Starting /dee2/code/volunteer_pipeline.sh SRR7230785 current disk space = 3057062940672 free memory = 1151364424 SRR7230785 SRAfilesize dc009c4c69f0a33f78740271747073a2 SRR7230785.sra SRR7230785.sra file validated SRR7230785 is paired end SRR7230785 is conventional basespace SRR7230785 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230785_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.067 34.0 33.0 34.0 32.0 34.0 2 32.9365 34.0 33.0 34.0 32.0 34.0 3 33.032 34.0 33.0 34.0 32.0 34.0 4 33.064 34.0 33.0 34.0 32.0 34.0 5 33.137 34.0 33.0 34.0 32.0 34.0 6 36.822 38.0 37.0 38.0 35.0 38.0 7 37.18875 38.0 38.0 38.0 36.0 38.0 8 37.2735 38.0 38.0 38.0 37.0 38.0 9 37.3765 38.0 38.0 38.0 37.0 38.0 10-14 37.3992 38.0 38.0 38.0 37.0 38.0 15-19 37.340199999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.2232 38.0 38.0 38.0 36.8 38.0 25-29 37.088 38.0 38.0 38.0 36.2 38.0 30-34 37.11175 38.0 38.0 38.0 36.4 38.0 35-39 37.1259 38.0 38.0 38.0 36.6 38.0 40-44 36.9887 38.0 38.0 38.0 36.0 38.0 45-49 37.026599999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.987 38.0 38.0 38.0 36.0 38.0 55-59 36.78995 38.0 38.0 38.0 35.2 38.0 60-64 36.772349999999996 38.0 38.0 38.0 35.0 38.0 65-69 36.735499999999995 38.0 38.0 38.0 35.0 38.0 70-74 36.14875 38.0 37.6 38.0 32.6 38.0 75-79 36.1348 38.0 38.0 38.0 33.8 38.0 80-84 36.1111 38.0 38.0 38.0 34.0 38.0 85-89 35.92765 38.0 37.8 38.0 33.4 38.0 90-94 35.66455 38.0 37.0 38.0 31.4 38.0 95-99 35.54945 38.0 36.8 38.0 31.0 38.0 100-104 35.1364 38.0 36.8 38.0 29.4 38.0 105-109 34.6182 38.0 35.8 38.0 25.0 38.0 110-114 35.0261 38.0 36.0 38.0 28.2 38.0 115-119 34.7395 38.0 35.6 38.0 27.0 38.0 120-124 34.73605 38.0 35.8 38.0 27.4 38.0 125-129 34.0767 38.0 34.8 38.0 21.8 38.0 130-134 33.63755 38.0 34.4 38.0 20.6 38.0 135-139 32.971900000000005 38.0 33.8 38.0 14.8 38.0 140-144 32.615300000000005 38.0 33.0 38.0 14.0 38.0 145-149 31.360300000000002 37.8 31.2 38.0 8.6 38.0 150-151 26.372125 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 3.0 8 1.0 9 0.0 10 1.0 11 2.0 12 1.0 13 1.0 14 0.0 15 5.0 16 6.0 17 9.0 18 32.0 19 14.0 20 8.0 21 6.0 22 5.0 23 14.0 24 18.0 25 22.0 26 31.0 27 35.0 28 38.0 29 54.0 30 52.0 31 77.0 32 119.0 33 144.0 34 208.0 35 345.0 36 786.0 37 1963.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.144447320735175 12.995081542842351 12.865648459746312 39.99482267667616 2 21.875 20.674999999999997 34.2 23.25 3 19.375 24.625 27.175 28.825 4 21.55 32.5 21.75 24.2 5 23.775 34.35 23.549999999999997 18.325 6 18.025 36.475 25.224999999999998 20.275000000000002 7 14.274999999999999 24.65 42.699999999999996 18.375 8 16.75 27.125 28.475 27.650000000000002 9 18.275 24.775 31.674999999999997 25.275 10-14 19.215 30.775000000000002 25.924999999999997 24.085 15-19 19.945 29.175 27.455000000000002 23.425 20-24 19.665 29.365000000000002 27.134999999999998 23.835 25-29 19.36 28.96 27.339999999999996 24.34 30-34 18.895 29.45 26.545 25.11 35-39 20.169999999999998 29.325000000000003 26.529999999999998 23.974999999999998 40-44 19.585 28.999999999999996 27.639999999999997 23.775 45-49 20.315 28.38 27.02 24.285 50-54 20.150000000000002 29.104999999999997 27.1 23.645 55-59 20.19 28.07 27.37 24.37 60-64 20.595 28.455000000000002 27.310000000000002 23.64 65-69 19.439999999999998 30.220000000000002 26.52 23.82 70-74 19.895 29.65 26.525 23.93 75-79 19.615 29.4 26.865 24.12 80-84 19.88195868553994 28.830090531686093 27.12949532336318 24.158455459410792 85-89 20.164279274767104 28.98427326454974 26.044275267955523 24.807172192727638 90-94 20.660991487230845 28.437656484727093 26.86029043565348 24.041061592388584 95-99 20.674999999999997 28.634999999999998 26.33 24.36 100-104 20.688962538917345 28.387064376820327 26.58933413678819 24.334638947474136 105-109 20.952953554787314 27.847086527381133 26.649631745077407 24.550328172754146 110-114 20.265 28.555000000000003 26.705000000000002 24.474999999999998 115-119 20.885 28.975 25.985000000000003 24.154999999999998 120-124 20.72 28.715000000000003 26.185000000000002 24.38 125-129 21.529999999999998 28.09 25.380000000000003 25.0 130-134 21.495 27.88 26.255 24.37 135-139 21.584999999999997 27.93 25.580000000000002 24.905 140-144 21.48 27.87 25.055 25.595000000000002 145-149 21.495 27.73 25.445 25.330000000000002 150-151 21.3125 29.1625 24.325 25.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 0.5 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 0.5 23 0.5 24 3.5 25 7.0 26 8.5 27 12.0 28 15.0 29 17.0 30 23.5 31 34.5 32 54.5 33 69.0 34 80.5 35 94.0 36 113.0 37 136.0 38 151.5 39 167.5 40 169.0 41 175.5 42 204.0 43 215.0 44 210.5 45 211.5 46 206.5 47 208.0 48 199.5 49 177.0 50 162.0 51 138.0 52 120.5 53 123.0 54 108.5 55 88.0 56 70.5 57 52.5 58 45.5 59 34.5 60 25.0 61 17.5 62 11.0 63 9.0 64 5.5 65 4.0 66 4.5 67 3.0 68 1.5 69 0.0 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4250000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.034999999999999996 85-89 0.16999999999999998 90-94 0.15 95-99 0.0 100-104 0.43 105-109 0.20500000000000002 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.3 #Duplication Level Percentage of deduplicated Percentage of total 1 97.97507788161994 94.35 2 1.5835929387331256 3.05 3 0.3115264797507788 0.8999999999999999 4 0.02596053997923157 0.1 5 0.0778816199376947 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02596053997923157 1.225 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACCGGATCTCGTATGC 49 1.225 TruSeq Adapter, Index 7 (97% over 35bp) GTTTGATTGGCCTTTCACCCCCAGCCACAAGTCATCCGCTAATTTTTCAA 5 0.125 No Hit GTCGGTTCGGTCCTCCAGTTAGTGTTACCCAACCTTCAACCTGCCCATGG 5 0.125 No Hit CGGGAACGTATTCACCGTGGCATTCTGATCCACGATTACTAGCGATTCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 1.1375000000000002 0.0 0.0 0.0 0.0 96-97 1.45 0.0 0.0 0.0 0.0 98-99 1.5625 0.0 0.0 0.0 0.0 100-101 1.7125 0.0 0.0 0.0 0.0 102-103 1.925 0.0 0.0 0.0 0.0 104-105 2.1 0.0 0.0 0.0 0.0 106-107 2.4 0.0 0.0 0.0 0.0 108-109 2.8375 0.0 0.0 0.0 0.0 110-111 3.375 0.0 0.0 0.0 0.0 112-113 3.8 0.0 0.0 0.0 0.0 114-115 4.1 0.0 0.0 0.0 0.0 116-117 4.5875 0.0 0.0 0.0 0.0 118-119 5.225 0.0 0.0 0.0 0.0 120-121 5.875 0.0 0.0 0.0 0.0 122-123 6.4125 0.0 0.0 0.0 0.0 124-125 7.2125 0.0 0.0 0.0 0.0 126-127 7.8625 0.0 0.0 0.0 0.0 128-129 8.7875 0.0 0.0 0.0 0.0 130-131 9.5625 0.0 0.0 0.0 0.0 132-133 10.100000000000001 0.0 0.0 0.0 0.0 134-135 10.7875 0.0 0.0 0.0 0.0 136-137 11.5125 0.0 0.0 0.0 0.0 138-139 12.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTGAG 10 0.0063610086 148.44872 1 GGCCCCG 10 0.006867937 144.7375 7 CCCCGAG 10 0.006867937 144.7375 9 CTCCGCG 10 0.006867937 144.7375 145 >>END_MODULE SRR7230785 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230785_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.865 33.0 33.0 34.0 32.0 34.0 2 32.95325 34.0 33.0 34.0 32.0 34.0 3 33.0015 34.0 33.0 34.0 32.0 34.0 4 32.94675 34.0 33.0 34.0 32.0 34.0 5 32.915 34.0 33.0 34.0 33.0 34.0 6 36.9995 38.0 38.0 38.0 37.0 38.0 7 37.02775 38.0 38.0 38.0 37.0 38.0 8 36.9395 38.0 38.0 38.0 37.0 38.0 9 36.9925 38.0 38.0 38.0 37.0 38.0 10-14 36.64605 38.0 38.0 38.0 35.0 38.0 15-19 36.89095 38.0 38.0 38.0 36.4 38.0 20-24 36.9018 38.0 38.0 38.0 36.6 38.0 25-29 36.81750000000001 38.0 38.0 38.0 36.4 38.0 30-34 36.547700000000006 38.0 38.0 38.0 34.8 38.0 35-39 36.765100000000004 38.0 38.0 38.0 36.0 38.0 40-44 36.59705 38.0 38.0 38.0 35.6 38.0 45-49 36.44905 38.0 38.0 38.0 35.0 38.0 50-54 36.54905 38.0 38.0 38.0 35.2 38.0 55-59 36.649950000000004 38.0 38.0 38.0 35.8 38.0 60-64 36.6466 38.0 38.0 38.0 35.8 38.0 65-69 36.36194999999999 38.0 38.0 38.0 34.6 38.0 70-74 35.7449 38.0 38.0 38.0 32.0 38.0 75-79 35.937850000000005 38.0 38.0 38.0 33.8 38.0 80-84 35.89095 38.0 38.0 38.0 33.8 38.0 85-89 35.77305 38.0 38.0 38.0 33.0 38.0 90-94 35.51435 38.0 37.8 38.0 32.0 38.0 95-99 35.5815 38.0 37.8 38.0 32.6 38.0 100-104 35.4518 38.0 37.8 38.0 31.4 38.0 105-109 35.00915 38.0 36.8 38.0 27.8 38.0 110-114 34.886649999999996 38.0 36.6 38.0 27.4 38.0 115-119 34.795249999999996 38.0 36.0 38.0 27.6 38.0 120-124 34.586 38.0 36.0 38.0 26.2 38.0 125-129 33.94155 38.0 35.0 38.0 22.8 38.0 130-134 33.2042 38.0 34.2 38.0 18.8 38.0 135-139 32.55475 38.0 33.6 38.0 14.0 38.0 140-144 31.99235 38.0 32.2 38.0 13.2 38.0 145-149 30.890500000000003 37.2 30.8 38.0 6.4 38.0 150-151 26.962125 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 7.0 4 2.0 5 3.0 6 5.0 7 3.0 8 2.0 9 5.0 10 4.0 11 2.0 12 2.0 13 5.0 14 8.0 15 8.0 16 15.0 17 34.0 18 8.0 19 4.0 20 10.0 21 17.0 22 10.0 23 12.0 24 17.0 25 21.0 26 17.0 27 33.0 28 27.0 29 39.0 30 68.0 31 70.0 32 100.0 33 125.0 34 158.0 35 320.0 36 647.0 37 2182.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.175000000000004 17.65 17.45 28.725 2 27.700000000000003 23.575 31.874999999999996 16.85 3 22.6 26.674999999999997 30.4 20.325 4 25.35 34.875 22.15 17.625 5 27.55 34.275 20.849999999999998 17.325 6 21.05 35.949999999999996 24.125 18.875 7 18.975 19.1 40.725 21.2 8 22.75 24.3 25.55 27.400000000000002 9 24.825 22.95 28.225 24.0 10-14 24.474999999999998 27.925 25.36 22.24 15-19 25.355 26.72 26.765 21.16 20-24 25.374999999999996 27.57 27.005000000000003 20.05 25-29 24.55 27.465 27.11 20.875 30-34 24.935 27.265 27.395000000000003 20.405 35-39 23.84 28.035 27.005000000000003 21.12 40-44 25.575 26.985 26.985 20.455000000000002 45-49 25.009999999999998 27.045 26.540000000000003 21.404999999999998 50-54 24.455 27.189999999999998 27.744999999999997 20.61 55-59 24.195 27.175 27.700000000000003 20.93 60-64 23.93 27.99 27.37 20.71 65-69 24.05 27.565 27.505000000000003 20.880000000000003 70-74 23.885 28.18 26.979999999999997 20.955 75-79 23.98 27.700000000000003 27.334999999999997 20.985 80-84 24.605 27.565 27.435 20.395 85-89 24.245 27.41 27.93 20.415 90-94 24.884999999999998 27.42 27.275 20.419999999999998 95-99 24.455 27.005000000000003 28.03 20.51 100-104 25.1 27.325 27.515 20.06 105-109 24.72 27.73 27.095000000000002 20.455000000000002 110-114 25.374999999999996 27.365000000000002 27.215 20.044999999999998 115-119 24.955 27.73 27.355 19.96 120-124 25.0 27.805000000000003 27.295 19.900000000000002 125-129 25.924999999999997 27.93 26.66 19.485 130-134 25.785000000000004 27.925 26.66 19.63 135-139 26.39 27.445000000000004 26.985 19.18 140-144 26.025 27.779999999999998 26.69 19.505 145-149 26.845000000000002 28.67 25.474999999999998 19.009999999999998 150-151 28.1125 27.6375 25.825 18.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 1.0 24 2.5 25 4.0 26 2.0 27 2.5 28 3.5 29 7.0 30 12.0 31 15.0 32 24.5 33 34.5 34 46.5 35 55.5 36 75.0 37 100.5 38 117.0 39 133.0 40 151.5 41 199.0 42 233.0 43 238.0 44 245.0 45 236.0 46 238.0 47 236.5 48 223.0 49 206.0 50 173.5 51 151.0 52 136.5 53 126.0 54 128.5 55 118.0 56 82.0 57 55.0 58 45.0 59 37.5 60 27.0 61 21.0 62 17.5 63 12.0 64 5.5 65 1.5 66 2.0 67 2.5 68 2.5 69 1.0 70 2.0 71 2.0 72 0.0 73 0.0 74 0.0 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.34796076406815 95.25 2 1.3680949922560661 2.65 3 0.23231801755291687 0.675 4 0.0 0.0 5 0.0 0.0 6 0.02581311306143521 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02581311306143521 1.275 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 51 1.275 Illumina Single End PCR Primer 1 (100% over 50bp) CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 1.125 0.0 0.0 0.0 0.0 96-97 1.425 0.0 0.0 0.0 0.0 98-99 1.5375 0.0 0.0 0.0 0.0 100-101 1.7000000000000002 0.0 0.0 0.0 0.0 102-103 1.9125 0.0 0.0 0.0 0.0 104-105 2.0625 0.0 0.0 0.0 0.0 106-107 2.3625 0.0 0.0 0.0 0.0 108-109 2.7750000000000004 0.0 0.0 0.0 0.0 110-111 3.3 0.0 0.0 0.0 0.0 112-113 3.75 0.0 0.0 0.0 0.0 114-115 4.1 0.0 0.0 0.0 0.0 116-117 4.6 0.0 0.0 0.0 0.0 118-119 5.2 0.0 0.0 0.0 0.0 120-121 5.875 0.0 0.0 0.0 0.0 122-123 6.4625 0.0 0.0 0.0 0.0 124-125 7.3 0.0 0.0 0.0 0.0 126-127 7.925000000000001 0.0 0.0 0.0 0.0 128-129 8.8375 0.0 0.0 0.0 0.0 130-131 9.65 0.0 0.0 0.0 0.0 132-133 10.2 0.0 0.0 0.0 0.0 134-135 10.8375 0.0 0.0 0.0 0.0 136-137 11.5125 0.0 0.0 0.0 0.0 138-139 12.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACAGCA 10 0.006830828 145.0 5 AAAAAAA 90 1.0830317E-6 16.11111 60-64 >>END_MODULE Read 600049 spots for SRR7230785.sra Written 600049 spots for SRR7230785.sra Read 600049 spots for SRR7230785.sra Written 600049 spots for SRR7230785.sra Read 600049 spots for SRR7230785.sra Written 600049 spots for SRR7230785.sra Read 600049 spots for SRR7230785.sra Written 600049 spots for SRR7230785.sra Read 600049 spots for SRR7230785.sra Written 600049 spots for SRR7230785.sra Read 600049 spots for SRR7230785.sra Written 600049 spots for SRR7230785.sra Read 600049 spots for SRR7230785.sra Written 600049 spots for SRR7230785.sra Read 600049 spots for SRR7230785.sra Written 600049 spots for SRR7230785.sra Read 600049 spots for SRR7230785.sra Written 600049 spots for SRR7230785.sra Read 600049 spots for SRR7230785.sra Written 600049 spots for SRR7230785.sra Read 600049 spots for SRR7230785.sra Written 600049 spots for SRR7230785.sra Read 600049 spots for SRR7230785.sra Written 600049 spots for SRR7230785.sra Read 600049 spots for SRR7230785.sra Written 600049 spots for SRR7230785.sra Read 600049 spots for SRR7230785.sra Written 600049 spots for SRR7230785.sra Read 600049 spots for SRR7230785.sra Written 600049 spots for SRR7230785.sra Read 600049 spots for SRR7230785.sra Written 600049 spots for SRR7230785.sra Read 600049 spots for SRR7230785.sra Written 600049 spots for SRR7230785.sra Read 600049 spots for SRR7230785.sra Written 600049 spots for SRR7230785.sra Read 600063 spots for SRR7230785.sra Written 600063 spots for SRR7230785.sra Read 600049 spots for SRR7230785.sra Written 600049 spots for SRR7230785.sra SRR ids: ['SRR7230785.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cn1cvd3r SRR7230785.sra spots: 12000994 blocks: [[1, 600049], [600050, 1200098], [1200099, 1800147], [1800148, 2400196], [2400197, 3000245], [3000246, 3600294], [3600295, 4200343], [4200344, 4800392], [4800393, 5400441], [5400442, 6000490], [6000491, 6600539], [6600540, 7200588], [7200589, 7800637], [7800638, 8400686], [8400687, 9000735], [9000736, 9600784], [9600785, 10200833], [10200834, 10800882], [10800883, 11400931], [11400932, 12000994]] SRR7230785 file size 4045042 SRR7230785 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230785 SRR7230785_1.fastq SRR7230785_2.fastq Input file: SRR7230785_1.fastq Paired file: SRR7230785_2.fastq trimmed: SRR7230785-trimmed-pair1.fastq, SRR7230785-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 01:19:24 2025 >> started Tue Feb 11 01:19:36 2025 >> done (12.774s) 12000994 read pairs processed; of these: 18602 ( 0.16%) short read pairs filtered out after trimming by size control 138403 ( 1.15%) empty read pairs filtered out after trimming by size control 11843989 (98.69%) read pairs available; of these: 7024903 (59.31%) trimmed read pairs available after processing 4819086 (40.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 1 0.00% 20 6 0.00% 21 8 0.00% 22 9 0.00% 23 8 0.00% 24 10 0.00% 25 12 0.00% 26 23 0.00% 27 22 0.00% 28 19 0.00% 29 20 0.00% 30 20 0.00% 31 22 0.00% 32 28 0.00% 33 24 0.00% 34 24 0.00% 35 21 0.00% 36 39 0.00% 37 34 0.00% 38 27 0.00% 39 43 0.00% 40 55 0.00% 41 47 0.00% 42 53 0.00% 43 54 0.00% 44 77 0.00% 45 65 0.00% 46 79 0.00% 47 104 0.00% 48 105 0.00% 49 112 0.00% 50 135 0.00% 51 167 0.00% 52 169 0.00% 53 196 0.00% 54 174 0.00% 55 207 0.00% 56 204 0.00% 57 260 0.00% 58 253 0.00% 59 350 0.00% 60 373 0.00% 61 416 0.00% 62 408 0.00% 63 528 0.00% 64 539 0.00% 65 703 0.01% 66 722 0.01% 67 845 0.01% 68 1115 0.01% 69 2409 0.02% 70 2753 0.02% 71 1687 0.01% 72 1594 0.01% 73 1675 0.01% 74 1841 0.02% 75 2029 0.02% 76 2166 0.02% 77 2438 0.02% 78 2658 0.02% 79 3087 0.03% 80 3358 0.03% 81 3725 0.03% 82 4465 0.04% 83 5140 0.04% 84 6638 0.06% 85 7335 0.06% 86 8135 0.07% 87 8717 0.07% 88 9582 0.08% 89 9995 0.08% 90 10635 0.09% 91 11557 0.10% 92 12036 0.10% 93 13530 0.11% 94 13885 0.12% 95 14960 0.13% 96 15679 0.13% 97 16456 0.14% 98 17215 0.15% 99 18229 0.15% 100 19366 0.16% 101 19544 0.17% 102 21823 0.18% 103 22709 0.19% 104 24484 0.21% 105 26642 0.22% 106 26820 0.23% 107 27146 0.23% 108 28704 0.24% 109 31013 0.26% 110 31711 0.27% 111 31818 0.27% 112 33698 0.28% 113 36124 0.30% 114 37282 0.31% 115 38699 0.33% 116 40017 0.34% 117 39955 0.34% 118 41637 0.35% 119 43256 0.37% 120 44642 0.38% 121 45517 0.38% 122 47527 0.40% 123 49766 0.42% 124 51528 0.44% 125 52512 0.44% 126 54210 0.46% 127 55772 0.47% 128 57323 0.48% 129 59415 0.50% 130 61891 0.52% 131 63739 0.54% 132 65942 0.56% 133 68205 0.58% 134 72214 0.61% 135 74983 0.63% 136 77960 0.66% 137 82848 0.70% 138 85216 0.72% 139 89947 0.76% 140 95160 0.80% 141 102706 0.87% 142 109309 0.92% 143 121517 1.03% 144 136549 1.15% 145 158044 1.33% 146 191029 1.61% 147 248261 2.10% 148 360424 3.04% 149 671493 5.67% 150 2702257 22.82% 151 4819086 40.69% 11843989 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=28 prefix-density=0.81 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=53.75 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.5 sequence=GATCTTCAAAAAACCAATAAAAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAAC criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=23 prefix-density=0.85 prefix-fanout=2.3 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.05 sequence-density-rank=30 fanout-score=16.19 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=5.0 sequence=AACCTGAAACCGTGTACGTACAAGCAGTGGGAGCACGCTTAGGCGTGTGACTGCGTACCTTTTGTATAATGGGTCAGCGACTTATATTCTGTAGCAAGGTTAACCGAATAGGGGAGCCGAAGGGAAACCGAGTCTTAACTGGGCGTTAAGTTGCAGGGTATAGACCCGAAACCCGGTGATCTAGCCATGGGCAGGTTGAAGGTTGGGTAACACTAACTGGAGGACCGAACCGACTAAT SRR7230785 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 01:20:29 Started mapping on | Feb 11 01:20:29 Finished on | Feb 11 01:23:24 Mapping speed, Million of reads per hour | 243.65 Number of input reads | 11843989 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 9774154 Uniquely mapped reads % | 82.52% Average mapped length | 288.95 Number of splices: Total | 7608919 Number of splices: Annotated (sjdb) | 7437309 Number of splices: GT/AG | 7447576 Number of splices: GC/AG | 129996 Number of splices: AT/AC | 5499 Number of splices: Non-canonical | 25848 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.03% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 321715 % of reads mapped to multiple loci | 2.72% Number of reads mapped to too many loci | 134298 % of reads mapped to too many loci | 1.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.24% % of reads unmapped: other | 0.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1764474 1764474 1764474 N_multimapping 321715 321715 321715 N_noFeature 279064 9522771 347040 N_ambiguous 255218 587 71574 UnstrandedReadsAssigned:9239872 PositiveStrandReadsAssigned:250796 NegativeStrandReadsAssigned:9355540 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7230785 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230785-trimmed-pair1.fastq SRR7230785-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,843,989 reads, 9,493,659 reads pseudoaligned [quant] estimated average fragment length: 210.563 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,316 rounds 52401 SRR7230785.ke.tsv 34699 SRR7230785.se.tsv 87100 total ==> SRR7230785.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1808.44 292 12.6044 Potri.005G024800.1.v4.1 1035 825.437 148 13.9965 Potri.004G059700.1.v4.1 961 751.437 5 0.519422 Potri.007G009000.2.v4.1 1416 1206.44 0 0 Potri.003G141000.2.v4.1 2943 2733.44 527 15.0503 Potri.016G087400.1.v4.1 270 92.2232 580 490.943 Potri.015G069301.1.v4.1 564 356.256 0 0 Potri.010G195200.1.v4.1 1773 1563.44 37 1.84742 Potri.012G127500.1.v4.1 977 767.437 55 5.59452 ==> SRR7230785.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 375 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 348 Potri.001G212900.v4.1 33 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7230785 completed mapping pipeline successfully