Starting /dee2/code/volunteer_pipeline.sh SRR7230787 current disk space = 3056960864256 free memory = 1580083968 SRR7230787 SRAfilesize 1560d190da3ad2f3cf5e0e31f76c4336 SRR7230787.sra SRR7230787.sra file validated SRR7230787 is paired end SRR7230787 is conventional basespace SRR7230787 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230787_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88025 34.0 33.0 34.0 32.0 34.0 2 33.18275 34.0 33.0 34.0 32.0 34.0 3 33.3255 34.0 33.0 34.0 33.0 34.0 4 33.2775 34.0 33.0 34.0 33.0 34.0 5 32.30325 34.0 33.0 34.0 31.0 34.0 6 36.67375 38.0 37.0 38.0 34.0 38.0 7 37.2635 38.0 38.0 38.0 36.0 38.0 8 37.46125 38.0 38.0 38.0 37.0 38.0 9 37.4705 38.0 38.0 38.0 38.0 38.0 10-14 37.4665 38.0 38.0 38.0 37.8 38.0 15-19 37.43935 38.0 38.0 38.0 37.4 38.0 20-24 36.92045 38.0 38.0 38.0 35.4 38.0 25-29 37.346500000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.2613 38.0 38.0 38.0 37.0 38.0 35-39 37.02640000000001 38.0 38.0 38.0 36.0 38.0 40-44 36.7666 38.0 38.0 38.0 35.2 38.0 45-49 37.078700000000005 38.0 38.0 38.0 36.2 38.0 50-54 37.1115 38.0 38.0 38.0 36.0 38.0 55-59 36.9677 38.0 38.0 38.0 36.0 38.0 60-64 37.02255 38.0 38.0 38.0 36.0 38.0 65-69 36.995599999999996 38.0 38.0 38.0 36.0 38.0 70-74 32.17265 38.0 26.8 38.0 15.4 38.0 75-79 32.88405 38.0 35.0 38.0 14.2 38.0 80-84 35.31255 38.0 37.6 38.0 29.4 38.0 85-89 36.24595 38.0 38.0 38.0 33.4 38.0 90-94 36.3111 38.0 38.0 38.0 33.8 38.0 95-99 36.2533 38.0 38.0 38.0 33.6 38.0 100-104 36.227999999999994 38.0 37.8 38.0 33.8 38.0 105-109 36.17745 38.0 37.8 38.0 33.6 38.0 110-114 36.028150000000004 38.0 37.2 38.0 33.0 38.0 115-119 35.74495 38.0 37.0 38.0 31.6 38.0 120-124 35.40805 38.0 36.4 38.0 30.0 38.0 125-129 35.00515 38.0 35.8 38.0 28.0 38.0 130-134 34.75165 38.0 35.0 38.0 27.2 38.0 135-139 34.65410000000001 38.0 35.0 38.0 27.4 38.0 140-144 34.009249999999994 38.0 34.6 38.0 22.6 38.0 145-149 33.3227 38.0 33.4 38.0 19.0 38.0 150-151 29.010125 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 2.0 12 1.0 13 1.0 14 2.0 15 2.0 16 2.0 17 2.0 18 2.0 19 4.0 20 5.0 21 8.0 22 6.0 23 6.0 24 17.0 25 21.0 26 23.0 27 30.0 28 26.0 29 57.0 30 66.0 31 102.0 32 91.0 33 162.0 34 249.0 35 392.0 36 744.0 37 1974.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.96074018504626 15.528882220555138 9.977494373593398 31.532883220805203 2 21.125 20.575 33.4 24.9 3 19.15 26.5 27.025 27.325 4 20.974999999999998 33.800000000000004 23.0 22.225 5 19.725 36.8 25.05 18.425 6 18.375 36.775000000000006 25.45 19.400000000000002 7 13.725000000000001 23.25 44.15 18.875 8 17.25 23.35 30.3 29.099999999999998 9 16.25 23.3 33.775 26.674999999999997 10-14 20.595 29.275000000000002 26.334999999999997 23.794999999999998 15-19 20.051002550127507 28.911445572278616 27.426371318565927 23.611180559027954 20-24 20.28 28.82 27.365000000000002 23.535 25-29 20.0880132019803 28.764314647197082 27.2890933640046 23.858578786818022 30-34 19.81 28.46 28.005000000000003 23.724999999999998 35-39 20.145 28.58 26.775 24.5 40-44 20.13013013013013 28.768768768768773 27.147147147147148 23.953953953953956 45-49 20.24 28.349999999999998 27.615000000000002 23.794999999999998 50-54 19.797919167667068 29.186674669867944 27.115846338535416 23.89955982392957 55-59 20.393550971359904 28.48988584017625 27.463448828359706 23.653114360104148 60-64 20.193270578810335 28.314640496695375 27.453434808732226 24.038654115762068 65-69 20.0150225338007 27.821732598898347 27.41111667501252 24.752128192288435 70-74 20.00342720054835 28.87987662078026 25.915348146455703 25.201348032215687 75-79 20.653070199549227 28.503105931504592 26.98587213457204 23.85795173437414 80-84 20.418902187371028 28.456458935204292 26.774659513000415 24.349979364424268 85-89 19.940700537715465 28.42856424945977 26.865671641791046 24.76506357103372 90-94 20.5 27.415 28.000000000000004 24.085 95-99 20.985 28.299999999999997 26.72 23.995 100-104 20.695 28.715000000000003 26.314999999999998 24.275 105-109 20.535 27.805000000000003 27.555000000000003 24.104999999999997 110-114 21.165 27.735 27.125 23.974999999999998 115-119 20.855 28.255000000000003 26.68 24.21 120-124 20.72 28.74 26.119999999999997 24.42 125-129 21.14 27.67 26.625 24.565 130-134 21.16 27.900000000000002 26.229999999999997 24.709999999999997 135-139 21.415 27.43 26.32 24.834999999999997 140-144 21.82 27.565 25.795 24.82 145-149 21.265 27.275 25.72 25.740000000000002 150-151 21.1625 27.3875 26.924999999999997 24.525 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 2.0 22 4.5 23 4.0 24 4.0 25 7.5 26 12.0 27 12.5 28 13.5 29 17.0 30 23.5 31 39.5 32 51.5 33 59.0 34 74.0 35 83.5 36 88.5 37 115.0 38 158.5 39 186.5 40 198.5 41 208.0 42 215.0 43 222.0 44 219.0 45 210.0 46 227.5 47 233.5 48 215.5 49 191.0 50 173.0 51 153.0 52 118.0 53 99.0 54 81.0 55 60.0 56 50.5 57 41.5 58 32.5 59 27.0 60 19.0 61 14.0 62 10.5 63 7.0 64 3.0 65 1.5 66 2.0 67 1.5 68 2.0 69 2.0 70 1.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.015 30-34 0.0 35-39 0.0 40-44 0.1 45-49 0.0 50-54 0.04 55-59 0.13999999999999999 60-64 0.13999999999999999 65-69 0.15 70-74 12.465 75-79 9.045 80-84 3.08 85-89 0.505 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85844748858447 97.425 2 0.8878741755454084 1.7500000000000002 3 0.20294266869609334 0.6 4 0.025367833587011668 0.1 5 0.025367833587011668 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCGATTCAGCATCCGAATCCAGAAAGCAAAAACAAAGTAGAATATTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.025 0.0 84-85 0.125 0.0 0.0 0.025 0.0 86-87 0.2375 0.0 0.0 0.025 0.0 88-89 0.2875 0.0 0.0 0.025 0.0 90-91 0.35 0.0 0.0 0.025 0.0 92-93 0.4375 0.0 0.0 0.025 0.0 94-95 0.55 0.0 0.0 0.025 0.0 96-97 0.7250000000000001 0.0 0.0 0.025 0.0 98-99 0.9624999999999999 0.0 0.0 0.025 0.0 100-101 1.15 0.0 0.0 0.025 0.0 102-103 1.2999999999999998 0.0 0.0 0.025 0.0 104-105 1.5 0.0 0.0 0.025 0.0 106-107 1.6749999999999998 0.0 0.0 0.025 0.0 108-109 1.9749999999999999 0.0 0.0 0.025 0.0 110-111 2.2625 0.0 0.0 0.025 0.0 112-113 2.575 0.0 0.0 0.025 0.0 114-115 2.85 0.0 0.0 0.025 0.0 116-117 3.2 0.0 0.0 0.025 0.0 118-119 3.625 0.0 0.0 0.025 0.0 120-121 4.0625 0.0 0.0 0.025 0.0 122-123 4.4375 0.0 0.0 0.025 0.0 124-125 4.85 0.0 0.0 0.025 0.0 126-127 5.325 0.0 0.0 0.025 0.0 128-129 5.9125 0.0 0.0 0.025 0.0 130-131 6.55 0.0 0.0 0.025 0.0 132-133 7.25 0.0 0.0 0.025 0.0 134-135 8.1875 0.0 0.0 0.025 0.0 136-137 8.9125 0.0 0.0 0.025 0.0 138-139 9.5 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATTTG 10 0.007240914 142.2 2 GGGATTT 10 0.007240914 142.2 1 AGATCCT 10 0.007240914 142.2 4 >>END_MODULE SRR7230787 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230787_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.752 33.0 33.0 34.0 32.0 34.0 2 32.8875 33.0 33.0 34.0 32.0 34.0 3 32.8855 34.0 33.0 34.0 32.0 34.0 4 32.90675 34.0 33.0 34.0 32.0 34.0 5 32.4295 34.0 33.0 34.0 32.0 34.0 6 36.5925 38.0 38.0 38.0 35.0 38.0 7 36.7895 38.0 38.0 38.0 36.0 38.0 8 36.838 38.0 38.0 38.0 36.0 38.0 9 36.867 38.0 38.0 38.0 36.0 38.0 10-14 36.459050000000005 38.0 38.0 38.0 34.2 38.0 15-19 36.9129 38.0 38.0 38.0 37.0 38.0 20-24 36.826049999999995 38.0 38.0 38.0 36.4 38.0 25-29 36.57405 38.0 38.0 38.0 35.4 38.0 30-34 36.709450000000004 38.0 38.0 38.0 36.0 38.0 35-39 36.52175 38.0 38.0 38.0 35.2 38.0 40-44 36.2521 38.0 38.0 38.0 34.0 38.0 45-49 36.449349999999995 38.0 38.0 38.0 35.0 38.0 50-54 36.590450000000004 38.0 38.0 38.0 35.6 38.0 55-59 36.49425 38.0 38.0 38.0 35.4 38.0 60-64 36.440000000000005 38.0 38.0 38.0 34.6 38.0 65-69 36.1909 38.0 37.8 38.0 33.6 38.0 70-74 36.308350000000004 38.0 38.0 38.0 34.6 38.0 75-79 36.40925 38.0 38.0 38.0 34.8 38.0 80-84 36.2955 38.0 38.0 38.0 34.4 38.0 85-89 36.3652 38.0 38.0 38.0 34.8 38.0 90-94 36.288650000000004 38.0 38.0 38.0 34.2 38.0 95-99 36.212300000000006 38.0 38.0 38.0 34.0 38.0 100-104 35.437250000000006 38.0 37.2 38.0 29.8 38.0 105-109 35.57885 38.0 37.2 38.0 31.8 38.0 110-114 35.700599999999994 38.0 37.6 38.0 32.2 38.0 115-119 35.6673 38.0 37.8 38.0 32.4 38.0 120-124 35.370850000000004 38.0 37.0 38.0 30.2 38.0 125-129 34.899649999999994 38.0 36.0 38.0 27.8 38.0 130-134 34.817899999999995 38.0 36.0 38.0 27.8 38.0 135-139 34.4843 38.0 35.8 38.0 27.2 38.0 140-144 33.5547 38.0 33.4 38.0 20.6 38.0 145-149 32.3125 38.0 32.6 38.0 10.8 38.0 150-151 25.91475 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 12.0 4 8.0 5 2.0 6 2.0 7 0.0 8 2.0 9 0.0 10 5.0 11 2.0 12 1.0 13 4.0 14 2.0 15 4.0 16 4.0 17 5.0 18 5.0 19 3.0 20 8.0 21 12.0 22 9.0 23 14.0 24 19.0 25 16.0 26 22.0 27 26.0 28 26.0 29 39.0 30 48.0 31 58.0 32 95.0 33 127.0 34 132.0 35 266.0 36 604.0 37 2400.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.225 18.8 12.775 21.2 2 27.825 22.650000000000002 30.099999999999998 19.425 3 22.925 27.025 30.3 19.75 4 25.724999999999998 33.85 21.9 18.525 5 24.775 37.7 20.150000000000002 17.375 6 21.925 34.55 22.325 21.2 7 20.625 19.900000000000002 38.275 21.2 8 21.9 23.474999999999998 27.500000000000004 27.125 9 21.9 24.525 28.525 25.05 10-14 24.625 28.125 25.465 21.785 15-19 24.295 27.355 27.560000000000002 20.79 20-24 24.12 27.944999999999997 26.71 21.224999999999998 25-29 24.095 27.765 26.825 21.315 30-34 23.849999999999998 27.400000000000002 27.665 21.085 35-39 24.16 27.51 26.889999999999997 21.44 40-44 23.71 27.544999999999998 27.245 21.5 45-49 24.431221561078054 27.091354567728388 26.976348817440872 21.50107505375269 50-54 23.878654385262315 27.492991589907888 27.042450941129353 21.58590308370044 55-59 24.552339870592366 26.73922856999549 27.421377338616644 21.287054220795508 60-64 24.207420742074206 26.932693269326936 27.462746274627463 21.3971397139714 65-69 24.121157414372398 27.18018153552981 27.145077980041123 21.553583070056668 70-74 24.268243785084202 27.681435445068164 26.53869286287089 21.511627906976745 75-79 24.03 27.455000000000002 27.345000000000002 21.17 80-84 24.287286185855756 27.093127938381517 27.438231469440833 21.181354406321898 85-89 24.295 26.845000000000002 27.27 21.59 90-94 23.955000000000002 27.07 27.71 21.265 95-99 24.14 27.92 27.07 20.87 100-104 24.58 27.250000000000004 27.029999999999998 21.14 105-109 24.62 27.68 26.955000000000002 20.745 110-114 24.515 27.87 27.05 20.565 115-119 25.040000000000003 27.33 27.57 20.06 120-124 25.035 27.37 27.24 20.355 125-129 24.915000000000003 27.245 27.33 20.51 130-134 25.805 27.400000000000002 27.155 19.64 135-139 25.88 27.575 26.655 19.89 140-144 25.91 27.54 26.540000000000003 20.01 145-149 26.534999999999997 27.800000000000004 25.759999999999998 19.905 150-151 26.025 28.6625 26.700000000000003 18.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 0.5 24 0.5 25 2.0 26 4.5 27 4.0 28 4.0 29 8.0 30 8.5 31 12.0 32 21.0 33 29.5 34 34.5 35 42.5 36 67.0 37 79.0 38 104.5 39 133.5 40 159.0 41 200.5 42 210.0 43 217.0 44 250.0 45 270.0 46 269.5 47 263.0 48 236.5 49 209.0 50 185.5 51 171.5 52 149.5 53 130.0 54 131.5 55 108.5 56 72.5 57 53.5 58 42.5 59 32.0 60 22.5 61 15.0 62 10.5 63 5.5 64 3.5 65 2.5 66 1.5 67 2.0 68 3.0 69 2.0 70 1.5 71 1.5 72 2.0 73 2.0 74 0.5 75 1.5 76 1.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.005 50-54 0.12 55-59 0.315 60-64 0.01 65-69 0.295 70-74 0.24 75-79 0.0 80-84 0.03 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83485309017223 97.55 2 1.0131712259371835 2.0 3 0.1519756838905775 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.6499999999999999 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.25 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.6625 0.0 0.0 0.0 0.0 106-107 1.85 0.0 0.0 0.0 0.0 108-109 2.125 0.0 0.0 0.0 0.0 110-111 2.4000000000000004 0.0 0.0 0.0 0.0 112-113 2.75 0.0 0.0 0.0 0.0 114-115 2.9875 0.0 0.0 0.0 0.0 116-117 3.3 0.0 0.0 0.0 0.0 118-119 3.7 0.0 0.0 0.0 0.0 120-121 4.1875 0.0 0.0 0.0 0.0 122-123 4.6 0.0 0.0 0.0 0.0 124-125 5.0375 0.0 0.0 0.0 0.0 126-127 5.525 0.0 0.0 0.0 0.0 128-129 6.1 0.0 0.0 0.0 0.0 130-131 6.7625 0.0 0.0 0.0 0.0 132-133 7.45 0.0 0.0 0.0 0.0 134-135 8.3875 0.0 0.0 0.0 0.0 136-137 9.1 0.0 0.0 0.0 0.0 138-139 9.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGCAT 10 0.006830828 145.0 3 TGCATAG 10 0.006830828 145.0 5 CAACCAT 10 0.006830828 145.0 4 TAGCTTA 10 0.006830828 145.0 9 TCAGTAC 10 0.006830828 145.0 145 ATAGCTT 10 0.006830828 145.0 8 GACAACC 10 0.006830828 145.0 2 CATAGCT 10 0.006830828 145.0 7 TGTGGCA 10 0.006830828 145.0 145 GCACTGC 10 0.006830828 145.0 1 ACAACCA 10 0.006830828 145.0 3 >>END_MODULE Read 749954 spots for SRR7230787.sra Written 749954 spots for SRR7230787.sra Read 749954 spots for SRR7230787.sra Written 749954 spots for SRR7230787.sra Read 749958 spots for SRR7230787.sra Written 749958 spots for SRR7230787.sra Read 749954 spots for SRR7230787.sra Written 749954 spots for SRR7230787.sra Read 749954 spots for SRR7230787.sra Written 749954 spots for SRR7230787.sra Read 749954 spots for SRR7230787.sra Written 749954 spots for SRR7230787.sra Read 749954 spots for SRR7230787.sra Written 749954 spots for SRR7230787.sra Read 749954 spots for SRR7230787.sra Written 749954 spots for SRR7230787.sra Read 749954 spots for SRR7230787.sra Written 749954 spots for SRR7230787.sra Read 749954 spots for SRR7230787.sra Written 749954 spots for SRR7230787.sra Read 749954 spots for SRR7230787.sra Written 749954 spots for SRR7230787.sra Read 749954 spots for SRR7230787.sra Written 749954 spots for SRR7230787.sra Read 749954 spots for SRR7230787.sra Written 749954 spots for SRR7230787.sra Read 749954 spots for SRR7230787.sra Written 749954 spots for SRR7230787.sra Read 749954 spots for SRR7230787.sra Written 749954 spots for SRR7230787.sra Read 749954 spots for SRR7230787.sra Written 749954 spots for SRR7230787.sra Read 749954 spots for SRR7230787.sra Written 749954 spots for SRR7230787.sra Read 749954 spots for SRR7230787.sra Written 749954 spots for SRR7230787.sra Read 749954 spots for SRR7230787.sra Written 749954 spots for SRR7230787.sra Read 749954 spots for SRR7230787.sra Written 749954 spots for SRR7230787.sra SRR ids: ['SRR7230787.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2oiw7632 SRR7230787.sra spots: 14999084 blocks: [[1, 749954], [749955, 1499908], [1499909, 2249862], [2249863, 2999816], [2999817, 3749770], [3749771, 4499724], [4499725, 5249678], [5249679, 5999632], [5999633, 6749586], [6749587, 7499540], [7499541, 8249494], [8249495, 8999448], [8999449, 9749402], [9749403, 10499356], [10499357, 11249310], [11249311, 11999264], [11999265, 12749218], [12749219, 13499172], [13499173, 14249126], [14249127, 14999084]] SRR7230787 file size 5060997 SRR7230787 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230787 SRR7230787_1.fastq SRR7230787_2.fastq Input file: SRR7230787_1.fastq Paired file: SRR7230787_2.fastq trimmed: SRR7230787-trimmed-pair1.fastq, SRR7230787-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 03:27:18 2025 >> started Tue Feb 11 03:31:13 2025 >> done (235.094s) 14999084 read pairs processed; of these: 35529 ( 0.24%) short read pairs filtered out after trimming by size control 35795 ( 0.24%) empty read pairs filtered out after trimming by size control 14927760 (99.52%) read pairs available; of these: 7542558 (50.53%) trimmed read pairs available after processing 7385202 (49.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 2 0.00% 21 3 0.00% 22 4 0.00% 23 4 0.00% 24 7 0.00% 25 8 0.00% 26 7 0.00% 27 7 0.00% 28 7 0.00% 29 12 0.00% 30 11 0.00% 31 13 0.00% 32 10 0.00% 33 17 0.00% 34 11 0.00% 35 23 0.00% 36 13 0.00% 37 14 0.00% 38 22 0.00% 39 23 0.00% 40 29 0.00% 41 36 0.00% 42 36 0.00% 43 34 0.00% 44 37 0.00% 45 42 0.00% 46 62 0.00% 47 71 0.00% 48 84 0.00% 49 71 0.00% 50 92 0.00% 51 114 0.00% 52 121 0.00% 53 128 0.00% 54 131 0.00% 55 178 0.00% 56 219 0.00% 57 165 0.00% 58 245 0.00% 59 255 0.00% 60 316 0.00% 61 363 0.00% 62 391 0.00% 63 428 0.00% 64 511 0.00% 65 560 0.00% 66 641 0.00% 67 883 0.01% 68 1204 0.01% 69 1853 0.01% 70 1413 0.01% 71 1235 0.01% 72 1339 0.01% 73 1486 0.01% 74 1736 0.01% 75 1822 0.01% 76 2152 0.01% 77 2338 0.02% 78 2561 0.02% 79 2989 0.02% 80 3311 0.02% 81 3807 0.03% 82 4300 0.03% 83 4957 0.03% 84 7057 0.05% 85 8077 0.05% 86 8623 0.06% 87 9154 0.06% 88 9464 0.06% 89 10214 0.07% 90 10541 0.07% 91 11550 0.08% 92 12147 0.08% 93 13347 0.09% 94 14395 0.10% 95 14972 0.10% 96 15618 0.10% 97 16446 0.11% 98 17510 0.12% 99 18562 0.12% 100 19435 0.13% 101 20579 0.14% 102 22380 0.15% 103 23798 0.16% 104 25187 0.17% 105 26407 0.18% 106 26814 0.18% 107 27965 0.19% 108 29263 0.20% 109 30573 0.20% 110 31745 0.21% 111 32548 0.22% 112 34821 0.23% 113 36845 0.25% 114 37848 0.25% 115 39312 0.26% 116 40368 0.27% 117 40772 0.27% 118 42036 0.28% 119 42839 0.29% 120 44577 0.30% 121 46728 0.31% 122 48211 0.32% 123 50602 0.34% 124 52660 0.35% 125 53926 0.36% 126 55883 0.37% 127 56793 0.38% 128 58672 0.39% 129 60660 0.41% 130 61940 0.41% 131 64295 0.43% 132 67303 0.45% 133 69890 0.47% 134 73134 0.49% 135 76927 0.52% 136 78982 0.53% 137 82311 0.55% 138 86005 0.58% 139 91217 0.61% 140 93778 0.63% 141 100112 0.67% 142 107926 0.72% 143 119157 0.80% 144 134324 0.90% 145 159291 1.07% 146 187321 1.25% 147 241471 1.62% 148 346209 2.32% 149 651910 4.37% 150 3246162 21.75% 151 7385202 49.47% 14927760 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=19 prefix-density=0.84 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=47.54 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.2 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=20 prefix-density=0.69 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=40.03 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.6 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7230787 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 04:23:55 Started mapping on | Feb 11 04:24:13 Finished on | Feb 11 05:56:56 Mapping speed, Million of reads per hour | 9.66 Number of input reads | 14927760 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 13537721 Uniquely mapped reads % | 90.69% Average mapped length | 290.83 Number of splices: Total | 11999793 Number of splices: Annotated (sjdb) | 11774360 Number of splices: GT/AG | 11750620 Number of splices: GC/AG | 210391 Number of splices: AT/AC | 7518 Number of splices: Non-canonical | 31264 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 409423 % of reads mapped to multiple loci | 2.74% Number of reads mapped to too many loci | 169013 % of reads mapped to too many loci | 1.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.05% % of reads unmapped: other | 0.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1011577 1011577 1011577 N_multimapping 409423 409423 409423 N_noFeature 365679 13250558 465797 N_ambiguous 270036 1225 82229 UnstrandedReadsAssigned:12902006 PositiveStrandReadsAssigned:285938 NegativeStrandReadsAssigned:12989695 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7230787 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230787-trimmed-pair1.fastq SRR7230787-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,927,760 reads, 13,165,373 reads pseudoaligned [quant] estimated average fragment length: 224.367 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,287 rounds 52401 SRR7230787.ke.tsv 34699 SRR7230787.se.tsv 87100 total ==> SRR7230787.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.63 345 12.2533 Potri.005G024800.1.v4.1 1035 811.633 188 14.7641 Potri.004G059700.1.v4.1 961 737.643 34 2.93794 Potri.007G009000.2.v4.1 1416 1192.63 0 0 Potri.003G141000.2.v4.1 2943 2719.63 679 15.9136 Potri.016G087400.1.v4.1 270 90.0179 733 519.021 Potri.015G069301.1.v4.1 564 344.915 0 0 Potri.010G195200.1.v4.1 1773 1549.63 14 0.57585 Potri.012G127500.1.v4.1 977 753.638 313 26.4723 ==> SRR7230787.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 543 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 357 Potri.001G212900.v4.1 59 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 4 SRR7230787 completed mapping pipeline successfully