Starting /dee2/code/volunteer_pipeline.sh SRR7230788 current disk space = 3056967766016 free memory = 1580003568 SRR7230788 SRAfilesize 47590cf79bd94a9c3a2997d3c4a90240 SRR7230788.sra SRR7230788.sra file validated SRR7230788 is paired end SRR7230788 is conventional basespace SRR7230788 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230788_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9045 34.0 33.0 34.0 32.0 34.0 2 32.999 34.0 33.0 34.0 32.0 34.0 3 33.024 34.0 33.0 34.0 32.0 34.0 4 33.0655 34.0 33.0 34.0 32.0 34.0 5 33.11175 34.0 33.0 34.0 32.0 34.0 6 36.759 38.0 37.0 38.0 35.0 38.0 7 37.20925 38.0 38.0 38.0 36.0 38.0 8 37.269 38.0 38.0 38.0 37.0 38.0 9 37.365 38.0 38.0 38.0 37.0 38.0 10-14 37.36525 38.0 38.0 38.0 37.0 38.0 15-19 37.296350000000004 38.0 38.0 38.0 36.8 38.0 20-24 37.13135 38.0 38.0 38.0 36.2 38.0 25-29 37.01605000000001 38.0 38.0 38.0 36.0 38.0 30-34 37.048199999999994 38.0 38.0 38.0 35.8 38.0 35-39 37.082350000000005 38.0 38.0 38.0 36.0 38.0 40-44 37.08305 38.0 38.0 38.0 36.0 38.0 45-49 37.02605 38.0 38.0 38.0 36.0 38.0 50-54 36.9563 38.0 38.0 38.0 35.8 38.0 55-59 36.8053 38.0 38.0 38.0 35.2 38.0 60-64 36.71925 38.0 38.0 38.0 34.8 38.0 65-69 36.71795 38.0 38.0 38.0 34.4 38.0 70-74 36.249300000000005 38.0 37.4 38.0 33.2 38.0 75-79 36.4756 38.0 37.8 38.0 34.0 38.0 80-84 36.488749999999996 38.0 38.0 38.0 34.0 38.0 85-89 36.3574 38.0 37.8 38.0 34.0 38.0 90-94 36.069950000000006 38.0 37.0 38.0 33.0 38.0 95-99 35.74315 38.0 36.6 38.0 30.8 38.0 100-104 35.299549999999996 38.0 36.6 38.0 28.6 38.0 105-109 34.77625 38.0 35.6 38.0 25.6 38.0 110-114 35.31845 38.0 36.0 38.0 28.8 38.0 115-119 35.06985 38.0 35.8 38.0 28.0 38.0 120-124 34.9024 38.0 35.4 38.0 27.4 38.0 125-129 34.354549999999996 38.0 34.8 38.0 24.0 38.0 130-134 33.896300000000004 38.0 34.2 38.0 19.8 38.0 135-139 33.3427 38.0 33.8 38.0 19.8 38.0 140-144 32.590599999999995 38.0 32.4 38.0 14.2 38.0 145-149 31.12055 36.8 31.0 38.0 8.6 38.0 150-151 26.05775 33.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 1.0 13 0.0 14 0.0 15 2.0 16 4.0 17 4.0 18 2.0 19 3.0 20 4.0 21 5.0 22 10.0 23 12.0 24 17.0 25 21.0 26 29.0 27 42.0 28 48.0 29 45.0 30 79.0 31 106.0 32 127.0 33 178.0 34 239.0 35 374.0 36 771.0 37 1875.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.199583116206355 15.711307972902553 9.14538822303283 31.943720687858256 2 21.8 19.325 34.599999999999994 24.275 3 18.275 27.6 27.450000000000003 26.674999999999997 4 23.075000000000003 32.375 22.975 21.575 5 20.925 38.2 24.575 16.3 6 18.5 35.475 25.4 20.625 7 13.200000000000001 23.974999999999998 44.5 18.325 8 16.175 23.400000000000002 31.574999999999996 28.849999999999998 9 17.75 22.525000000000002 32.75 26.974999999999998 10-14 20.015 29.26 26.815 23.91 15-19 19.950000000000003 28.675 28.000000000000004 23.375 20-24 19.8 28.575 27.83 23.794999999999998 25-29 19.89 29.189999999999998 27.700000000000003 23.22 30-34 19.945 28.884999999999998 27.860000000000003 23.31 35-39 20.330000000000002 28.205000000000002 28.444999999999997 23.02 40-44 19.955000000000002 28.615000000000002 28.155 23.275000000000002 45-49 19.814999999999998 29.299999999999997 27.529999999999998 23.355 50-54 20.005 28.95 27.725 23.32 55-59 20.419999999999998 27.96 27.894999999999996 23.724999999999998 60-64 20.19 29.189999999999998 27.61 23.01 65-69 19.985 28.849999999999998 27.305 23.86 70-74 20.145 28.655 27.805000000000003 23.395 75-79 19.955000000000002 28.895 27.755000000000003 23.395 80-84 20.09102730819246 28.54856456937081 27.76332899869961 23.59707912373712 85-89 20.541975556000803 28.87697856141054 26.933480264476056 23.647565618112605 90-94 20.042067307692307 28.670873397435898 28.014823717948715 23.272235576923077 95-99 20.76 27.96 27.96 23.32 100-104 20.355582341419314 28.22560393752197 27.54256441163176 23.87624930942695 105-109 20.57526558428543 28.918620966125474 27.259971938264183 23.246141511324915 110-114 20.724999999999998 28.189999999999998 27.55 23.535 115-119 20.845 28.685 26.784999999999997 23.685000000000002 120-124 20.65 28.865000000000002 27.275 23.21 125-129 20.25 28.985 26.865 23.9 130-134 21.255 28.84 26.775 23.13 135-139 20.830000000000002 27.884999999999998 27.345000000000002 23.94 140-144 20.26 29.39 26.39 23.96 145-149 21.096054802740134 28.95144757237862 26.681334066703332 23.27116355817791 150-151 20.849999999999998 28.749999999999996 27.200000000000003 23.200000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 2.5 23 3.5 24 6.0 25 7.5 26 4.5 27 4.5 28 10.5 29 20.0 30 24.5 31 24.0 32 34.5 33 47.0 34 63.5 35 86.5 36 92.0 37 123.5 38 154.5 39 165.0 40 185.5 41 206.0 42 241.0 43 257.5 44 260.5 45 279.0 46 273.0 47 248.0 48 216.0 49 191.5 50 169.0 51 126.0 52 107.5 53 93.0 54 74.5 55 55.0 56 38.0 57 30.5 58 19.0 59 18.5 60 14.5 61 6.5 62 3.0 63 1.5 64 3.0 65 2.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.03 85-89 0.18 90-94 0.16 95-99 0.0 100-104 0.445 105-109 0.22 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.2508780732563974 0.5 3 0.050175614651279475 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.48750000000000004 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.85 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.3625 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.9625 0.0 0.0 0.0 0.0 110-111 2.1624999999999996 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.7750000000000004 0.0 0.0 0.0 0.0 116-117 3.025 0.0 0.0 0.0 0.0 118-119 3.3625 0.0 0.0 0.0 0.0 120-121 3.6375 0.0 0.0 0.0 0.0 122-123 4.025 0.0 0.0 0.0 0.0 124-125 4.35 0.0 0.0 0.0 0.0 126-127 4.6 0.0 0.0 0.0 0.0 128-129 4.925 0.0 0.0 0.0 0.0 130-131 5.387499999999999 0.0 0.0 0.0 0.0 132-133 5.8125 0.0 0.0 0.0 0.0 134-135 6.2125 0.0 0.0 0.0 0.0 136-137 6.825 0.0 0.0 0.0 0.0 138-139 7.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGAGA 10 0.006832588 144.9875 7 ATTGGTA 10 0.006832588 144.9875 3 TAGAGAT 10 0.006832588 144.9875 8 GAAGAGC 40 0.0076588374 18.123438 140-144 ATCGGAA 40 0.0076588374 18.123438 135-139 AAGAGCA 50 0.0013305914 17.3985 140-144 >>END_MODULE SRR7230788 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230788_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.78275 33.0 33.0 34.0 32.0 34.0 2 32.90625 34.0 33.0 34.0 32.0 34.0 3 32.86325 34.0 33.0 34.0 32.0 34.0 4 32.80425 34.0 33.0 34.0 32.0 34.0 5 32.75425 34.0 33.0 34.0 32.0 34.0 6 36.90375 38.0 38.0 38.0 36.0 38.0 7 36.843 38.0 38.0 38.0 36.0 38.0 8 36.875 38.0 38.0 38.0 36.0 38.0 9 36.83925 38.0 38.0 38.0 36.0 38.0 10-14 36.446250000000006 38.0 37.8 38.0 34.0 38.0 15-19 36.6894 38.0 38.0 38.0 35.8 38.0 20-24 36.6807 38.0 38.0 38.0 36.0 38.0 25-29 36.6803 38.0 38.0 38.0 35.8 38.0 30-34 36.32985 38.0 38.0 38.0 34.0 38.0 35-39 36.657050000000005 38.0 38.0 38.0 35.8 38.0 40-44 36.4969 38.0 38.0 38.0 35.0 38.0 45-49 36.423100000000005 38.0 38.0 38.0 34.4 38.0 50-54 36.486450000000005 38.0 38.0 38.0 35.0 38.0 55-59 36.52425000000001 38.0 38.0 38.0 35.4 38.0 60-64 36.48045 38.0 38.0 38.0 34.8 38.0 65-69 36.436749999999996 38.0 38.0 38.0 34.8 38.0 70-74 36.1526 38.0 38.0 38.0 33.6 38.0 75-79 36.22845 38.0 38.0 38.0 34.0 38.0 80-84 36.142 38.0 38.0 38.0 33.8 38.0 85-89 36.07565 38.0 38.0 38.0 33.8 38.0 90-94 35.82595 38.0 37.8 38.0 32.6 38.0 95-99 35.88445 38.0 37.8 38.0 32.8 38.0 100-104 35.755250000000004 38.0 37.8 38.0 32.6 38.0 105-109 35.27185 38.0 36.8 38.0 29.2 38.0 110-114 35.166250000000005 38.0 36.8 38.0 28.8 38.0 115-119 35.122299999999996 38.0 36.8 38.0 28.6 38.0 120-124 34.97655 38.0 36.2 38.0 28.2 38.0 125-129 34.238350000000004 38.0 35.4 38.0 24.0 38.0 130-134 33.4195 38.0 34.2 38.0 19.2 38.0 135-139 32.76174999999999 38.0 33.4 38.0 15.8 38.0 140-144 32.463499999999996 38.0 32.8 38.0 13.6 38.0 145-149 31.629949999999997 38.0 31.8 38.0 8.6 38.0 150-151 27.677999999999997 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 9.0 4 6.0 5 1.0 6 1.0 7 2.0 8 3.0 9 2.0 10 3.0 11 2.0 12 5.0 13 3.0 14 5.0 15 4.0 16 4.0 17 11.0 18 10.0 19 6.0 20 7.0 21 12.0 22 13.0 23 21.0 24 29.0 25 17.0 26 32.0 27 29.0 28 31.0 29 39.0 30 57.0 31 79.0 32 98.0 33 132.0 34 177.0 35 285.0 36 615.0 37 2237.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.75 20.05 12.725 23.474999999999998 2 24.5 25.775 32.85 16.875 3 20.474999999999998 27.650000000000002 31.6 20.275000000000002 4 23.9 35.35 22.650000000000002 18.099999999999998 5 24.45 36.75 21.875 16.925 6 19.325 37.525 24.6 18.55 7 18.6 19.625 40.949999999999996 20.825 8 20.4 22.95 28.275 28.375 9 22.625 24.525 28.1 24.75 10-14 22.85 28.32 26.979999999999997 21.85 15-19 22.57 27.99 28.15 21.29 20-24 22.75 27.965 28.449999999999996 20.835 25-29 23.25 27.925 28.410000000000004 20.415 30-34 22.345000000000002 28.13 27.915 21.61 35-39 23.03 28.285 27.825 20.86 40-44 22.905 28.315 27.315 21.465 45-49 23.255 28.79 27.389999999999997 20.565 50-54 22.689999999999998 28.494999999999997 28.185 20.630000000000003 55-59 23.155 27.150000000000002 28.754999999999995 20.94 60-64 23.04 28.194999999999997 27.855 20.91 65-69 23.155 27.665 27.955000000000002 21.224999999999998 70-74 23.185 28.09 28.1 20.625 75-79 23.52 27.284999999999997 28.095 21.099999999999998 80-84 22.98 27.68 28.235 21.105 85-89 22.99 27.650000000000002 28.655 20.705000000000002 90-94 23.49 27.655 28.389999999999997 20.465 95-99 23.79 27.529999999999998 28.475 20.205000000000002 100-104 22.935 27.794999999999998 28.28 20.990000000000002 105-109 23.56 28.18 27.650000000000002 20.61 110-114 23.425 28.365000000000002 27.77 20.44 115-119 24.095 27.42 28.335 20.150000000000002 120-124 23.845 27.950000000000003 27.67 20.535 125-129 24.495 27.61 27.54 20.355 130-134 24.44 27.755000000000003 27.975 19.830000000000002 135-139 24.77 27.345000000000002 27.944999999999997 19.939999999999998 140-144 24.425 27.43 27.99 20.155 145-149 24.65 28.09 27.525 19.735 150-151 25.124999999999996 28.050000000000004 27.075 19.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.5 19 1.0 20 1.0 21 1.5 22 2.5 23 3.0 24 2.5 25 2.0 26 3.5 27 7.0 28 15.5 29 18.5 30 17.0 31 18.0 32 26.0 33 41.5 34 46.5 35 59.0 36 87.0 37 113.5 38 129.5 39 159.5 40 196.5 41 218.5 42 240.5 43 262.0 44 270.0 45 274.0 46 281.5 47 251.0 48 227.0 49 206.0 50 171.0 51 144.0 52 112.5 53 93.5 54 83.5 55 65.0 56 44.0 57 31.5 58 22.0 59 16.0 60 9.0 61 6.0 62 4.0 63 1.5 64 1.5 65 1.5 66 1.5 67 2.0 68 1.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6499999999999999 0.0 0.0 0.0 0.0 98-99 0.85 0.0 0.0 0.0 0.0 100-101 0.975 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.3875 0.0 0.0 0.0 0.0 106-107 1.7625 0.0 0.0 0.0 0.0 108-109 2.0250000000000004 0.0 0.0 0.0 0.0 110-111 2.25 0.0 0.0 0.0 0.0 112-113 2.5625 0.0 0.0 0.0 0.0 114-115 2.925 0.0 0.0 0.0 0.0 116-117 3.2 0.0 0.0 0.0 0.0 118-119 3.5 0.0 0.0 0.0 0.0 120-121 3.7875 0.0 0.0 0.0 0.0 122-123 4.2125 0.0 0.0 0.0 0.0 124-125 4.475 0.0 0.0 0.0 0.0 126-127 4.7 0.0 0.0 0.0 0.0 128-129 4.975 0.0 0.0 0.0 0.0 130-131 5.4375 0.0 0.0 0.0 0.0 132-133 5.85 0.0 0.0 0.0 0.0 134-135 6.2625 0.0 0.0 0.0 0.0 136-137 6.862500000000001 0.0 0.0 0.0 0.0 138-139 7.362500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAGA 10 0.006830828 145.0 8 AAGAGCG 30 0.0014437955 24.166668 140-144 ATCGGAA 40 0.0076550315 18.125 135-139 >>END_MODULE Read 987039 spots for SRR7230788.sra Written 987039 spots for SRR7230788.sra Read 987039 spots for SRR7230788.sra Written 987039 spots for SRR7230788.sra Read 987039 spots for SRR7230788.sra Written 987039 spots for SRR7230788.sra Read 987039 spots for SRR7230788.sra Written 987039 spots for SRR7230788.sra Read 987039 spots for SRR7230788.sra Written 987039 spots for SRR7230788.sra Read 987039 spots for SRR7230788.sra Written 987039 spots for SRR7230788.sra Read 987039 spots for SRR7230788.sra Written 987039 spots for SRR7230788.sra Read 987039 spots for SRR7230788.sra Written 987039 spots for SRR7230788.sra Read 987039 spots for SRR7230788.sra Written 987039 spots for SRR7230788.sra Read 987039 spots for SRR7230788.sra Written 987039 spots for SRR7230788.sra Read 987039 spots for SRR7230788.sra Written 987039 spots for SRR7230788.sra Read 987039 spots for SRR7230788.sra Written 987039 spots for SRR7230788.sra Read 987039 spots for SRR7230788.sra Written 987039 spots for SRR7230788.sra Read 987039 spots for SRR7230788.sra Written 987039 spots for SRR7230788.sra Read 987039 spots for SRR7230788.sra Written 987039 spots for SRR7230788.sra Read 987052 spots for SRR7230788.sra Written 987052 spots for SRR7230788.sra Read 987039 spots for SRR7230788.sra Written 987039 spots for SRR7230788.sra Read 987039 spots for SRR7230788.sra Written 987039 spots for SRR7230788.sra Read 987039 spots for SRR7230788.sra Written 987039 spots for SRR7230788.sra Read 987039 spots for SRR7230788.sra Written 987039 spots for SRR7230788.sra SRR ids: ['SRR7230788.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rz70xnlx SRR7230788.sra spots: 19740793 blocks: [[1, 987039], [987040, 1974078], [1974079, 2961117], [2961118, 3948156], [3948157, 4935195], [4935196, 5922234], [5922235, 6909273], [6909274, 7896312], [7896313, 8883351], [8883352, 9870390], [9870391, 10857429], [10857430, 11844468], [11844469, 12831507], [12831508, 13818546], [13818547, 14805585], [14805586, 15792624], [15792625, 16779663], [16779664, 17766702], [17766703, 18753741], [18753742, 19740793]] SRR7230788 file size 6667806 SRR7230788 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230788 SRR7230788_1.fastq SRR7230788_2.fastq Input file: SRR7230788_1.fastq Paired file: SRR7230788_2.fastq trimmed: SRR7230788-trimmed-pair1.fastq, SRR7230788-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 04:00:41 2025 >> started Tue Feb 11 04:05:42 2025 >> done (301.102s) 19740793 read pairs processed; of these: 29091 ( 0.15%) short read pairs filtered out after trimming by size control 18352 ( 0.09%) empty read pairs filtered out after trimming by size control 19693350 (99.76%) read pairs available; of these: 11085282 (56.29%) trimmed read pairs available after processing 8608068 (43.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 7 0.00% 21 2 0.00% 22 2 0.00% 23 8 0.00% 24 11 0.00% 25 9 0.00% 26 9 0.00% 27 18 0.00% 28 11 0.00% 29 13 0.00% 30 12 0.00% 31 16 0.00% 32 15 0.00% 33 9 0.00% 34 22 0.00% 35 18 0.00% 36 13 0.00% 37 28 0.00% 38 22 0.00% 39 28 0.00% 40 41 0.00% 41 31 0.00% 42 41 0.00% 43 44 0.00% 44 49 0.00% 45 51 0.00% 46 65 0.00% 47 83 0.00% 48 76 0.00% 49 99 0.00% 50 96 0.00% 51 138 0.00% 52 147 0.00% 53 147 0.00% 54 188 0.00% 55 182 0.00% 56 202 0.00% 57 236 0.00% 58 307 0.00% 59 336 0.00% 60 361 0.00% 61 408 0.00% 62 475 0.00% 63 569 0.00% 64 600 0.00% 65 646 0.00% 66 771 0.00% 67 810 0.00% 68 1041 0.01% 69 1554 0.01% 70 1921 0.01% 71 1713 0.01% 72 1735 0.01% 73 1964 0.01% 74 2091 0.01% 75 2364 0.01% 76 2691 0.01% 77 2893 0.01% 78 3219 0.02% 79 3639 0.02% 80 4121 0.02% 81 4604 0.02% 82 5124 0.03% 83 6088 0.03% 84 7645 0.04% 85 8688 0.04% 86 9448 0.05% 87 10204 0.05% 88 10581 0.05% 89 11323 0.06% 90 12151 0.06% 91 12862 0.07% 92 13637 0.07% 93 14760 0.07% 94 15534 0.08% 95 16599 0.08% 96 17561 0.09% 97 18091 0.09% 98 19378 0.10% 99 20662 0.10% 100 21312 0.11% 101 22800 0.12% 102 24080 0.12% 103 25359 0.13% 104 26486 0.13% 105 27501 0.14% 106 28948 0.15% 107 29997 0.15% 108 31251 0.16% 109 33218 0.17% 110 34448 0.17% 111 35953 0.18% 112 37749 0.19% 113 39171 0.20% 114 41064 0.21% 115 42281 0.21% 116 43954 0.22% 117 45120 0.23% 118 47111 0.24% 119 48460 0.25% 120 50159 0.25% 121 52584 0.27% 122 54718 0.28% 123 57700 0.29% 124 59239 0.30% 125 61653 0.31% 126 63669 0.32% 127 65952 0.33% 128 69056 0.35% 129 73401 0.37% 130 75899 0.39% 131 78767 0.40% 132 83007 0.42% 133 87432 0.44% 134 91154 0.46% 135 97277 0.49% 136 102867 0.52% 137 108602 0.55% 138 116835 0.59% 139 126137 0.64% 140 136089 0.69% 141 149105 0.76% 142 166192 0.84% 143 186583 0.95% 144 216563 1.10% 145 256494 1.30% 146 319912 1.62% 147 427847 2.17% 148 637359 3.24% 149 1211605 6.15% 150 4841792 24.59% 151 8608068 43.71% 19693350 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.90 fanout-score-rank=5 prefix-density=0.68 prefix-fanout=3.1 sequence=CCATTGCTTGCAATGGAAGTAATGTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=45.02 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.7 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=22 prefix-density=0.68 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=23 fanout-score=17.41 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=4.3 sequence=CTGCATTTGCTAGCTAGAAGTCACTCTACCCTTCGCATTACTTCCTCAATCAACCACTGCTGTTTGATCATGGCAGCAACCATCTCAACCGTTGGAGCTGTCAACACAGCACCGCTGGCTTTGAATGGCTCTGGCGCTGGATCCACAGTCCCAA SRR7230788 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 05:20:37 Started mapping on | Feb 11 05:20:40 Finished on | Feb 11 07:33:14 Mapping speed, Million of reads per hour | 8.91 Number of input reads | 19693350 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 18406385 Uniquely mapped reads % | 93.46% Average mapped length | 291.48 Number of splices: Total | 17423644 Number of splices: Annotated (sjdb) | 17028023 Number of splices: GT/AG | 17085954 Number of splices: GC/AG | 282842 Number of splices: AT/AC | 10261 Number of splices: Non-canonical | 44587 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 493200 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 50745 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.69% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 825562 825562 825562 N_multimapping 493200 493200 493200 N_noFeature 745586 18112953 884973 N_ambiguous 275139 1174 120318 UnstrandedReadsAssigned:17385660 PositiveStrandReadsAssigned:292258 NegativeStrandReadsAssigned:17401094 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7230788 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230788-trimmed-pair1.fastq SRR7230788-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,693,350 reads, 17,455,044 reads pseudoaligned [quant] estimated average fragment length: 239.425 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,049 rounds 52401 SRR7230788.ke.tsv 34699 SRR7230788.se.tsv 87100 total ==> SRR7230788.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.58 916 30.8696 Potri.005G024800.1.v4.1 1035 796.575 107 8.0558 Potri.004G059700.1.v4.1 961 722.641 14 1.16187 Potri.007G009000.2.v4.1 1416 1177.58 0 0 Potri.003G141000.2.v4.1 2943 2704.58 808 17.9169 Potri.016G087400.1.v4.1 270 84.4574 731 519.076 Potri.015G069301.1.v4.1 564 331.33 0 0 Potri.010G195200.1.v4.1 1773 1534.58 27 1.05518 Potri.012G127500.1.v4.1 977 738.618 189 15.346 ==> SRR7230788.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1373 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 345 Potri.001G212900.v4.1 20 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 1 SRR7230788 completed mapping pipeline successfully