425 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 2.025 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.7 0.0 0.0 0.0 0.0 118-119 3.0625 0.0 0.0 0.0 0.0 120-121 3.425 0.0 0.0 0.0 0.0 122-123 3.8875 0.0 0.0 0.0 0.0 124-125 4.2625 0.0 0.0 0.0 0.0 126-127 4.625 0.0 0.0 0.0 0.0 128-129 4.9875 0.0 0.0 0.0 0.0 130-131 5.575 0.0 0.0 0.0 0.0 132-133 6.1875 0.0 0.0 0.0 0.0 134-135 6.6 0.0 0.0 0.0 0.0 136-137 7.125 0.0 0.0 0.0 0.0 138-139 7.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGCAC 10 0.006923209 144.35 7 >>END_MODULE SRR7230782 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230782_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.805 33.0 33.0 34.0 32.0 34.0 2 32.88275 34.0 33.0 34.0 32.0 34.0 3 32.92325 34.0 33.0 34.0 32.0 34.0 4 32.77625 34.0 33.0 34.0 32.0 34.0 5 32.736 34.0 33.0 34.0 32.0 34.0 6 36.80375 38.0 38.0 38.0 36.0 38.0 7 36.84425 38.0 38.0 38.0 36.0 38.0 8 36.8505 38.0 38.0 38.0 36.0 38.0 9 36.85425 38.0 38.0 38.0 36.0 38.0 10-14 36.38185 38.0 37.8 38.0 33.6 38.0 15-19 36.72095 38.0 38.0 38.0 35.6 38.0 20-24 36.7375 38.0 38.0 38.0 36.0 38.0 25-29 36.686400000000006 38.0 38.0 38.0 35.6 38.0 30-34 36.43125 38.0 38.0 38.0 34.0 38.0 35-39 36.647000000000006 38.0 38.0 38.0 35.6 38.0 40-44 36.540949999999995 38.0 38.0 38.0 35.0 38.0 45-49 36.39 38.0 38.0 38.0 34.0 38.0 50-54 36.54155 38.0 38.0 38.0 35.0 38.0 55-59 36.59155 38.0 38.0 38.0 35.0 38.0 60-64 36.4988 38.0 38.0 38.0 34.8 38.0 65-69 36.41175 38.0 38.0 38.0 34.6 38.0 70-74 36.08315 38.0 38.0 38.0 32.8 38.0 75-79 36.21295 38.0 38.0 38.0 33.8 38.0 80-84 36.146 38.0 38.0 38.0 33.8 38.0 85-89 36.0086 38.0 38.0 38.0 33.4 38.0 90-94 35.76155 38.0 37.8 38.0 32.0 38.0 95-99 35.8094 38.0 37.8 38.0 32.4 38.0 100-104 35.6944 38.0 37.8 38.0 32.4 38.0 105-109 35.19540000000001 38.0 36.8 38.0 28.4 38.0 110-114 35.2087 38.0 36.6 38.0 29.6 38.0 115-119 35.1486 38.0 36.4 38.0 28.6 38.0 120-124 34.95360000000001 38.0 36.2 38.0 28.6 38.0 125-129 34.222750000000005 38.0 35.4 38.0 23.8 38.0 130-134 33.2924 38.0 34.0 38.0 19.2 38.0 135-139 32.808400000000006 38.0 33.6 38.0 15.8 38.0 140-144 32.27325 38.0 32.2 38.0 13.2 38.0 145-149 31.281799999999997 37.4 31.8 38.0 6.4 38.0 150-151 27.312125 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 6.0 4 4.0 5 0.0 6 3.0 7 2.0 8 7.0 9 8.0 10 2.0 11 2.0 12 7.0 13 3.0 14 7.0 15 7.0 16 4.0 17 8.0 18 7.0 19 8.0 20 16.0 21 16.0 22 15.0 23 13.0 24 29.0 25 18.0 26 20.0 27 33.0 28 40.0 29 42.0 30 59.0 31 73.0 32 102.0 33 117.0 34 177.0 35 285.0 36 695.0 37 2160.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.3 20.0 14.299999999999999 24.4 2 27.3 25.0 29.799999999999997 17.9 3 21.55 28.15 31.075000000000003 19.225 4 23.575 35.699999999999996 22.125 18.6 5 24.725 36.825 20.599999999999998 17.849999999999998 6 20.575 36.625 23.525 19.275000000000002 7 18.275 19.275000000000002 39.975 22.475 8 20.225 24.175 27.3 28.299999999999997 9 22.825 25.15 26.75 25.275 10-14 23.04 28.035 26.545 22.38 15-19 24.145 27.42 27.794999999999998 20.64 20-24 23.315 27.529999999999998 27.57 21.584999999999997 25-29 22.57 28.455000000000002 27.805000000000003 21.17 30-34 22.97 27.555000000000003 28.225 21.25 35-39 22.939999999999998 27.725 27.295 22.040000000000003 40-44 23.580000000000002 27.955000000000002 27.3 21.165 45-49 22.29 28.04 28.305000000000003 21.365000000000002 50-54 23.625 27.560000000000002 27.365000000000002 21.45 55-59 23.39 27.32 28.21 21.08 60-64 23.200000000000003 27.834999999999997 27.73 21.235 65-69 23.31 27.575 27.744999999999997 21.37 70-74 23.395 27.46 27.400000000000002 21.745 75-79 23.66 27.189999999999998 27.565 21.584999999999997 80-84 23.095 27.92 27.875 21.11 85-89 24.185000000000002 28.275 27.205000000000002 20.335 90-94 23.244999999999997 27.99 27.450000000000003 21.315 95-99 23.630000000000003 27.755000000000003 27.555000000000003 21.060000000000002 100-104 23.86 28.12 27.665 20.355 105-109 23.87 26.540000000000003 28.425 21.165 110-114 23.95 27.3 27.705000000000002 21.044999999999998 115-119 23.825 27.915 27.435 20.825 120-124 24.02 27.700000000000003 27.775 20.505000000000003 125-129 24.385 27.6 27.529999999999998 20.485 130-134 24.79 27.700000000000003 26.93 20.580000000000002 135-139 24.595 27.37 27.52 20.515 140-144 25.14 27.77 26.63 20.46 145-149 25.424999999999997 28.16 26.435 19.98 150-151 25.2 27.9375 27.2625 19.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 2.0 22 1.5 23 1.0 24 1.5 25 1.0 26 1.0 27 3.5 28 5.5 29 11.0 30 16.5 31 17.5 32 28.5 33 37.5 34 40.5 35 58.0 36 73.0 37 100.0 38 139.0 39 166.5 40 185.0 41 203.0 42 215.0 43 232.5 44 256.0 45 255.0 46 261.0 47 258.5 48 234.0 49 213.5 50 196.5 51 166.5 52 131.5 53 111.5 54 95.0 55 74.5 56 54.5 57 40.0 58 28.5 59 19.5 60 19.0 61 16.5 62 9.0 63 6.5 64 3.0 65 2.0 66 1.5 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01290812452544 97.8 2 0.8099215388509239 1.6 3 0.10124019235636549 0.3 4 0.07593014426727411 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.6000000000000001 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.4874999999999998 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.3375 0.0 0.0 0.0 0.0 116-117 2.6500000000000004 0.0 0.0 0.0 0.0 118-119 3.0125 0.0 0.0 0.0 0.0 120-121 3.4000000000000004 0.0 0.0 0.0 0.0 122-123 3.85 0.0 0.0 0.0 0.0 124-125 4.2125 0.0 0.0 0.0 0.0 126-127 4.637499999999999 0.0 0.0 0.0 0.0 128-129 5.0 0.0 0.0 0.0 0.0 130-131 5.575 0.0 0.0 0.0 0.0 132-133 6.1875 0.0 0.0 0.0 0.0 134-135 6.612500000000001 0.0 0.0 0.0 0.0 136-137 7.1375 0.0 0.0 0.0 0.0 138-139 7.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 776977 spots for SRR7230782.sra Written 776977 spots for SRR7230782.sra Read 776977 spots for SRR7230782.sra Written 776977 spots for SRR7230782.sra Read 776977 spots for SRR7230782.sra Written 776977 spots for SRR7230782.sra Read 776977 spots for SRR7230782.sra Written 776977 spots for SRR7230782.sra Read 776977 spots for SRR7230782.sra Written 776977 spots for SRR7230782.sra Read 776977 spots for SRR7230782.sra Written 776977 spots for SRR7230782.sra Read 776977 spots for SRR7230782.sra Written 776977 spots for SRR7230782.sra Read 776977 spots for SRR7230782.sra Written 776977 spots for SRR7230782.sra Read 776977 spots for SRR7230782.sra Written 776977 spots for SRR7230782.sra Read 776977 spots for SRR7230782.sra Written 776977 spots for SRR7230782.sra Read 776977 spots for SRR7230782.sra Written 776977 spots for SRR7230782.sra Read 776977 spots for SRR7230782.sra Written 776977 spots for SRR7230782.sra Read 776977 spots for SRR7230782.sra Written 776977 spots for SRR7230782.sra Read 776977 spots for SRR7230782.sra Written 776977 spots for SRR7230782.sra Read 776977 spots for SRR7230782.sra Written 776977 spots for SRR7230782.sra Read 776977 spots for SRR7230782.sra Written 776977 spots for SRR7230782.sra Read 776977 spots for SRR7230782.sra Written 776977 spots for SRR7230782.sra Read 776977 spots for SRR7230782.sra Written 776977 spots for SRR7230782.sra Read 776977 spots for SRR7230782.sra Written 776977 spots for SRR7230782.sra Read 776986 spots for SRR7230782.sra Written 776986 spots for SRR7230782.sra SRR ids: ['SRR7230782.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_75yelu_o SRR7230782.sra spots: 15539549 blocks: [[1, 776977], [776978, 1553954], [1553955, 2330931], [2330932, 3107908], [3107909, 3884885], [3884886, 4661862], [4661863, 5438839], [5438840, 6215816], [6215817, 6992793], [6992794, 7769770], [7769771, 8546747], [8546748, 9323724], [9323725, 10100701], [10100702, 10877678], [10877679, 11654655], [11654656, 12431632], [12431633, 13208609], [13208610, 13985586], [13985587, 14762563], [14762564, 15539549]] SRR7230782 file size 5244142 SRR7230782 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230782 SRR7230782_1.fastq SRR7230782_2.fastq Input file: SRR7230782_1.fastq Paired file: SRR7230782_2.fastq trimmed: SRR7230782-trimmed-pair1.fastq, SRR7230782-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 01:45:19 2025 >> started Tue Feb 11 01:49:04 2025 >> done (224.641s) 15539549 read pairs processed; of these: 25095 ( 0.16%) short read pairs filtered out after trimming by size control 17115 ( 0.11%) empty read pairs filtered out after trimming by size control 15497339 (99.73%) read pairs available; of these: 8884621 (57.33%) trimmed read pairs available after processing 6612718 (42.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 7 0.00% 20 7 0.00% 21 4 0.00% 22 4 0.00% 23 10 0.00% 24 10 0.00% 25 9 0.00% 26 11 0.00% 27 10 0.00% 28 15 0.00% 29 12 0.00% 30 17 0.00% 31 17 0.00% 32 17 0.00% 33 16 0.00% 34 17 0.00% 35 11 0.00% 36 23 0.00% 37 21 0.00% 38 26 0.00% 39 27 0.00% 40 26 0.00% 41 19 0.00% 42 35 0.00% 43 36 0.00% 44 37 0.00% 45 44 0.00% 46 47 0.00% 47 55 0.00% 48 57 0.00% 49 73 0.00% 50 88 0.00% 51 85 0.00% 52 117 0.00% 53 125 0.00% 54 141 0.00% 55 136 0.00% 56 161 0.00% 57 185 0.00% 58 226 0.00% 59 231 0.00% 60 276 0.00% 61 270 0.00% 62 312 0.00% 63 366 0.00% 64 385 0.00% 65 441 0.00% 66 499 0.00% 67 571 0.00% 68 755 0.00% 69 1264 0.01% 70 1425 0.01% 71 1135 0.01% 72 1176 0.01% 73 1365 0.01% 74 1439 0.01% 75 1581 0.01% 76 1755 0.01% 77 1951 0.01% 78 2186 0.01% 79 2523 0.02% 80 2794 0.02% 81 3189 0.02% 82 3637 0.02% 83 4206 0.03% 84 5488 0.04% 85 6431 0.04% 86 6838 0.04% 87 7508 0.05% 88 7893 0.05% 89 8320 0.05% 90 9154 0.06% 91 9717 0.06% 92 10233 0.07% 93 11176 0.07% 94 11794 0.08% 95 12465 0.08% 96 13382 0.09% 97 13764 0.09% 98 14342 0.09% 99 15325 0.10% 100 16406 0.11% 101 17323 0.11% 102 18610 0.12% 103 19565 0.13% 104 20716 0.13% 105 22203 0.14% 106 22567 0.15% 107 23822 0.15% 108 24695 0.16% 109 26211 0.17% 110 27629 0.18% 111 28733 0.19% 112 30379 0.20% 113 31293 0.20% 114 33179 0.21% 115 34659 0.22% 116 36162 0.23% 117 36902 0.24% 118 38482 0.25% 119 39707 0.26% 120 41539 0.27% 121 43181 0.28% 122 44981 0.29% 123 47803 0.31% 124 49451 0.32% 125 51314 0.33% 126 53786 0.35% 127 55317 0.36% 128 58064 0.37% 129 61206 0.39% 130 63709 0.41% 131 66359 0.43% 132 69720 0.45% 133 73797 0.48% 134 77044 0.50% 135 82663 0.53% 136 87194 0.56% 137 92169 0.59% 138 98504 0.64% 139 105262 0.68% 140 114080 0.74% 141 125089 0.81% 142 137757 0.89% 143 156868 1.01% 144 179093 1.16% 145 213199 1.38% 146 264213 1.70% 147 352472 2.27% 148 519125 3.35% 149 975848 6.30% 150 3773023 24.35% 151 6612718 42.67% 15497339 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=16 prefix-density=0.59 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=22 fanout-score=213.28 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCT criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=19 prefix-density=0.59 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.16 sequence-density-rank=20 fanout-score=9.30 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=5.5 sequence=CAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR7230782 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 02:10:07 Started mapping on | Feb 11 02:10:23 Finished on | Feb 11 03:30:18 Mapping speed, Million of reads per hour | 11.64 Number of input reads | 15497339 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14431361 Uniquely mapped reads % | 93.12% Average mapped length | 291.45 Number of splices: Total | 13324177 Number of splices: Annotated (sjdb) | 13034294 Number of splices: GT/AG | 13054602 Number of splices: GC/AG | 225046 Number of splices: AT/AC | 7763 Number of splices: Non-canonical | 36766 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 408261 % of reads mapped to multiple loci | 2.63% Number of reads mapped to too many loci | 53701 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.80% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 684027 684027 684027 N_multimapping 408261 408261 408261 N_noFeature 520217 14141159 626747 N_ambiguous 279940 1351 95303 UnstrandedReadsAssigned:13631204 PositiveStrandReadsAssigned:288851 NegativeStrandReadsAssigned:13709311 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7230782 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230782-trimmed-pair1.fastq SRR7230782-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,497,339 reads, 13,692,083 reads pseudoaligned [quant] estimated average fragment length: 238.99 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52401 SRR7230782.ke.tsv 34699 SRR7230782.se.tsv 87100 total ==> SRR7230782.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.01 390 14.2481 Potri.005G024800.1.v4.1 1035 797.01 94 7.66974 Potri.004G059700.1.v4.1 961 723.045 18 1.61891 Potri.007G009000.2.v4.1 1416 1178.01 0 0 Potri.003G141000.2.v4.1 2943 2705.01 911.452 21.912 Potri.016G087400.1.v4.1 270 85.4752 677 515.068 Potri.015G069301.1.v4.1 564 331.981 0 0 Potri.010G195200.1.v4.1 1773 1535.01 20 0.847296 Potri.012G127500.1.v4.1 977 739.03 110 9.67936 ==> SRR7230782.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1288 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 277 Potri.001G212900.v4.1 25 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 7 SRR7230782 completed mapping pipeline successfully