Starting /dee2/code/volunteer_pipeline.sh SRR7230786 current disk space = 3057051443200 free memory = 1461257068 SRR7230786 SRAfilesize 8268351bd86315202adfe5aa36581cca SRR7230786.sra SRR7230786.sra file validated SRR7230786 is paired end SRR7230786 is conventional basespace SRR7230786 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230786_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.47875 34.0 34.0 34.0 33.0 34.0 2 33.52625 34.0 34.0 34.0 33.0 34.0 3 33.5835 34.0 34.0 34.0 33.0 34.0 4 33.536 34.0 34.0 34.0 33.0 34.0 5 33.51425 34.0 34.0 34.0 33.0 34.0 6 37.2165 38.0 38.0 38.0 36.0 38.0 7 37.39 38.0 38.0 38.0 37.0 38.0 8 37.42525 38.0 38.0 38.0 37.0 38.0 9 37.4445 38.0 38.0 38.0 38.0 38.0 10-14 37.431200000000004 38.0 38.0 38.0 37.4 38.0 15-19 37.43745 38.0 38.0 38.0 38.0 38.0 20-24 37.414100000000005 38.0 38.0 38.0 37.8 38.0 25-29 37.1086 38.0 38.0 38.0 36.0 38.0 30-34 37.15245 38.0 38.0 38.0 36.6 38.0 35-39 36.9732 38.0 38.0 38.0 36.2 38.0 40-44 36.73845 38.0 38.0 38.0 35.4 38.0 45-49 36.55695 38.0 37.6 38.0 34.2 38.0 50-54 36.8269 38.0 37.8 38.0 35.4 38.0 55-59 37.07765 38.0 38.0 38.0 36.2 38.0 60-64 37.041 38.0 38.0 38.0 36.2 38.0 65-69 36.995099999999994 38.0 38.0 38.0 36.0 38.0 70-74 31.94475 38.0 26.8 38.0 15.4 38.0 75-79 33.03085 38.0 36.0 38.0 11.8 38.0 80-84 35.506899999999995 38.0 38.0 38.0 30.0 38.0 85-89 36.57895 38.0 38.0 38.0 35.0 38.0 90-94 36.765249999999995 38.0 38.0 38.0 35.4 38.0 95-99 36.8012 38.0 38.0 38.0 35.6 38.0 100-104 36.63335 38.0 38.0 38.0 35.0 38.0 105-109 36.583600000000004 38.0 38.0 38.0 34.6 38.0 110-114 36.3849 38.0 38.0 38.0 34.0 38.0 115-119 35.8451 38.0 37.2 38.0 32.2 38.0 120-124 35.65345 38.0 37.0 38.0 31.0 38.0 125-129 35.5621 38.0 36.6 38.0 31.0 38.0 130-134 34.97795 38.0 35.6 38.0 27.6 38.0 135-139 35.340199999999996 38.0 36.0 38.0 31.0 38.0 140-144 34.494299999999996 38.0 35.4 38.0 26.2 38.0 145-149 33.947050000000004 38.0 33.4 38.0 25.0 38.0 150-151 30.100125 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 2.0 12 2.0 13 0.0 14 3.0 15 2.0 16 2.0 17 2.0 18 5.0 19 3.0 20 1.0 21 1.0 22 7.0 23 9.0 24 9.0 25 17.0 26 26.0 27 29.0 28 33.0 29 28.0 30 52.0 31 52.0 32 77.0 33 168.0 34 252.0 35 407.0 36 791.0 37 2019.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.94097048524262 20.51025512756378 5.377688844422211 42.17108554277139 2 14.85 18.475 51.800000000000004 14.875 3 14.249999999999998 25.4 30.599999999999998 29.75 4 19.875 32.375 26.125 21.625 5 19.25 39.15 25.474999999999998 16.125 6 15.75 36.199999999999996 27.400000000000002 20.65 7 12.8 23.325000000000003 46.150000000000006 17.724999999999998 8 13.700000000000001 21.25 37.05 28.000000000000004 9 15.7 20.674999999999997 36.75 26.875 10-14 19.67 28.99 27.57 23.77 15-19 19.24788718307746 28.869330399559935 27.819172875931393 24.063609541431212 20-24 18.91 29.04 28.17 23.880000000000003 25-29 19.695 28.83 28.384999999999998 23.09 30-34 19.31 28.655 27.950000000000003 24.085 35-39 19.354031046569855 28.753129694541812 27.831747621432147 24.061091637456183 40-44 19.535327177840227 28.51766358892011 28.306904857486952 23.64010437575271 45-49 19.68984492246123 28.8144072036018 28.424212106053027 23.07153576788394 50-54 19.814999999999998 28.665000000000003 28.13 23.39 55-59 20.150000000000002 28.985 27.785 23.080000000000002 60-64 19.435 28.52 28.34 23.705000000000002 65-69 19.96 28.310000000000002 28.505000000000003 23.225 70-74 19.712869003690038 28.863007380073803 28.27490774907749 23.14921586715867 75-79 19.70200509582364 29.361914257228317 27.960562756175918 22.975517890772128 80-84 19.772000412668937 28.28845558650573 28.211080160940888 23.728463839884455 85-89 20.06433453960595 28.437876960193005 27.729191797346196 23.768596702854843 90-94 19.68 28.605000000000004 28.384999999999998 23.330000000000002 95-99 19.695 28.945 27.839999999999996 23.52 100-104 20.235 28.565 28.015 23.185 105-109 20.155 28.549999999999997 28.415000000000003 22.88 110-114 20.54 29.01 27.334999999999997 23.115 115-119 20.82 28.804999999999996 27.065 23.31 120-124 20.625 28.754999999999995 27.139999999999997 23.48 125-129 20.25 28.67 27.51 23.57 130-134 20.349999999999998 29.189999999999998 27.229999999999997 23.23 135-139 21.240000000000002 28.88 26.26 23.62 140-144 20.599999999999998 28.64 27.13 23.630000000000003 145-149 20.34 28.54 27.089999999999996 24.03 150-151 20.7 29.012500000000003 27.0125 23.275000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.0 21 1.0 22 2.5 23 5.5 24 6.0 25 7.0 26 10.0 27 19.0 28 25.5 29 28.5 30 32.5 31 41.0 32 52.5 33 68.0 34 83.5 35 87.0 36 101.5 37 127.5 38 162.5 39 200.5 40 227.5 41 243.0 42 260.0 43 274.5 44 276.0 45 278.5 46 243.0 47 213.5 48 201.0 49 159.0 50 126.0 51 101.0 52 78.0 53 66.0 54 58.5 55 44.0 56 28.0 57 18.5 58 12.5 59 6.5 60 6.0 61 5.0 62 1.5 63 1.0 64 1.0 65 0.5 66 0.0 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.015 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.15 40-44 0.36 45-49 0.05 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 13.28 75-79 9.73 80-84 3.0700000000000003 85-89 0.52 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.37357052096569 96.775 2 1.6010165184243963 3.15 3 0.025412960609911054 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.44999999999999996 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 0.9375 0.0 0.0 0.0 0.0 92-93 1.1124999999999998 0.0 0.0 0.0 0.0 94-95 1.3375 0.0 0.0 0.0 0.0 96-97 1.625 0.0 0.0 0.0 0.0 98-99 1.9874999999999998 0.0 0.0 0.0 0.0 100-101 2.3499999999999996 0.0 0.0 0.0 0.0 102-103 2.6375 0.0 0.0 0.0 0.0 104-105 2.9625 0.0 0.0 0.0 0.0 106-107 3.3625 0.0 0.0 0.0 0.0 108-109 3.8625 0.0 0.0 0.0 0.0 110-111 4.362500000000001 0.0 0.0 0.0 0.0 112-113 4.725 0.0 0.0 0.0 0.0 114-115 5.475 0.0 0.0 0.0 0.0 116-117 6.1625 0.0 0.0 0.0 0.0 118-119 6.7 0.0 0.0 0.0 0.0 120-121 7.3125 0.0 0.0 0.0 0.0 122-123 7.975 0.0 0.0 0.0 0.0 124-125 8.55 0.0 0.0 0.0 0.0 126-127 9.15 0.0 0.0 0.0 0.0 128-129 9.825 0.0 0.0 0.0 0.0 130-131 10.5625 0.0 0.0 0.0 0.0 132-133 11.525 0.0 0.0 0.0 0.0 134-135 12.1625 0.0 0.0 0.0 0.0 136-137 12.825 0.0 0.0 0.0 0.0 138-139 13.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAGAG 60 0.005140001 14.20875 135-139 >>END_MODULE SRR7230786 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230786_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.89725 34.0 33.0 34.0 32.0 34.0 2 33.19975 34.0 33.0 34.0 33.0 34.0 3 33.2005 34.0 33.0 34.0 33.0 34.0 4 33.1745 34.0 33.0 34.0 33.0 34.0 5 33.228 34.0 33.0 34.0 33.0 34.0 6 37.329 38.0 38.0 38.0 37.0 38.0 7 37.30325 38.0 38.0 38.0 37.0 38.0 8 37.25175 38.0 38.0 38.0 38.0 38.0 9 37.265 38.0 38.0 38.0 37.0 38.0 10-14 36.9962 38.0 38.0 38.0 36.6 38.0 15-19 37.2604 38.0 38.0 38.0 37.0 38.0 20-24 37.285399999999996 38.0 38.0 38.0 37.8 38.0 25-29 37.25705 38.0 38.0 38.0 37.6 38.0 30-34 37.25435 38.0 38.0 38.0 37.8 38.0 35-39 36.97085 38.0 38.0 38.0 36.6 38.0 40-44 37.0494 38.0 38.0 38.0 37.0 38.0 45-49 37.0817 38.0 38.0 38.0 37.0 38.0 50-54 37.16345 38.0 38.0 38.0 37.2 38.0 55-59 36.96775 38.0 38.0 38.0 36.8 38.0 60-64 37.0692 38.0 38.0 38.0 37.0 38.0 65-69 36.98885 38.0 38.0 38.0 36.8 38.0 70-74 36.81335 38.0 38.0 38.0 36.6 38.0 75-79 36.9237 38.0 38.0 38.0 36.4 38.0 80-84 36.9485 38.0 38.0 38.0 36.8 38.0 85-89 36.8787 38.0 38.0 38.0 36.2 38.0 90-94 36.809250000000006 38.0 38.0 38.0 36.4 38.0 95-99 36.57000000000001 38.0 38.0 38.0 35.6 38.0 100-104 36.45795 38.0 38.0 38.0 34.8 38.0 105-109 36.38665 38.0 38.0 38.0 34.4 38.0 110-114 36.27825 38.0 38.0 38.0 34.0 38.0 115-119 36.20135 38.0 38.0 38.0 34.0 38.0 120-124 35.8214 38.0 38.0 38.0 33.0 38.0 125-129 35.730399999999996 38.0 38.0 38.0 33.0 38.0 130-134 35.473349999999996 38.0 37.4 38.0 31.4 38.0 135-139 35.10719999999999 38.0 36.4 38.0 30.6 38.0 140-144 34.437799999999996 38.0 35.8 38.0 27.2 38.0 145-149 32.768950000000004 38.0 32.8 38.0 16.6 38.0 150-151 27.89575 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 3.0 5 2.0 6 1.0 7 1.0 8 0.0 9 2.0 10 2.0 11 3.0 12 4.0 13 0.0 14 6.0 15 0.0 16 1.0 17 9.0 18 4.0 19 3.0 20 4.0 21 8.0 22 5.0 23 13.0 24 10.0 25 12.0 26 21.0 27 28.0 28 30.0 29 40.0 30 29.0 31 34.0 32 65.0 33 83.0 34 106.0 35 217.0 36 480.0 37 2769.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.07035175879397 24.14572864321608 8.015075376884422 33.768844221105525 2 19.2 24.575 44.074999999999996 12.15 3 15.65 27.85 35.5 21.0 4 20.549999999999997 36.1 24.9 18.45 5 23.599999999999998 40.2 22.325 13.875000000000002 6 18.85 40.300000000000004 23.025000000000002 17.825 7 17.525 18.625 44.474999999999994 19.375 8 16.3 23.75 32.7 27.250000000000004 9 19.900000000000002 22.325 32.875 24.9 10-14 23.119999999999997 28.244999999999997 26.669999999999998 21.965 15-19 22.55 27.794999999999998 29.060000000000002 20.595 20-24 22.25 27.98 28.825 20.945 25-29 22.765 28.79 27.54 20.905 30-34 22.24 28.999999999999996 28.185 20.575 35-39 22.91 27.800000000000004 28.794999999999998 20.495 40-44 22.439999999999998 28.799999999999997 28.595 20.165 45-49 22.586137820512818 28.42548076923077 28.645833333333332 20.342548076923077 50-54 22.685625594552647 28.288189055224557 28.57357432533921 20.452611024883595 55-59 22.537612838515546 28.2246740220662 28.5456369107322 20.69207622868606 60-64 22.605 28.42 28.33 20.645 65-69 22.983729662077597 28.420525657071337 28.430538172715895 20.16520650813517 70-74 23.305552766342004 28.26086956521739 28.296013655989555 20.137564012451048 75-79 22.735 28.305000000000003 28.044999999999998 20.915 80-84 22.770000000000003 29.17 27.975 20.085 85-89 23.255 28.49 28.349999999999998 19.905 90-94 23.405 28.515 28.175 19.905 95-99 23.415 28.715000000000003 28.189999999999998 19.68 100-104 23.855 28.065 28.689999999999998 19.39 105-109 23.43 29.099999999999998 27.845 19.625 110-114 24.27 28.38 27.525 19.825 115-119 24.44 28.970000000000002 27.384999999999998 19.205 120-124 24.645 28.725 26.895000000000003 19.735 125-129 24.8 28.294999999999998 27.400000000000002 19.505 130-134 24.959999999999997 28.175 27.944999999999997 18.92 135-139 25.485000000000003 28.175 27.235 19.105 140-144 25.569999999999997 28.93 26.88 18.62 145-149 25.679999999999996 28.64 27.04 18.64 150-151 26.087500000000002 28.549999999999997 26.6125 18.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.0 22 0.5 23 5.0 24 8.5 25 5.5 26 5.0 27 8.0 28 13.0 29 14.0 30 16.0 31 29.0 32 40.0 33 46.5 34 62.5 35 85.5 36 101.0 37 123.5 38 165.5 39 209.5 40 238.5 41 242.5 42 251.5 43 259.5 44 263.5 45 287.5 46 271.5 47 239.0 48 219.5 49 179.5 50 140.5 51 113.0 52 92.0 53 69.0 54 56.5 55 43.0 56 26.5 57 23.0 58 17.0 59 8.0 60 3.5 61 4.0 62 2.5 63 1.5 64 1.5 65 1.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.16 50-54 0.135 55-59 0.3 60-64 0.0 65-69 0.125 70-74 0.41000000000000003 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.175 #Duplication Level Percentage of deduplicated Percentage of total 1 98.31932773109243 96.525 2 1.578813343519226 3.1 3 0.025464731347084286 0.075 4 0.07639419404125286 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.037500000000000006 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.65 0.0 0.0 0.0 0.0 88-89 0.8125 0.0 0.0 0.0 0.0 90-91 1.0 0.0 0.0 0.0 0.0 92-93 1.1625 0.0 0.0 0.0 0.0 94-95 1.4125 0.0 0.0 0.0 0.0 96-97 1.7 0.0 0.0 0.0 0.0 98-99 2.0375 0.0 0.0 0.0 0.0 100-101 2.4000000000000004 0.0 0.0 0.0 0.0 102-103 2.6875 0.0 0.0 0.0 0.0 104-105 3.0125 0.0 0.0 0.0 0.0 106-107 3.4375 0.0 0.0 0.0 0.0 108-109 3.9375 0.0 0.0 0.0 0.0 110-111 4.4125 0.0 0.0 0.0 0.0 112-113 4.800000000000001 0.0 0.0 0.0 0.0 114-115 5.5375 0.0 0.0 0.0 0.0 116-117 6.2125 0.0 0.0 0.0 0.0 118-119 6.725 0.0 0.0 0.0 0.0 120-121 7.300000000000001 0.0 0.0 0.0 0.0 122-123 7.949999999999999 0.0 0.0 0.0 0.0 124-125 8.524999999999999 0.0 0.0 0.0 0.0 126-127 9.15 0.0 0.0 0.0 0.0 128-129 9.8375 0.0 0.0 0.0 0.0 130-131 10.6375 0.0 0.0 0.0 0.0 132-133 11.575 0.0 0.0 0.0 0.0 134-135 12.2875 0.0 0.0 0.0 0.0 136-137 12.9875 0.0 0.0 0.0 0.0 138-139 13.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCTGAT 10 0.006843168 144.91249 1 >>END_MODULE Read 885779 spots for SRR7230786.sra Written 885779 spots for SRR7230786.sra Read 885779 spots for SRR7230786.sra Written 885779 spots for SRR7230786.sra Read 885779 spots for SRR7230786.sra Written 885779 spots for SRR7230786.sra Read 885779 spots for SRR7230786.sra Written 885779 spots for SRR7230786.sra Read 885779 spots for SRR7230786.sra Written 885779 spots for SRR7230786.sra Read 885779 spots for SRR7230786.sra Written 885779 spots for SRR7230786.sra Read 885779 spots for SRR7230786.sra Written 885779 spots for SRR7230786.sra Read 885779 spots for SRR7230786.sra Written 885779 spots for SRR7230786.sra Read 885779 spots for SRR7230786.sra Written 885779 spots for SRR7230786.sra Read 885779 spots for SRR7230786.sra Written 885779 spots for SRR7230786.sra Read 885779 spots for SRR7230786.sra Written 885779 spots for SRR7230786.sra Read 885779 spots for SRR7230786.sra Written 885779 spots for SRR7230786.sra Read 885781 spots for SRR7230786.sra Written 885781 spots for SRR7230786.sra Read 885779 spots for SRR7230786.sra Written 885779 spots for SRR7230786.sra Read 885779 spots for SRR7230786.sra Written 885779 spots for SRR7230786.sra Read 885779 spots for SRR7230786.sra Written 885779 spots for SRR7230786.sra Read 885779 spots for SRR7230786.sra Written 885779 spots for SRR7230786.sra Read 885779 spots for SRR7230786.sra Written 885779 spots for SRR7230786.sra Read 885779 spots for SRR7230786.sra Written 885779 spots for SRR7230786.sra Read 885779 spots for SRR7230786.sra Written 885779 spots for SRR7230786.sra SRR ids: ['SRR7230786.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_49fm9d0j SRR7230786.sra spots: 17715582 blocks: [[1, 885779], [885780, 1771558], [1771559, 2657337], [2657338, 3543116], [3543117, 4428895], [4428896, 5314674], [5314675, 6200453], [6200454, 7086232], [7086233, 7972011], [7972012, 8857790], [8857791, 9743569], [9743570, 10629348], [10629349, 11515127], [11515128, 12400906], [12400907, 13286685], [13286686, 14172464], [14172465, 15058243], [15058244, 15944022], [15944023, 16829801], [16829802, 17715582]] SRR7230786 file size 5981529 SRR7230786 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230786 SRR7230786_1.fastq SRR7230786_2.fastq Input file: SRR7230786_1.fastq Paired file: SRR7230786_2.fastq trimmed: SRR7230786-trimmed-pair1.fastq, SRR7230786-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 01:25:01 2025 >> started Tue Feb 11 01:25:21 2025 >> done (20.322s) 17715582 read pairs processed; of these: 12342 ( 0.07%) short read pairs filtered out after trimming by size control 24321 ( 0.14%) empty read pairs filtered out after trimming by size control 17678919 (99.79%) read pairs available; of these: 8657153 (48.97%) trimmed read pairs available after processing 9021766 (51.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 33 0.00% 19 42 0.00% 20 34 0.00% 21 27 0.00% 22 37 0.00% 23 29 0.00% 24 29 0.00% 25 37 0.00% 26 37 0.00% 27 38 0.00% 28 39 0.00% 29 44 0.00% 30 44 0.00% 31 38 0.00% 32 42 0.00% 33 41 0.00% 34 46 0.00% 35 43 0.00% 36 46 0.00% 37 83 0.00% 38 70 0.00% 39 70 0.00% 40 61 0.00% 41 75 0.00% 42 63 0.00% 43 73 0.00% 44 97 0.00% 45 97 0.00% 46 102 0.00% 47 114 0.00% 48 145 0.00% 49 177 0.00% 50 181 0.00% 51 221 0.00% 52 270 0.00% 53 264 0.00% 54 322 0.00% 55 341 0.00% 56 368 0.00% 57 393 0.00% 58 566 0.00% 59 567 0.00% 60 631 0.00% 61 786 0.00% 62 884 0.01% 63 1008 0.01% 64 1125 0.01% 65 1238 0.01% 66 1447 0.01% 67 1639 0.01% 68 1915 0.01% 69 2675 0.02% 70 3069 0.02% 71 2775 0.02% 72 3008 0.02% 73 3355 0.02% 74 3856 0.02% 75 4205 0.02% 76 4743 0.03% 77 5349 0.03% 78 5914 0.03% 79 6571 0.04% 80 7344 0.04% 81 8245 0.05% 82 8960 0.05% 83 10041 0.06% 84 11804 0.07% 85 13212 0.07% 86 14673 0.08% 87 15402 0.09% 88 16568 0.09% 89 17581 0.10% 90 19845 0.11% 91 20742 0.12% 92 22036 0.12% 93 24083 0.14% 94 24978 0.14% 95 27313 0.15% 96 27985 0.16% 97 30183 0.17% 98 31470 0.18% 99 33174 0.19% 100 34911 0.20% 101 36022 0.20% 102 37473 0.21% 103 38925 0.22% 104 40755 0.23% 105 42138 0.24% 106 43749 0.25% 107 45525 0.26% 108 46897 0.27% 109 48491 0.27% 110 49793 0.28% 111 51914 0.29% 112 52956 0.30% 113 53786 0.30% 114 55783 0.32% 115 57774 0.33% 116 58482 0.33% 117 59481 0.34% 118 62008 0.35% 119 62145 0.35% 120 64192 0.36% 121 65244 0.37% 122 67380 0.38% 123 69002 0.39% 124 70103 0.40% 125 70802 0.40% 126 72291 0.41% 127 72534 0.41% 128 74006 0.42% 129 76380 0.43% 130 77760 0.44% 131 78620 0.44% 132 81785 0.46% 133 83850 0.47% 134 86180 0.49% 135 87291 0.49% 136 89306 0.51% 137 91975 0.52% 138 95543 0.54% 139 99629 0.56% 140 102481 0.58% 141 109097 0.62% 142 114626 0.65% 143 122727 0.69% 144 136532 0.77% 145 152574 0.86% 146 181043 1.02% 147 228440 1.29% 148 316740 1.79% 149 594825 3.36% 150 3597909 20.35% 151 9021766 51.03% 17678919 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=19 prefix-density=0.36 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=242.36 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.4 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=22 prefix-density=0.37 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=62.98 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.4 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7230786 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 01:26:10 Started mapping on | Feb 11 01:26:10 Finished on | Feb 11 01:28:07 Mapping speed, Million of reads per hour | 543.97 Number of input reads | 17678919 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 16811618 Uniquely mapped reads % | 95.09% Average mapped length | 288.57 Number of splices: Total | 16027577 Number of splices: Annotated (sjdb) | 15620500 Number of splices: GT/AG | 15708867 Number of splices: GC/AG | 257205 Number of splices: AT/AC | 9930 Number of splices: Non-canonical | 51575 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 1.98 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 432461 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 33925 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.21% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 450530 450530 450530 N_multimapping 432461 432461 432461 N_noFeature 835825 16513560 985852 N_ambiguous 269916 1117 121320 UnstrandedReadsAssigned:15705877 PositiveStrandReadsAssigned:296941 NegativeStrandReadsAssigned:15704446 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7230786 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230786-trimmed-pair1.fastq SRR7230786-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,678,919 reads, 15,708,747 reads pseudoaligned [quant] estimated average fragment length: 233.298 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,065 rounds 52401 SRR7230786.ke.tsv 34699 SRR7230786.se.tsv 87100 total ==> SRR7230786.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.7 582.502 22.0329 Potri.005G024800.1.v4.1 1035 802.702 192 16.1558 Potri.004G059700.1.v4.1 961 728.856 22 2.03875 Potri.007G009000.2.v4.1 1416 1183.7 0 0 Potri.003G141000.2.v4.1 2943 2710.7 944.337 23.5303 Potri.016G087400.1.v4.1 270 97.5765 673 465.857 Potri.015G069301.1.v4.1 564 342.726 0 0 Potri.010G195200.1.v4.1 1773 1540.7 62 2.71804 Potri.012G127500.1.v4.1 977 744.806 193 17.5024 ==> SRR7230786.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1122 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 411 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 60 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 3 SRR7230786 completed mapping pipeline successfully