Starting /dee2/code/volunteer_pipeline.sh SRR7230784 current disk space = 3056979849216 free memory = 1519502364 SRR7230784 SRAfilesize e5e433cce33c9e00c3f6843e85f05e5c SRR7230784.sra SRR7230784.sra file validated SRR7230784 is paired end SRR7230784 is conventional basespace SRR7230784 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230784_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.34075 34.0 33.0 34.0 33.0 34.0 2 33.32975 34.0 33.0 34.0 33.0 34.0 3 33.384 34.0 33.0 34.0 33.0 34.0 4 33.35475 34.0 33.0 34.0 33.0 34.0 5 33.378 34.0 33.0 34.0 33.0 34.0 6 37.20175 38.0 37.0 38.0 36.0 38.0 7 37.3955 38.0 38.0 38.0 37.0 38.0 8 37.5275 38.0 38.0 38.0 38.0 38.0 9 37.4285 38.0 38.0 38.0 37.0 38.0 10-14 37.480999999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.373450000000005 38.0 38.0 38.0 37.2 38.0 20-24 37.2369 38.0 38.0 38.0 36.8 38.0 25-29 37.3352 38.0 38.0 38.0 37.0 38.0 30-34 37.4189 38.0 38.0 38.0 37.2 38.0 35-39 37.25205 38.0 38.0 38.0 36.8 38.0 40-44 36.68254999999999 38.0 38.0 38.0 34.8 38.0 45-49 37.0715 38.0 38.0 38.0 36.0 38.0 50-54 37.232000000000006 38.0 38.0 38.0 36.8 38.0 55-59 37.098699999999994 38.0 38.0 38.0 36.0 38.0 60-64 37.099900000000005 38.0 38.0 38.0 36.0 38.0 65-69 37.07965 38.0 38.0 38.0 36.0 38.0 70-74 30.2805 38.0 21.0 38.0 15.0 38.0 75-79 31.425699999999996 38.0 32.0 38.0 2.0 38.0 80-84 34.331900000000005 38.0 36.6 38.0 25.2 38.0 85-89 35.98345 38.0 37.8 38.0 31.8 38.0 90-94 36.19045 38.0 37.8 38.0 33.2 38.0 95-99 36.1868 38.0 38.0 38.0 33.4 38.0 100-104 36.262100000000004 38.0 37.8 38.0 33.8 38.0 105-109 36.2133 38.0 37.8 38.0 33.6 38.0 110-114 34.65145 38.0 34.6 38.0 25.2 38.0 115-119 34.1404 37.6 33.2 38.0 25.0 38.0 120-124 34.8075 38.0 35.4 38.0 27.0 38.0 125-129 33.79935 38.0 34.2 38.0 21.2 38.0 130-134 34.182 38.0 34.6 38.0 24.0 38.0 135-139 33.399350000000005 37.8 33.6 38.0 21.0 38.0 140-144 33.823299999999996 38.0 34.2 38.0 22.6 38.0 145-149 33.080200000000005 38.0 33.6 38.0 18.2 38.0 150-151 28.884124999999997 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 1.0 13 3.0 14 1.0 15 2.0 16 2.0 17 4.0 18 2.0 19 4.0 20 8.0 21 12.0 22 12.0 23 14.0 24 12.0 25 22.0 26 23.0 27 29.0 28 41.0 29 52.0 30 59.0 31 99.0 32 139.0 33 216.0 34 345.0 35 476.0 36 870.0 37 1550.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.225 14.899999999999999 10.125 40.75 2 19.900000000000002 19.7 38.2 22.2 3 19.25 25.5 26.650000000000002 28.599999999999998 4 23.175 33.0 21.975 21.85 5 21.875 34.975 24.95 18.2 6 15.9 36.175000000000004 27.55 20.375 7 13.05 22.05 44.4 20.5 8 17.424999999999997 22.35 31.5 28.725 9 16.55 22.6 33.575 27.275 10-14 19.625981299064954 29.906495324766237 26.651332566628334 23.816190809540476 15-19 20.18 28.335 27.655 23.830000000000002 20-24 19.97 28.625 27.825 23.580000000000002 25-29 19.67688691041865 28.304906717351074 28.369929475316365 23.64827689691392 30-34 20.055 28.389999999999997 27.79 23.765 35-39 20.00700070007001 29.017901790179017 27.137713771377136 23.837383738373838 40-44 20.10007505629222 28.41130848136102 27.860895671753816 23.627720790592946 45-49 20.13 28.23 27.73 23.91 50-54 20.275000000000002 27.985 27.725 24.015 55-59 20.269121104497025 28.617878045120303 27.382322044920215 23.730678805462457 60-64 20.422147751713098 28.38993647776722 26.9994498074326 24.18846596308708 65-69 20.137013701370137 28.08780878087809 27.37273727372737 24.402440244024405 70-74 20.67837674136887 28.394912174439735 26.359781950333133 24.566929133858267 75-79 20.1438021282715 28.547598504457866 27.31090020132298 23.997699165947655 80-84 19.862833025586916 28.298601951991557 27.89765233447639 23.940912687945133 85-89 20.510106356167146 28.267553808155654 27.14350521699683 24.07883461868038 90-94 20.588235294117645 28.406362545018006 27.315926370548222 23.689475790316123 95-99 19.96 27.834999999999997 28.43 23.775 100-104 20.69431244059827 28.097643939772897 27.457355810114553 23.750687809514282 105-109 20.025000000000002 28.549999999999997 27.37 24.055 110-114 20.985 28.465 27.62 22.93 115-119 20.762076207620762 27.92279227922792 27.28772877287729 24.027402740274027 120-124 21.148838141025642 28.200120192307693 26.65264423076923 23.998397435897438 125-129 20.815 27.975 27.37 23.84 130-134 21.365000000000002 28.26 27.36 23.015 135-139 21.415 28.26 26.939999999999998 23.385 140-144 21.465 28.299999999999997 26.534999999999997 23.7 145-149 21.317131713171317 28.132813281328133 26.98769876987699 23.562356235623565 150-151 20.625 28.625 26.937499999999996 23.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 2.5 20 2.5 21 0.5 22 2.0 23 4.0 24 4.5 25 4.0 26 5.0 27 11.0 28 15.5 29 14.5 30 26.5 31 37.0 32 41.0 33 54.5 34 69.0 35 83.0 36 92.0 37 127.5 38 154.0 39 178.5 40 219.5 41 224.0 42 236.0 43 260.0 44 276.0 45 270.0 46 245.5 47 218.5 48 211.0 49 190.5 50 145.0 51 121.0 52 99.5 53 83.5 54 71.5 55 56.0 56 45.0 57 35.0 58 18.0 59 9.5 60 12.0 61 7.5 62 3.5 63 4.0 64 2.5 65 1.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.5 71 0.5 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.034999999999999996 30-34 0.0 35-39 0.01 40-44 0.075 45-49 0.0 50-54 0.0 55-59 0.045 60-64 0.034999999999999996 65-69 0.01 70-74 17.45 75-79 13.075000000000001 80-84 5.225 85-89 0.8049999999999999 90-94 0.04 95-99 0.0 100-104 0.045 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.16 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.42767295597484273 0.8500000000000001 3 0.10062893081761005 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.775 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 0.9875 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.3 0.0 0.0 0.0 0.0 116-117 1.5125000000000002 0.0 0.0 0.0 0.0 118-119 1.725 0.0 0.0 0.0 0.0 120-121 1.975 0.0 0.0 0.0 0.0 122-123 2.2125 0.0 0.0 0.0 0.0 124-125 2.6 0.0 0.0 0.0 0.0 126-127 2.9625000000000004 0.0 0.0 0.0 0.0 128-129 3.3 0.0 0.0 0.0 0.0 130-131 3.5125 0.0 0.0 0.0 0.0 132-133 3.9625000000000004 0.0 0.0 0.0 0.0 134-135 4.3625 0.0 0.0 0.0 0.0 136-137 4.9625 0.0 0.0 0.0 0.0 138-139 5.574999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACATTC 10 0.0074960496 140.5625 2 ACATTCG 10 0.0074960496 140.5625 3 TACTTTG 10 0.0074960496 140.5625 9 AAAAAAA 20 0.0069082794 28.1125 130-134 >>END_MODULE SRR7230784 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230784_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.883 33.0 33.0 34.0 32.0 34.0 2 33.11125 34.0 33.0 34.0 32.0 34.0 3 33.09475 34.0 33.0 34.0 32.0 34.0 4 33.046 34.0 33.0 34.0 32.0 34.0 5 33.0335 34.0 33.0 34.0 33.0 34.0 6 37.0395 38.0 38.0 38.0 36.0 38.0 7 37.08475 38.0 38.0 38.0 37.0 38.0 8 36.94975 38.0 38.0 38.0 37.0 38.0 9 36.91175 38.0 38.0 38.0 36.0 38.0 10-14 37.0025 38.0 38.0 38.0 36.6 38.0 15-19 37.09125 38.0 38.0 38.0 37.0 38.0 20-24 37.017700000000005 38.0 38.0 38.0 36.8 38.0 25-29 37.017399999999995 38.0 38.0 38.0 36.8 38.0 30-34 36.928900000000006 38.0 38.0 38.0 36.6 38.0 35-39 36.5635 38.0 38.0 38.0 35.0 38.0 40-44 36.34355000000001 38.0 38.0 38.0 33.6 38.0 45-49 36.8771 38.0 38.0 38.0 36.0 38.0 50-54 36.85145 38.0 38.0 38.0 36.0 38.0 55-59 36.2293 38.0 38.0 38.0 33.6 38.0 60-64 36.66625 38.0 38.0 38.0 35.2 38.0 65-69 36.33025 38.0 38.0 38.0 34.6 38.0 70-74 36.224500000000006 38.0 38.0 38.0 34.0 38.0 75-79 36.4861 38.0 38.0 38.0 34.6 38.0 80-84 36.488299999999995 38.0 38.0 38.0 34.8 38.0 85-89 36.428250000000006 38.0 38.0 38.0 34.4 38.0 90-94 36.33365 38.0 38.0 38.0 34.0 38.0 95-99 35.7134 38.0 37.2 38.0 31.0 38.0 100-104 35.684999999999995 38.0 37.6 38.0 31.4 38.0 105-109 35.104049999999994 38.0 36.4 38.0 26.2 38.0 110-114 35.4754 38.0 37.0 38.0 30.6 38.0 115-119 35.49915 38.0 37.0 38.0 31.2 38.0 120-124 35.2284 38.0 36.8 38.0 29.4 38.0 125-129 34.92115 38.0 36.0 38.0 27.4 38.0 130-134 34.77745 38.0 36.0 38.0 27.6 38.0 135-139 34.4687 38.0 35.8 38.0 25.6 38.0 140-144 33.940799999999996 38.0 34.8 38.0 23.6 38.0 145-149 32.94585000000001 38.0 33.0 38.0 12.8 38.0 150-151 26.911749999999998 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 2.0 5 4.0 6 3.0 7 0.0 8 0.0 9 1.0 10 3.0 11 3.0 12 2.0 13 3.0 14 7.0 15 3.0 16 2.0 17 8.0 18 3.0 19 12.0 20 8.0 21 17.0 22 16.0 23 18.0 24 22.0 25 16.0 26 26.0 27 31.0 28 40.0 29 43.0 30 47.0 31 53.0 32 88.0 33 101.0 34 158.0 35 237.0 36 567.0 37 2450.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.725 19.325 13.900000000000002 32.05 2 23.625 25.874999999999996 34.875 15.625 3 20.474999999999998 26.924999999999997 30.95 21.65 4 22.625 35.449999999999996 21.95 19.975 5 23.625 38.324999999999996 21.375 16.675 6 18.2 38.45 23.95 19.400000000000002 7 18.4 17.424999999999997 43.325 20.849999999999998 8 22.25 23.974999999999998 27.925 25.85 9 20.549999999999997 24.474999999999998 30.275000000000002 24.7 10-14 22.884999999999998 28.675 26.529999999999998 21.91 15-19 22.935 27.615000000000002 27.845 21.605 20-24 23.36 28.065 27.834999999999997 20.74 25-29 22.585 28.249999999999996 28.235 20.93 30-34 22.745 28.335 27.21 21.709999999999997 35-39 22.849569913982798 27.900580116023203 27.950590118023605 21.299259851970394 40-44 23.447344734473447 28.317831783178317 27.262726272627262 20.97209720972097 45-49 22.487248724872487 27.772777277727773 28.402840284028404 21.337133713371337 50-54 23.14 28.03 27.665 21.165 55-59 22.61928729615462 27.657539762432055 27.979665794242 21.743507147171332 60-64 23.106155307765388 27.631381569078457 27.91139556977849 21.35106755337767 65-69 23.728471134905803 27.511490479317136 27.738774685590183 21.02126370018688 70-74 23.264256542126756 28.008874098724345 27.328190389754447 21.398678969394442 75-79 23.895 27.605 27.46 21.04 80-84 23.435858964741186 28.00700175043761 26.9567391847962 21.600400100025006 85-89 23.115 27.575 27.975 21.335 90-94 23.285 27.425 27.76 21.529999999999998 95-99 23.94 27.255000000000003 27.800000000000004 21.005 100-104 23.635 27.744999999999997 27.42 21.2 105-109 23.544999999999998 28.110000000000003 27.58 20.765 110-114 24.224999999999998 27.96 26.919999999999998 20.895 115-119 23.794999999999998 28.17 27.47 20.565 120-124 24.075 27.779999999999998 27.42 20.724999999999998 125-129 24.495 28.205000000000002 27.284999999999997 20.015 130-134 24.81 27.42 27.255000000000003 20.515 135-139 24.291214560728037 27.85639281964098 27.36136806840342 20.49102455122756 140-144 25.155031006201238 27.970594118823765 26.810362072414485 20.064012802560512 145-149 25.195 28.110000000000003 26.314999999999998 20.380000000000003 150-151 24.9125 27.8125 27.224999999999998 20.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.0 24 2.0 25 3.5 26 5.5 27 8.0 28 9.0 29 12.0 30 17.5 31 21.5 32 26.5 33 35.0 34 50.0 35 58.0 36 71.0 37 94.0 38 126.5 39 166.0 40 194.5 41 210.0 42 229.5 43 253.5 44 278.0 45 273.5 46 269.5 47 270.0 48 227.0 49 198.5 50 181.5 51 146.0 52 115.5 53 97.0 54 85.5 55 76.5 56 57.5 57 38.5 58 24.5 59 18.0 60 14.0 61 8.0 62 5.5 63 3.5 64 3.0 65 2.0 66 2.0 67 3.0 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.02 40-44 0.01 45-49 0.01 50-54 0.0 55-59 0.66 60-64 0.005 65-69 1.005 70-74 0.835 75-79 0.0 80-84 0.025 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.02 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1154915339904 98.05 2 0.7581501137225171 1.5 3 0.10108668182966893 0.3 4 0.0 0.0 5 0.0 0.0 6 0.025271670457417232 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.8999999999999999 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.425 0.0 0.0 0.0 0.0 116-117 1.6375000000000002 0.0 0.0 0.0 0.0 118-119 1.8875 0.0 0.0 0.0 0.0 120-121 2.1375 0.0 0.0 0.0 0.0 122-123 2.3625 0.0 0.0 0.0 0.0 124-125 2.7375 0.0 0.0 0.0 0.0 126-127 3.0875000000000004 0.0 0.0 0.0 0.0 128-129 3.425 0.0 0.0 0.0 0.0 130-131 3.6500000000000004 0.0 0.0 0.0 0.0 132-133 4.1625 0.0 0.0 0.0 0.0 134-135 4.5875 0.0 0.0 0.0 0.0 136-137 5.199999999999999 0.0 0.0 0.0 0.0 138-139 5.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATGGG 10 0.00692859 144.3125 2 >>END_MODULE Read 952131 spots for SRR7230784.sra Written 952131 spots for SRR7230784.sra Read 952131 spots for SRR7230784.sra Written 952131 spots for SRR7230784.sra Read 952131 spots for SRR7230784.sra Written 952131 spots for SRR7230784.sra Read 952131 spots for SRR7230784.sra Written 952131 spots for SRR7230784.sra Read 952131 spots for SRR7230784.sra Written 952131 spots for SRR7230784.sra Read 952131 spots for SRR7230784.sra Written 952131 spots for SRR7230784.sra Read 952131 spots for SRR7230784.sra Written 952131 spots for SRR7230784.sra Read 952146 spots for SRR7230784.sra Written 952146 spots for SRR7230784.sra Read 952131 spots for SRR7230784.sra Written 952131 spots for SRR7230784.sra Read 952131 spots for SRR7230784.sra Written 952131 spots for SRR7230784.sra Read 952131 spots for SRR7230784.sra Written 952131 spots for SRR7230784.sra Read 952131 spots for SRR7230784.sra Written 952131 spots for SRR7230784.sra Read 952131 spots for SRR7230784.sra Written 952131 spots for SRR7230784.sra Read 952131 spots for SRR7230784.sra Written 952131 spots for SRR7230784.sra Read 952131 spots for SRR7230784.sra Written 952131 spots for SRR7230784.sra Read 952131 spots for SRR7230784.sra Written 952131 spots for SRR7230784.sra Read 952131 spots for SRR7230784.sra Written 952131 spots for SRR7230784.sra Read 952131 spots for SRR7230784.sra Written 952131 spots for SRR7230784.sra Read 952131 spots for SRR7230784.sra Written 952131 spots for SRR7230784.sra Read 952131 spots for SRR7230784.sra Written 952131 spots for SRR7230784.sra SRR ids: ['SRR7230784.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jdr1iq1r SRR7230784.sra spots: 19042635 blocks: [[1, 952131], [952132, 1904262], [1904263, 2856393], [2856394, 3808524], [3808525, 4760655], [4760656, 5712786], [5712787, 6664917], [6664918, 7617048], [7617049, 8569179], [8569180, 9521310], [9521311, 10473441], [10473442, 11425572], [11425573, 12377703], [12377704, 13329834], [13329835, 14281965], [14281966, 15234096], [15234097, 16186227], [16186228, 17138358], [17138359, 18090489], [18090490, 19042635]] SRR7230784 file size 6431223 SRR7230784 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230784 SRR7230784_1.fastq SRR7230784_2.fastq Input file: SRR7230784_1.fastq Paired file: SRR7230784_2.fastq trimmed: SRR7230784-trimmed-pair1.fastq, SRR7230784-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 03:35:20 2025 >> started Tue Feb 11 03:40:05 2025 >> done (284.973s) 19042635 read pairs processed; of these: 20751 ( 0.11%) short read pairs filtered out after trimming by size control 23482 ( 0.12%) empty read pairs filtered out after trimming by size control 18998402 (99.77%) read pairs available; of these: 8757450 (46.10%) trimmed read pairs available after processing 10240952 (53.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 4 0.00% 20 3 0.00% 21 2 0.00% 22 4 0.00% 23 10 0.00% 24 7 0.00% 25 2 0.00% 26 6 0.00% 27 6 0.00% 28 5 0.00% 29 9 0.00% 30 9 0.00% 31 10 0.00% 32 9 0.00% 33 12 0.00% 34 11 0.00% 35 15 0.00% 36 17 0.00% 37 12 0.00% 38 22 0.00% 39 25 0.00% 40 23 0.00% 41 28 0.00% 42 23 0.00% 43 32 0.00% 44 32 0.00% 45 36 0.00% 46 51 0.00% 47 46 0.00% 48 50 0.00% 49 72 0.00% 50 72 0.00% 51 72 0.00% 52 86 0.00% 53 94 0.00% 54 91 0.00% 55 135 0.00% 56 131 0.00% 57 138 0.00% 58 215 0.00% 59 176 0.00% 60 218 0.00% 61 274 0.00% 62 254 0.00% 63 295 0.00% 64 357 0.00% 65 406 0.00% 66 415 0.00% 67 502 0.00% 68 628 0.00% 69 959 0.01% 70 920 0.00% 71 844 0.00% 72 869 0.00% 73 1016 0.01% 74 1152 0.01% 75 1346 0.01% 76 1472 0.01% 77 1683 0.01% 78 1960 0.01% 79 2016 0.01% 80 2232 0.01% 81 2603 0.01% 82 3477 0.02% 83 3325 0.02% 84 4556 0.02% 85 5258 0.03% 86 5736 0.03% 87 5957 0.03% 88 6430 0.03% 89 6894 0.04% 90 7502 0.04% 91 7727 0.04% 92 8167 0.04% 93 9062 0.05% 94 9634 0.05% 95 10274 0.05% 96 11044 0.06% 97 11680 0.06% 98 12213 0.06% 99 13342 0.07% 100 13956 0.07% 101 14509 0.08% 102 15391 0.08% 103 16421 0.09% 104 17505 0.09% 105 18467 0.10% 106 19140 0.10% 107 20462 0.11% 108 21658 0.11% 109 23027 0.12% 110 23745 0.12% 111 25310 0.13% 112 26155 0.14% 113 27412 0.14% 114 28402 0.15% 115 30053 0.16% 116 31399 0.17% 117 32738 0.17% 118 34400 0.18% 119 35600 0.19% 120 37321 0.20% 121 39190 0.21% 122 40412 0.21% 123 42425 0.22% 124 44347 0.23% 125 45478 0.24% 126 47518 0.25% 127 50202 0.26% 128 52196 0.27% 129 54293 0.29% 130 57146 0.30% 131 59621 0.31% 132 62874 0.33% 133 66528 0.35% 134 69623 0.37% 135 73523 0.39% 136 76973 0.41% 137 82898 0.44% 138 87412 0.46% 139 92999 0.49% 140 99861 0.53% 141 108370 0.57% 142 119227 0.63% 143 132328 0.70% 144 152129 0.80% 145 178132 0.94% 146 218352 1.15% 147 289226 1.52% 148 427421 2.25% 149 821144 4.32% 150 4386029 23.09% 151 10240952 53.90% 18998402 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=28 prefix-density=0.59 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=93.61 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=13.5 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATT criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.92 fanout-score-rank=9 prefix-density=0.57 prefix-fanout=2.4 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=43.17 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.9 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC SRR7230784 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 04:40:13 Started mapping on | Feb 11 04:40:22 Finished on | Feb 11 07:33:15 Mapping speed, Million of reads per hour | 6.59 Number of input reads | 18998402 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 17881434 Uniquely mapped reads % | 94.12% Average mapped length | 294.30 Number of splices: Total | 16956008 Number of splices: Annotated (sjdb) | 16581794 Number of splices: GT/AG | 16606662 Number of splices: GC/AG | 294434 Number of splices: AT/AC | 10024 Number of splices: Non-canonical | 44888 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 515006 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 110853 % of reads mapped to too many loci | 0.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.46% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 622266 622266 622266 N_multimapping 515006 515006 515006 N_noFeature 721954 17592492 835323 N_ambiguous 306303 1334 129745 UnstrandedReadsAssigned:16853177 PositiveStrandReadsAssigned:287608 NegativeStrandReadsAssigned:16916366 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7230784 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230784-trimmed-pair1.fastq SRR7230784-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,998,402 reads, 17,008,950 reads pseudoaligned [quant] estimated average fragment length: 246.113 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52401 SRR7230784.ke.tsv 34699 SRR7230784.se.tsv 87100 total ==> SRR7230784.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.89 410 12.6031 Potri.005G024800.1.v4.1 1035 789.887 194 13.3847 Potri.004G059700.1.v4.1 961 715.945 11 0.837311 Potri.007G009000.2.v4.1 1416 1170.89 0 0 Potri.003G141000.2.v4.1 2943 2697.89 624.5 12.6148 Potri.016G087400.1.v4.1 270 80.3938 823 557.893 Potri.015G069301.1.v4.1 564 325.602 0 0 Potri.010G195200.1.v4.1 1773 1527.89 10 0.356683 Potri.012G127500.1.v4.1 977 731.924 535 39.8347 ==> SRR7230784.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 341 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 357 Potri.001G212900.v4.1 39 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 24 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7230784 completed mapping pipeline successfully