Starting /dee2/code/volunteer_pipeline.sh SRR7230783 current disk space = 3056985518080 free memory = 1499525068 SRR7230783 SRAfilesize 34cc794ae00f8783fdbb01a775744d76 SRR7230783.sra SRR7230783.sra file validated SRR7230783 is paired end SRR7230783 is conventional basespace SRR7230783 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230783_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4685 34.0 33.0 34.0 31.0 34.0 2 32.852 34.0 33.0 34.0 31.0 34.0 3 32.921 34.0 33.0 34.0 32.0 34.0 4 33.04575 34.0 33.0 34.0 32.0 34.0 5 33.12 34.0 33.0 34.0 32.0 34.0 6 36.748 38.0 37.0 38.0 35.0 38.0 7 37.15725 38.0 38.0 38.0 36.0 38.0 8 37.24025 38.0 38.0 38.0 37.0 38.0 9 37.30525 38.0 38.0 38.0 37.0 38.0 10-14 37.364000000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.24225 38.0 38.0 38.0 36.8 38.0 20-24 37.07934999999999 38.0 38.0 38.0 36.4 38.0 25-29 37.0118 38.0 38.0 38.0 36.0 38.0 30-34 36.97545 38.0 38.0 38.0 36.0 38.0 35-39 37.02604999999999 38.0 38.0 38.0 36.0 38.0 40-44 36.992399999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.962199999999996 38.0 38.0 38.0 35.8 38.0 50-54 36.88405 38.0 38.0 38.0 35.4 38.0 55-59 36.76595 38.0 38.0 38.0 35.0 38.0 60-64 36.6764 38.0 38.0 38.0 34.6 38.0 65-69 36.694100000000006 38.0 38.0 38.0 34.6 38.0 70-74 36.186350000000004 38.0 37.4 38.0 32.8 38.0 75-79 36.3211 38.0 37.8 38.0 33.6 38.0 80-84 36.45515 38.0 38.0 38.0 34.0 38.0 85-89 36.25245 38.0 37.8 38.0 33.6 38.0 90-94 36.0755 38.0 37.0 38.0 32.6 38.0 95-99 35.583600000000004 38.0 36.4 38.0 30.0 38.0 100-104 35.310500000000005 38.0 36.4 38.0 28.4 38.0 105-109 34.740550000000006 38.0 35.4 38.0 25.2 38.0 110-114 35.30905 38.0 36.0 38.0 28.8 38.0 115-119 34.9978 38.0 35.2 38.0 27.8 38.0 120-124 34.974199999999996 38.0 35.4 38.0 27.8 38.0 125-129 34.29965 38.0 34.8 38.0 24.0 38.0 130-134 33.946450000000006 38.0 34.6 38.0 22.2 38.0 135-139 33.2031 38.0 33.6 38.0 16.2 38.0 140-144 32.555949999999996 37.8 32.2 38.0 14.2 38.0 145-149 30.85775 36.6 31.0 38.0 8.6 38.0 150-151 25.871875 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 2.0 9 0.0 10 0.0 11 0.0 12 0.0 13 5.0 14 1.0 15 1.0 16 1.0 17 1.0 18 2.0 19 5.0 20 9.0 21 10.0 22 10.0 23 11.0 24 17.0 25 20.0 26 39.0 27 46.0 28 37.0 29 64.0 30 62.0 31 106.0 32 122.0 33 167.0 34 234.0 35 380.0 36 791.0 37 1855.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.91268794513321 14.21788446320232 9.786336059087313 35.08309153257716 2 21.875 20.25 33.925 23.95 3 18.45 26.224999999999998 25.825 29.5 4 22.5 32.2 23.1 22.2 5 21.025 36.8 23.400000000000002 18.775 6 17.424999999999997 36.375 25.825 20.375 7 14.025000000000002 21.075 44.45 20.45 8 16.475 23.175 31.2 29.15 9 17.8 22.775000000000002 33.35 26.075 10-14 20.185 29.080000000000002 26.91 23.825 15-19 19.64 28.335 28.025 24.0 20-24 19.85 28.26 28.23 23.66 25-29 20.07 28.115000000000002 28.055000000000003 23.76 30-34 19.465 28.449999999999996 28.33 23.755000000000003 35-39 20.23 28.43 27.800000000000004 23.54 40-44 19.97 28.875 27.865000000000002 23.29 45-49 19.855 28.720000000000002 27.68 23.745 50-54 20.275000000000002 28.9 27.445000000000004 23.380000000000003 55-59 20.525 28.494999999999997 27.63 23.35 60-64 20.24 29.310000000000002 27.29 23.16 65-69 20.315 28.189999999999998 28.08 23.415 70-74 20.565 27.97 28.18 23.285 75-79 20.115 28.305000000000003 27.83 23.75 80-84 20.614122824564912 28.640728145629126 27.290458091618326 23.454690938187635 85-89 20.30835460779897 28.70300845972869 27.406517495119388 23.582119437352954 90-94 20.854812071467897 27.816425604324106 27.651268705270006 23.67749361893799 95-99 20.665 28.67 27.525 23.14 100-104 20.49225525088977 28.39240062158504 27.745751666750213 23.369592460774978 105-109 20.644935155976167 28.44624705823444 27.13434479995994 23.774472985829455 110-114 20.580000000000002 28.105000000000004 27.644999999999996 23.669999999999998 115-119 20.57 28.405 27.565 23.46 120-124 20.325 28.970000000000002 26.889999999999997 23.815 125-129 20.794999999999998 28.1 27.765 23.34 130-134 20.44 28.645 27.189999999999998 23.724999999999998 135-139 20.96 28.175 27.505000000000003 23.36 140-144 20.830000000000002 28.51 27.125 23.535 145-149 20.96 28.075 27.045 23.919999999999998 150-151 20.6125 28.025 27.224999999999998 24.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 1.0 20 3.0 21 4.0 22 2.0 23 2.5 24 4.0 25 5.5 26 8.5 27 8.5 28 10.5 29 13.0 30 18.5 31 29.0 32 40.5 33 52.0 34 59.0 35 79.0 36 98.0 37 112.5 38 139.0 39 163.0 40 191.5 41 213.0 42 238.0 43 262.5 44 256.5 45 252.0 46 250.5 47 241.0 48 220.0 49 186.0 50 164.5 51 133.0 52 101.5 53 88.5 54 73.0 55 58.0 56 53.5 57 44.0 58 29.5 59 26.0 60 20.0 61 12.5 62 10.0 63 7.0 64 2.0 65 2.0 66 2.5 67 0.5 68 0.5 69 0.5 70 0.5 71 1.0 72 0.5 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.02 85-89 0.11499999999999999 90-94 0.095 95-99 0.0 100-104 0.255 105-109 0.145 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47076612903226 98.675 2 0.35282258064516125 0.7000000000000001 3 0.10080645161290322 0.3 4 0.05040322580645161 0.2 5 0.025201612903225805 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.1124999999999998 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 2.2375 0.0 0.0 0.0 0.0 118-119 2.45 0.0 0.0 0.0 0.0 120-121 2.775 0.0 0.0 0.0 0.0 122-123 2.9749999999999996 0.0 0.0 0.0 0.0 124-125 3.325 0.0 0.0 0.0 0.0 126-127 3.55 0.0 0.0 0.0 0.0 128-129 3.8125 0.0 0.0 0.0 0.0 130-131 4.1375 0.0 0.0 0.0 0.0 132-133 4.4375 0.0 0.0 0.0 0.0 134-135 4.7125 0.0 0.0 0.0 0.0 136-137 5.0875 0.0 0.0 0.0 0.0 138-139 5.550000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7230783 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230783_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.74175 33.0 33.0 34.0 32.0 34.0 2 32.85825 34.0 33.0 34.0 32.0 34.0 3 32.89675 34.0 33.0 34.0 32.0 34.0 4 32.81425 34.0 33.0 34.0 32.0 34.0 5 32.64825 34.0 33.0 34.0 32.0 34.0 6 36.78425 38.0 38.0 38.0 36.0 38.0 7 36.811 38.0 38.0 38.0 36.0 38.0 8 36.72575 38.0 38.0 38.0 36.0 38.0 9 36.719 38.0 38.0 38.0 36.0 38.0 10-14 36.342650000000006 38.0 37.8 38.0 33.2 38.0 15-19 36.654399999999995 38.0 38.0 38.0 35.8 38.0 20-24 36.623999999999995 38.0 38.0 38.0 35.8 38.0 25-29 36.567600000000006 38.0 38.0 38.0 35.2 38.0 30-34 36.342650000000006 38.0 38.0 38.0 33.8 38.0 35-39 36.591249999999995 38.0 38.0 38.0 35.0 38.0 40-44 36.493100000000005 38.0 38.0 38.0 34.8 38.0 45-49 36.3581 38.0 38.0 38.0 34.4 38.0 50-54 36.45805 38.0 38.0 38.0 34.8 38.0 55-59 36.53145 38.0 38.0 38.0 35.2 38.0 60-64 36.50865 38.0 38.0 38.0 35.0 38.0 65-69 36.41435 38.0 38.0 38.0 34.6 38.0 70-74 36.137 38.0 38.0 38.0 33.6 38.0 75-79 36.17535 38.0 38.0 38.0 34.0 38.0 80-84 36.15125 38.0 38.0 38.0 34.0 38.0 85-89 36.01605 38.0 38.0 38.0 33.4 38.0 90-94 35.70495 38.0 37.6 38.0 31.4 38.0 95-99 35.76715 38.0 37.8 38.0 32.2 38.0 100-104 35.7053 38.0 37.8 38.0 31.8 38.0 105-109 35.383950000000006 38.0 36.8 38.0 30.2 38.0 110-114 35.106899999999996 38.0 36.6 38.0 28.0 38.0 115-119 35.061400000000006 38.0 36.6 38.0 28.0 38.0 120-124 34.9747 38.0 36.4 38.0 28.0 38.0 125-129 34.2087 38.0 35.4 38.0 23.6 38.0 130-134 33.20845 38.0 34.0 38.0 18.6 38.0 135-139 32.747249999999994 38.0 33.2 38.0 15.8 38.0 140-144 32.39565 38.0 32.4 38.0 13.6 38.0 145-149 31.6179 38.0 31.8 38.0 8.6 38.0 150-151 27.607375 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 3.0 4 5.0 5 2.0 6 3.0 7 3.0 8 1.0 9 1.0 10 8.0 11 0.0 12 7.0 13 5.0 14 9.0 15 3.0 16 6.0 17 9.0 18 11.0 19 8.0 20 11.0 21 15.0 22 17.0 23 16.0 24 30.0 25 30.0 26 33.0 27 44.0 28 38.0 29 49.0 30 43.0 31 60.0 32 92.0 33 94.0 34 171.0 35 292.0 36 640.0 37 2232.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.225 20.225 13.350000000000001 25.2 2 25.15 26.224999999999998 32.1 16.525000000000002 3 21.0 26.200000000000003 32.4 20.4 4 23.775 35.575 21.975 18.675 5 22.85 37.3 21.95 17.9 6 19.45 37.35 24.075 19.125 7 19.025 17.7 42.05 21.224999999999998 8 19.950000000000003 24.9 27.900000000000002 27.250000000000004 9 22.025 24.775 27.925 25.275 10-14 23.135 29.020000000000003 26.205000000000002 21.64 15-19 22.45 27.994999999999997 28.360000000000003 21.195 20-24 22.53 27.955000000000002 28.470000000000002 21.044999999999998 25-29 22.78 28.83 27.939999999999998 20.45 30-34 22.61 28.144999999999996 28.475 20.77 35-39 22.97 28.01 28.23 20.79 40-44 23.244999999999997 27.589999999999996 28.025 21.14 45-49 22.835 27.71 28.349999999999998 21.105 50-54 23.244999999999997 27.515 28.050000000000004 21.19 55-59 23.080000000000002 28.585 27.505000000000003 20.830000000000002 60-64 22.939999999999998 27.91 27.765 21.385 65-69 23.035 27.605 27.74 21.62 70-74 23.255 28.035 27.400000000000002 21.310000000000002 75-79 23.235 27.525 27.839999999999996 21.4 80-84 23.165 27.82 27.98 21.035 85-89 23.455000000000002 27.810000000000002 27.560000000000002 21.175 90-94 22.865 27.615000000000002 28.585 20.935000000000002 95-99 23.275000000000002 27.785 27.665 21.275 100-104 23.53 27.560000000000002 28.1 20.810000000000002 105-109 23.169999999999998 28.49 28.12 20.22 110-114 23.474999999999998 27.16 28.575 20.79 115-119 23.705000000000002 27.529999999999998 27.744999999999997 21.02 120-124 23.785 27.779999999999998 27.650000000000002 20.785 125-129 24.115000000000002 27.675 27.72 20.49 130-134 24.485 27.58 27.37 20.565 135-139 23.715 27.465 28.21 20.61 140-144 24.195 28.24 26.995 20.57 145-149 24.545 28.249999999999996 27.41 19.794999999999998 150-151 25.412499999999998 27.8625 26.687499999999996 20.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 0.5 23 0.5 24 3.0 25 6.5 26 7.5 27 9.0 28 9.5 29 14.5 30 24.5 31 28.5 32 35.0 33 41.5 34 54.5 35 72.5 36 80.5 37 106.0 38 133.0 39 157.5 40 199.5 41 217.0 42 243.5 43 269.5 44 259.5 45 247.0 46 247.0 47 237.0 48 219.5 49 200.0 50 170.5 51 132.5 52 108.0 53 100.5 54 81.0 55 68.5 56 53.0 57 39.0 58 29.5 59 25.0 60 20.5 61 11.5 62 10.5 63 7.0 64 5.0 65 4.0 66 1.0 67 1.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31904161412358 98.45 2 0.605296343001261 1.2 3 0.025220680958385876 0.075 4 0.025220680958385876 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025220680958385876 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5249999999999999 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.8375 0.0 0.0 0.0 0.0 108-109 0.9875 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.325 0.0 0.0 0.0 0.0 120-121 2.625 0.0 0.0 0.0 0.0 122-123 2.8625 0.0 0.0 0.0 0.0 124-125 3.2249999999999996 0.0 0.0 0.0 0.0 126-127 3.4625 0.0 0.0 0.0 0.0 128-129 3.7 0.0 0.0 0.0 0.0 130-131 4.0125 0.0 0.0 0.0 0.0 132-133 4.35 0.0 0.0 0.0 0.0 134-135 4.6125 0.0 0.0 0.0 0.0 136-137 4.9875 0.0 0.0 0.0 0.0 138-139 5.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1112858 spots for SRR7230783.sra Written 1112858 spots for SRR7230783.sra Read 1112858 spots for SRR7230783.sra Written 1112858 spots for SRR7230783.sra Read 1112858 spots for SRR7230783.sra Written 1112858 spots for SRR7230783.sra Read 1112858 spots for SRR7230783.sra Written 1112858 spots for SRR7230783.sra Read 1112858 spots for SRR7230783.sra Written 1112858 spots for SRR7230783.sra Read 1112858 spots for SRR7230783.sra Written 1112858 spots for SRR7230783.sra Read 1112858 spots for SRR7230783.sra Written 1112858 spots for SRR7230783.sra Read 1112858 spots for SRR7230783.sra Written 1112858 spots for SRR7230783.sra Read 1112858 spots for SRR7230783.sra Written 1112858 spots for SRR7230783.sra Read 1112858 spots for SRR7230783.sra Written 1112858 spots for SRR7230783.sra Read 1112858 spots for SRR7230783.sra Written 1112858 spots for SRR7230783.sra Read 1112858 spots for SRR7230783.sra Written 1112858 spots for SRR7230783.sra Read 1112858 spots for SRR7230783.sra Written 1112858 spots for SRR7230783.sra Read 1112858 spots for SRR7230783.sra Written 1112858 spots for SRR7230783.sra Read 1112867 spots for SRR7230783.sra Written 1112867 spots for SRR7230783.sra Read 1112858 spots for SRR7230783.sra Written 1112858 spots for SRR7230783.sra Read 1112858 spots for SRR7230783.sra Written 1112858 spots for SRR7230783.sra Read 1112858 spots for SRR7230783.sra Written 1112858 spots for SRR7230783.sra Read 1112858 spots for SRR7230783.sra Written 1112858 spots for SRR7230783.sra Read 1112858 spots for SRR7230783.sra Written 1112858 spots for SRR7230783.sra SRR ids: ['SRR7230783.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5s_wm4ie SRR7230783.sra spots: 22257169 blocks: [[1, 1112858], [1112859, 2225716], [2225717, 3338574], [3338575, 4451432], [4451433, 5564290], [5564291, 6677148], [6677149, 7790006], [7790007, 8902864], [8902865, 10015722], [10015723, 11128580], [11128581, 12241438], [12241439, 13354296], [13354297, 14467154], [14467155, 15580012], [15580013, 16692870], [16692871, 17805728], [17805729, 18918586], [18918587, 20031444], [20031445, 21144302], [21144303, 22257169]] SRR7230783 file size 7520523 SRR7230783 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230783 SRR7230783_1.fastq SRR7230783_2.fastq Input file: SRR7230783_1.fastq Paired file: SRR7230783_2.fastq trimmed: SRR7230783-trimmed-pair1.fastq, SRR7230783-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 01:31:12 2025 >> started Tue Feb 11 01:39:29 2025 >> done (496.608s) 22257169 read pairs processed; of these: 29393 ( 0.13%) short read pairs filtered out after trimming by size control 18897 ( 0.08%) empty read pairs filtered out after trimming by size control 22208879 (99.78%) read pairs available; of these: 12320828 (55.48%) trimmed read pairs available after processing 9888051 (44.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 8 0.00% 21 3 0.00% 22 5 0.00% 23 7 0.00% 24 10 0.00% 25 1 0.00% 26 12 0.00% 27 11 0.00% 28 14 0.00% 29 17 0.00% 30 10 0.00% 31 11 0.00% 32 11 0.00% 33 14 0.00% 34 15 0.00% 35 18 0.00% 36 23 0.00% 37 20 0.00% 38 18 0.00% 39 29 0.00% 40 21 0.00% 41 20 0.00% 42 30 0.00% 43 35 0.00% 44 50 0.00% 45 36 0.00% 46 51 0.00% 47 68 0.00% 48 68 0.00% 49 92 0.00% 50 107 0.00% 51 101 0.00% 52 121 0.00% 53 138 0.00% 54 140 0.00% 55 150 0.00% 56 150 0.00% 57 210 0.00% 58 217 0.00% 59 242 0.00% 60 280 0.00% 61 336 0.00% 62 355 0.00% 63 474 0.00% 64 444 0.00% 65 508 0.00% 66 559 0.00% 67 666 0.00% 68 808 0.00% 69 1131 0.01% 70 1375 0.01% 71 1182 0.01% 72 1220 0.01% 73 1368 0.01% 74 1519 0.01% 75 1706 0.01% 76 1820 0.01% 77 2060 0.01% 78 2359 0.01% 79 2710 0.01% 80 2972 0.01% 81 3349 0.02% 82 3719 0.02% 83 4325 0.02% 84 5733 0.03% 85 6951 0.03% 86 7195 0.03% 87 7852 0.04% 88 8418 0.04% 89 8641 0.04% 90 9421 0.04% 91 10304 0.05% 92 10783 0.05% 93 11814 0.05% 94 12412 0.06% 95 13487 0.06% 96 14217 0.06% 97 14908 0.07% 98 15534 0.07% 99 16441 0.07% 100 17940 0.08% 101 18674 0.08% 102 20131 0.09% 103 21289 0.10% 104 22374 0.10% 105 23862 0.11% 106 25128 0.11% 107 26355 0.12% 108 27773 0.13% 109 29105 0.13% 110 30974 0.14% 111 32633 0.15% 112 35048 0.16% 113 36119 0.16% 114 37956 0.17% 115 39738 0.18% 116 41240 0.19% 117 42963 0.19% 118 45030 0.20% 119 46824 0.21% 120 48951 0.22% 121 51622 0.23% 122 53548 0.24% 123 56942 0.26% 124 59957 0.27% 125 62941 0.28% 126 65812 0.30% 127 68063 0.31% 128 71867 0.32% 129 75582 0.34% 130 80008 0.36% 131 83708 0.38% 132 88501 0.40% 133 94001 0.42% 134 99229 0.45% 135 107012 0.48% 136 113029 0.51% 137 120424 0.54% 138 130030 0.59% 139 140558 0.63% 140 152636 0.69% 141 167690 0.76% 142 187468 0.84% 143 213415 0.96% 144 249401 1.12% 145 295256 1.33% 146 370574 1.67% 147 498429 2.24% 148 738729 3.33% 149 1399459 6.30% 150 5541163 24.95% 151 9888051 44.52% 22208879 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=21 prefix-density=0.41 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=375.11 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=17.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=15 prefix-density=0.65 prefix-fanout=2.3 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=41.99 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.2 sequence=GAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATAAACCAGTGTACGGTTGCGGAAGGGGTAATCGATATTGCGTACCTAAAACACCAAGAGGTTGCCCAA SRR7230783 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 03:10:31 Started mapping on | Feb 11 03:10:43 Finished on | Feb 11 05:37:36 Mapping speed, Million of reads per hour | 9.07 Number of input reads | 22208879 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 19244032 Uniquely mapped reads % | 86.65% Average mapped length | 288.74 Number of splices: Total | 18316607 Number of splices: Annotated (sjdb) | 17878867 Number of splices: GT/AG | 17957748 Number of splices: GC/AG | 289270 Number of splices: AT/AC | 11523 Number of splices: Non-canonical | 58066 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 531849 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 301029 % of reads mapped to too many loci | 1.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.33% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2461433 2461433 2461433 N_multimapping 531849 531849 531849 N_noFeature 866398 18900982 993074 N_ambiguous 412127 2502 193966 UnstrandedReadsAssigned:17965507 PositiveStrandReadsAssigned:340548 NegativeStrandReadsAssigned:18056992 Dataset is classified negative stranded MeadianReadLen=147 20thPercentileLength=145 echo kmer=141 SRR7230783 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230783-trimmed-pair1.fastq SRR7230783-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,208,879 reads, 19,413,827 reads pseudoaligned [quant] estimated average fragment length: 248.145 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,020 rounds 52401 SRR7230783.ke.tsv 34699 SRR7230783.se.tsv 87100 total ==> SRR7230783.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.85 737 19.5084 Potri.005G024800.1.v4.1 1035 787.855 238 14.1602 Potri.004G059700.1.v4.1 961 713.96 6 0.393927 Potri.007G009000.2.v4.1 1416 1168.85 0 0 Potri.003G141000.2.v4.1 2943 2695.85 1282 22.291 Potri.016G087400.1.v4.1 270 83.2547 709 399.186 Potri.015G069301.1.v4.1 564 325.437 0 0 Potri.010G195200.1.v4.1 1773 1525.85 90 2.76482 Potri.012G127500.1.v4.1 977 729.908 333 21.3852 ==> SRR7230783.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1075 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 382 Potri.001G212900.v4.1 24 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 1 SRR7230783 completed mapping pipeline successfully