Starting /dee2/code/volunteer_pipeline.sh SRR7230789 current disk space = 3056991191040 free memory = 1033376192 SRR7230789 SRAfilesize 97094624a5fa58cbe35a26cf5f7327f2 SRR7230789.sra SRR7230789.sra file validated SRR7230789 is paired end SRR7230789 is conventional basespace SRR7230789 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230789_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72825 33.0 33.0 34.0 32.0 34.0 2 33.1905 34.0 33.0 34.0 32.0 34.0 3 33.31075 34.0 33.0 34.0 33.0 34.0 4 33.3435 34.0 33.0 34.0 33.0 34.0 5 31.99975 34.0 33.0 34.0 28.0 34.0 6 36.624 38.0 37.0 38.0 34.0 38.0 7 37.308 38.0 38.0 38.0 36.0 38.0 8 37.51375 38.0 38.0 38.0 37.0 38.0 9 37.52825 38.0 38.0 38.0 38.0 38.0 10-14 37.49705 38.0 38.0 38.0 37.8 38.0 15-19 37.489850000000004 38.0 38.0 38.0 37.8 38.0 20-24 36.9633 38.0 38.0 38.0 35.8 38.0 25-29 37.35435 38.0 38.0 38.0 37.0 38.0 30-34 37.397499999999994 38.0 38.0 38.0 37.0 38.0 35-39 37.0604 38.0 38.0 38.0 36.0 38.0 40-44 36.8309 38.0 38.0 38.0 35.6 38.0 45-49 37.199799999999996 38.0 38.0 38.0 36.4 38.0 50-54 37.2737 38.0 38.0 38.0 36.8 38.0 55-59 37.14470000000001 38.0 38.0 38.0 36.0 38.0 60-64 37.16175 38.0 38.0 38.0 36.2 38.0 65-69 37.158 38.0 38.0 38.0 36.2 38.0 70-74 31.286399999999997 38.0 24.0 38.0 15.4 38.0 75-79 32.1561 38.0 33.4 38.0 9.4 38.0 80-84 35.05159999999999 38.0 37.4 38.0 28.6 38.0 85-89 36.27605 38.0 38.0 38.0 33.4 38.0 90-94 36.448899999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.387649999999994 38.0 38.0 38.0 34.0 38.0 100-104 36.36395 38.0 38.0 38.0 34.0 38.0 105-109 36.43515 38.0 38.0 38.0 34.0 38.0 110-114 36.2644 38.0 37.6 38.0 33.6 38.0 115-119 35.97175 38.0 37.0 38.0 33.0 38.0 120-124 35.50005 38.0 36.4 38.0 30.2 38.0 125-129 35.22075 38.0 36.0 38.0 28.6 38.0 130-134 35.027750000000005 38.0 35.6 38.0 27.8 38.0 135-139 35.0394 38.0 35.2 38.0 28.2 38.0 140-144 34.411699999999996 38.0 35.0 38.0 25.4 38.0 145-149 33.7094 38.0 33.4 38.0 23.0 38.0 150-151 29.55525 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 2.0 14 0.0 15 3.0 16 0.0 17 3.0 18 2.0 19 2.0 20 2.0 21 4.0 22 3.0 23 6.0 24 11.0 25 18.0 26 22.0 27 23.0 28 39.0 29 41.0 30 63.0 31 65.0 32 109.0 33 188.0 34 275.0 35 444.0 36 866.0 37 1807.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.574999999999996 14.6 8.95 37.875 2 20.05 21.25 36.4 22.3 3 20.05 25.0 27.125 27.825 4 22.675 33.75 22.650000000000002 20.925 5 20.275000000000002 37.475 24.25 18.0 6 16.7 36.75 26.8 19.75 7 13.600000000000001 22.55 43.8 20.05 8 17.299999999999997 22.1 32.1 28.499999999999996 9 17.4 22.025 34.275 26.3 10-14 20.105 29.665000000000003 26.41 23.82 15-19 20.27 28.749999999999996 27.345000000000002 23.635 20-24 19.86 28.599999999999998 27.889999999999997 23.65 25-29 19.63 28.775000000000002 28.294999999999998 23.3 30-34 19.78 28.615000000000002 28.015 23.59 35-39 20.16 28.110000000000003 28.035 23.695 40-44 20.382324976229796 28.609317920232197 27.86868838512736 23.13966871841065 45-49 19.945 28.749999999999996 27.384999999999998 23.919999999999998 50-54 20.236011800590028 28.281414070703537 27.711385569278463 23.771188559427973 55-59 19.490847254176252 29.02370711213364 27.89336801040312 23.592077623286986 60-64 20.05001250312578 28.997249312328083 27.726931732933235 23.225806451612904 65-69 19.931976191667083 28.77006952433352 27.74971239933977 23.54824188465963 70-74 20.298489853704577 28.710476639924494 27.825625294950445 23.165408211420484 75-79 20.101437024513945 28.22203437588053 27.844463229078613 23.83206537052691 80-84 19.63765097875885 28.26426488962932 28.06643065389421 24.03165347771762 85-89 20.07949285570537 28.169651841416783 28.531897766150134 23.21895753672771 90-94 20.315 28.349999999999998 27.47 23.865 95-99 20.275000000000002 28.32 27.955000000000002 23.45 100-104 20.93 28.22 27.384999999999998 23.465 105-109 20.674999999999997 27.88 27.74 23.705000000000002 110-114 20.145 28.299999999999997 27.750000000000004 23.805 115-119 21.11 28.51 26.93 23.45 120-124 21.075 28.535 27.165 23.225 125-129 20.84 28.92 26.72 23.52 130-134 20.419999999999998 29.020000000000003 27.029999999999998 23.53 135-139 21.13 28.62 26.865 23.385 140-144 20.985 28.715000000000003 26.834999999999997 23.465 145-149 21.29 28.37 27.150000000000002 23.189999999999998 150-151 21.15 28.499999999999996 27.737499999999997 22.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 3.0 22 3.5 23 4.5 24 6.0 25 5.0 26 8.5 27 11.5 28 13.5 29 21.5 30 26.0 31 33.0 32 41.5 33 50.5 34 74.0 35 93.5 36 122.0 37 143.5 38 160.5 39 195.5 40 213.5 41 236.5 42 248.0 43 252.0 44 248.0 45 247.0 46 248.0 47 226.5 48 212.5 49 183.5 50 146.5 51 111.5 52 93.5 53 77.5 54 52.5 55 42.5 56 40.5 57 32.5 58 18.0 59 10.0 60 10.5 61 9.5 62 6.0 63 3.5 64 1.0 65 2.5 66 3.0 67 1.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.08499999999999999 45-49 0.0 50-54 0.005 55-59 0.03 60-64 0.025 65-69 0.034999999999999996 70-74 15.24 75-79 11.275 80-84 3.9600000000000004 85-89 0.62 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49685534591195 98.875 2 0.4528301886792453 0.8999999999999999 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025157232704402514 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.025 0.0 0.0 0.0 3 0.0 0.025 0.0 0.0 0.0 4 0.0 0.025 0.0 0.0 0.0 5 0.0 0.025 0.0 0.0 0.0 6 0.0 0.025 0.0 0.0 0.0 7 0.0 0.025 0.0 0.0 0.0 8 0.0 0.025 0.0 0.0 0.0 9 0.0 0.025 0.0 0.0 0.0 10-11 0.0 0.025 0.0 0.0 0.0 12-13 0.0 0.025 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0125 0.025 0.0 0.0 0.0 76-77 0.037500000000000006 0.025 0.0 0.0 0.0 78-79 0.0875 0.025 0.0 0.0 0.0 80-81 0.1 0.025 0.0 0.0 0.0 82-83 0.1125 0.025 0.0 0.0 0.0 84-85 0.175 0.025 0.0 0.0 0.0 86-87 0.1875 0.025 0.0 0.0 0.0 88-89 0.25 0.025 0.0 0.0 0.0 90-91 0.3 0.025 0.0 0.0 0.0 92-93 0.3 0.025 0.0 0.0 0.0 94-95 0.3375 0.025 0.0 0.0 0.0 96-97 0.3875 0.025 0.0 0.0 0.0 98-99 0.44999999999999996 0.025 0.0 0.0 0.0 100-101 0.575 0.025 0.0 0.0 0.0 102-103 0.7125 0.025 0.0 0.0 0.0 104-105 0.85 0.025 0.0 0.0 0.0 106-107 0.9624999999999999 0.025 0.0 0.0 0.0 108-109 1.025 0.025 0.0 0.0 0.0 110-111 1.125 0.025 0.0 0.0 0.0 112-113 1.275 0.025 0.0 0.0 0.0 114-115 1.45 0.025 0.0 0.0 0.0 116-117 1.65 0.025 0.0 0.0 0.0 118-119 1.9125 0.025 0.0 0.0 0.0 120-121 2.075 0.025 0.0 0.0 0.0 122-123 2.375 0.025 0.0 0.0 0.0 124-125 2.625 0.025 0.0 0.0 0.0 126-127 2.8625 0.025 0.0 0.0 0.0 128-129 3.3 0.025 0.0 0.0 0.0 130-131 3.7 0.025 0.0 0.0 0.0 132-133 4.05 0.025 0.0 0.0 0.0 134-135 4.487500000000001 0.025 0.0 0.0 0.0 136-137 4.762499999999999 0.025 0.0 0.0 0.0 138-139 5.175000000000001 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCAATC 10 0.0073640896 141.4 1 ATCATAG 10 0.0073640896 141.4 5 >>END_MODULE SRR7230789 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230789_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2395 33.0 32.0 33.0 27.0 34.0 2 31.56325 33.0 32.0 33.0 27.0 34.0 3 31.67625 33.0 32.0 33.0 28.0 34.0 4 31.6115 33.0 32.0 33.0 28.0 34.0 5 31.1145 33.0 32.0 33.0 27.0 34.0 6 34.9405 38.0 35.0 38.0 28.0 38.0 7 35.27075 38.0 36.0 38.0 29.0 38.0 8 35.39875 38.0 36.0 38.0 29.0 38.0 9 35.44325 38.0 36.0 38.0 29.0 38.0 10-14 34.79255 38.0 35.4 38.0 26.0 38.0 15-19 35.568200000000004 38.0 36.0 38.0 29.4 38.0 20-24 35.4544 38.0 36.0 38.0 29.0 38.0 25-29 34.8237 38.0 35.8 38.0 26.4 38.0 30-34 35.03575 38.0 36.0 38.0 28.0 38.0 35-39 34.59490000000001 38.0 35.0 38.0 24.8 38.0 40-44 34.11985 38.0 34.0 38.0 21.4 38.0 45-49 34.47475 38.0 34.8 38.0 24.6 38.0 50-54 34.7924 38.0 35.4 38.0 27.2 38.0 55-59 34.689350000000005 38.0 35.4 38.0 26.8 38.0 60-64 34.322900000000004 38.0 34.6 38.0 24.8 38.0 65-69 33.95185 37.8 33.6 38.0 23.4 38.0 70-74 34.096250000000005 38.0 34.0 38.0 24.6 38.0 75-79 34.1583 38.0 34.0 38.0 25.0 38.0 80-84 33.840700000000005 38.0 34.0 38.0 19.2 38.0 85-89 33.858850000000004 38.0 34.0 38.0 22.0 38.0 90-94 33.63785 38.0 34.0 38.0 16.6 38.0 95-99 33.23779999999999 37.6 33.4 38.0 15.0 38.0 100-104 31.962799999999998 36.8 29.6 38.0 15.0 38.0 105-109 31.928050000000002 37.0 30.0 38.0 15.0 38.0 110-114 31.9452 37.0 30.4 38.0 15.0 38.0 115-119 31.70955 36.8 30.2 38.0 15.0 38.0 120-124 31.10145 36.0 28.8 38.0 14.6 38.0 125-129 29.99465 35.4 25.4 38.0 13.4 38.0 130-134 29.6099 35.0 24.4 38.0 13.0 38.0 135-139 28.616999999999997 33.8 22.8 38.0 2.0 38.0 140-144 27.08535 33.0 16.6 38.0 2.0 38.0 145-149 24.6946 32.6 8.6 38.0 2.0 38.0 150-151 18.011625000000002 15.0 2.0 34.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 8.0 4 7.0 5 2.0 6 2.0 7 4.0 8 3.0 9 5.0 10 6.0 11 6.0 12 7.0 13 8.0 14 11.0 15 18.0 16 17.0 17 18.0 18 26.0 19 24.0 20 25.0 21 31.0 22 40.0 23 48.0 24 55.0 25 78.0 26 82.0 27 94.0 28 118.0 29 126.0 30 137.0 31 178.0 32 224.0 33 288.0 34 408.0 35 569.0 36 789.0 37 527.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.65 18.75 14.025000000000002 28.575 2 25.1 23.474999999999998 36.1 15.325 3 20.25 26.674999999999997 32.675 20.4 4 23.325000000000003 35.65 21.95 19.075 5 23.724999999999998 37.0 22.400000000000002 16.875 6 18.6 37.15 25.775 18.475 7 18.8 17.549999999999997 43.225 20.424999999999997 8 20.3 23.375 29.45 26.875 9 21.075 24.075 29.299999999999997 25.55 10-14 23.085 28.549999999999997 27.05 21.315 15-19 23.06 27.18 28.189999999999998 21.57 20-24 22.314999999999998 28.225 28.64 20.82 25-29 22.775000000000002 28.285 28.64 20.3 30-34 22.64 27.575 28.835 20.95 35-39 22.439999999999998 28.275 28.15 21.135 40-44 22.765 27.529999999999998 28.365000000000002 21.34 45-49 22.536126806340317 27.721386069303467 28.576428821441073 21.166058302915143 50-54 22.950655590031026 27.88509658692824 27.915123611250124 21.249124211790612 55-59 23.361066559743385 27.816760224538896 27.79671210906175 21.025461106655975 60-64 23.005 27.315 28.54 21.14 65-69 22.92199007966331 27.476326469261984 28.668770980510043 20.93291247056466 70-74 23.461056849486603 27.563235662409213 28.07412972702229 20.901577761081892 75-79 22.68 27.800000000000004 28.28 21.240000000000002 80-84 23.05230523052305 27.997799779978 27.667766776677666 21.282128212821284 85-89 23.02 27.815 28.189999999999998 20.974999999999998 90-94 23.26 28.685 27.544999999999998 20.51 95-99 23.14 27.800000000000004 28.33 20.73 100-104 23.82 27.155 28.535 20.49 105-109 23.24 27.68 28.265 20.815 110-114 23.59 28.144999999999996 27.794999999999998 20.47 115-119 23.5 27.994999999999997 27.955000000000002 20.549999999999997 120-124 23.365 27.894999999999996 28.23 20.51 125-129 24.169999999999998 27.865000000000002 27.305 20.66 130-134 24.23 27.905 27.605 20.26 135-139 24.135 28.050000000000004 27.200000000000003 20.615 140-144 24.535 27.875 27.400000000000002 20.19 145-149 24.965 27.775 27.615000000000002 19.645000000000003 150-151 25.35 27.6375 26.5625 20.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 1.5 24 3.5 25 5.5 26 5.5 27 8.0 28 9.5 29 14.5 30 23.5 31 27.0 32 35.0 33 43.0 34 56.5 35 72.0 36 89.0 37 106.0 38 136.5 39 173.0 40 201.0 41 214.5 42 235.0 43 270.5 44 264.5 45 259.0 46 257.0 47 231.0 48 224.5 49 206.0 50 159.5 51 139.5 52 125.5 53 99.0 54 73.0 55 57.0 56 47.5 57 32.0 58 20.0 59 15.5 60 13.0 61 10.0 62 8.0 63 6.0 64 2.5 65 0.5 66 1.5 67 2.5 68 1.0 69 2.5 70 3.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.005 50-54 0.09 55-59 0.24 60-64 0.0 65-69 0.20500000000000002 70-74 0.17500000000000002 75-79 0.0 80-84 0.01 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29346454706031 98.375 2 0.5551349987383295 1.0999999999999999 3 0.10093363613424174 0.3 4 0.025233409033560434 0.1 5 0.025233409033560434 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.6625 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.9125000000000001 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.2625000000000002 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.7000000000000002 0.0 0.0 0.0 0.0 118-119 2.0125 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.4625 0.0 0.0 0.0 0.0 124-125 2.7 0.0 0.0 0.0 0.0 126-127 2.9375 0.0 0.0 0.0 0.0 128-129 3.3875 0.0 0.0 0.0 0.0 130-131 3.6500000000000004 0.0 0.0 0.0 0.0 132-133 3.95 0.0 0.0 0.0 0.0 134-135 4.375 0.0 0.0 0.0 0.0 136-137 4.612500000000001 0.0 0.0 0.0 0.0 138-139 4.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCTGA 10 0.0069501684 144.1625 145 >>END_MODULE Read 988018 spots for SRR7230789.sra Written 988018 spots for SRR7230789.sra Read 988018 spots for SRR7230789.sra Written 988018 spots for SRR7230789.sra Read 988018 spots for SRR7230789.sra Written 988018 spots for SRR7230789.sra Read 988018 spots for SRR7230789.sra Written 988018 spots for SRR7230789.sra Read 988018 spots for SRR7230789.sra Written 988018 spots for SRR7230789.sra Read 988018 spots for SRR7230789.sra Written 988018 spots for SRR7230789.sra Read 988018 spots for SRR7230789.sra Written 988018 spots for SRR7230789.sra Read 988018 spots for SRR7230789.sra Written 988018 spots for SRR7230789.sra Read 988018 spots for SRR7230789.sra Written 988018 spots for SRR7230789.sra Read 988018 spots for SRR7230789.sra Written 988018 spots for SRR7230789.sra Read 988018 spots for SRR7230789.sra Written 988018 spots for SRR7230789.sra Read 988029 spots for SRR7230789.sra Written 988029 spots for SRR7230789.sra Read 988018 spots for SRR7230789.sra Written 988018 spots for SRR7230789.sra Read 988018 spots for SRR7230789.sra Written 988018 spots for SRR7230789.sra Read 988018 spots for SRR7230789.sra Written 988018 spots for SRR7230789.sra Read 988018 spots for SRR7230789.sra Written 988018 spots for SRR7230789.sra Read 988018 spots for SRR7230789.sra Written 988018 spots for SRR7230789.sra Read 988018 spots for SRR7230789.sra Written 988018 spots for SRR7230789.sra Read 988018 spots for SRR7230789.sra Written 988018 spots for SRR7230789.sra Read 988018 spots for SRR7230789.sra Written 988018 spots for SRR7230789.sra SRR ids: ['SRR7230789.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kf13uqt5 SRR7230789.sra spots: 19760371 blocks: [[1, 988018], [988019, 1976036], [1976037, 2964054], [2964055, 3952072], [3952073, 4940090], [4940091, 5928108], [5928109, 6916126], [6916127, 7904144], [7904145, 8892162], [8892163, 9880180], [9880181, 10868198], [10868199, 11856216], [11856217, 12844234], [12844235, 13832252], [13832253, 14820270], [14820271, 15808288], [15808289, 16796306], [16796307, 17784324], [17784325, 18772342], [18772343, 19760371]] SRR7230789 file size 6674440 SRR7230789 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230789 SRR7230789_1.fastq SRR7230789_2.fastq Input file: SRR7230789_1.fastq Paired file: SRR7230789_2.fastq trimmed: SRR7230789-trimmed-pair1.fastq, SRR7230789-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 03:57:39 2025 >> started Tue Feb 11 04:02:14 2025 >> done (275.829s) 19760371 read pairs processed; of these: 43904 ( 0.22%) short read pairs filtered out after trimming by size control 44042 ( 0.22%) empty read pairs filtered out after trimming by size control 19672425 (99.55%) read pairs available; of these: 12196511 (62.00%) trimmed read pairs available after processing 7475914 (38.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 8 0.00% 21 8 0.00% 22 7 0.00% 23 11 0.00% 24 6 0.00% 25 9 0.00% 26 4 0.00% 27 6 0.00% 28 14 0.00% 29 13 0.00% 30 13 0.00% 31 13 0.00% 32 10 0.00% 33 17 0.00% 34 16 0.00% 35 20 0.00% 36 22 0.00% 37 22 0.00% 38 17 0.00% 39 24 0.00% 40 38 0.00% 41 33 0.00% 42 40 0.00% 43 48 0.00% 44 41 0.00% 45 51 0.00% 46 64 0.00% 47 69 0.00% 48 81 0.00% 49 86 0.00% 50 102 0.00% 51 130 0.00% 52 122 0.00% 53 149 0.00% 54 167 0.00% 55 173 0.00% 56 208 0.00% 57 217 0.00% 58 213 0.00% 59 228 0.00% 60 223 0.00% 61 358 0.00% 62 397 0.00% 63 425 0.00% 64 454 0.00% 65 529 0.00% 66 588 0.00% 67 622 0.00% 68 717 0.00% 69 943 0.00% 70 1060 0.01% 71 1118 0.01% 72 1265 0.01% 73 1408 0.01% 74 1499 0.01% 75 1738 0.01% 76 1887 0.01% 77 2068 0.01% 78 2372 0.01% 79 2652 0.01% 80 2857 0.01% 81 3292 0.02% 82 3867 0.02% 83 4485 0.02% 84 6540 0.03% 85 8033 0.04% 86 8272 0.04% 87 8701 0.04% 88 8573 0.04% 89 9061 0.05% 90 9599 0.05% 91 10045 0.05% 92 10720 0.05% 93 11685 0.06% 94 12315 0.06% 95 13024 0.07% 96 13708 0.07% 97 14397 0.07% 98 15066 0.08% 99 15837 0.08% 100 16736 0.09% 101 17514 0.09% 102 18639 0.09% 103 19333 0.10% 104 20460 0.10% 105 21684 0.11% 106 23048 0.12% 107 24317 0.12% 108 25178 0.13% 109 26770 0.14% 110 27715 0.14% 111 29658 0.15% 112 31584 0.16% 113 33197 0.17% 114 34628 0.18% 115 36760 0.19% 116 38500 0.20% 117 40569 0.21% 118 42859 0.22% 119 44908 0.23% 120 47326 0.24% 121 49942 0.25% 122 52574 0.27% 123 56537 0.29% 124 59851 0.30% 125 63758 0.32% 126 67595 0.34% 127 71495 0.36% 128 75548 0.38% 129 80529 0.41% 130 86457 0.44% 131 91759 0.47% 132 98162 0.50% 133 105834 0.54% 134 114861 0.58% 135 123909 0.63% 136 135385 0.69% 137 146629 0.75% 138 158140 0.80% 139 171975 0.87% 140 185851 0.94% 141 206530 1.05% 142 232749 1.18% 143 264600 1.35% 144 311771 1.58% 145 380914 1.94% 146 475084 2.41% 147 628782 3.20% 148 877277 4.46% 149 1512276 7.69% 150 4473424 22.74% 151 7475914 38.00% 19672425 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=4.65 fanout-score-rank=6 prefix-density=0.45 prefix-fanout=3.5 sequence=CCATTGCTTGCAATGGAAGTAATGTCATT criterion=fanout-score sequence-density=0.14 sequence-density-rank=21 fanout-score=15.07 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=2.7 sequence=TGCTTGCTTCTTCTAATCCACTGGAGAACTTT criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=17 prefix-density=0.50 prefix-fanout=2.4 sequence=TCCACTTGCACTGCTCGAGAATTGGCCGAGCGAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=38.32 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.8 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT SRR7230789 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 05:10:27 Started mapping on | Feb 11 05:10:30 Finished on | Feb 11 07:33:15 Mapping speed, Million of reads per hour | 8.27 Number of input reads | 19672425 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 18157201 Uniquely mapped reads % | 92.30% Average mapped length | 291.03 Number of splices: Total | 17215774 Number of splices: Annotated (sjdb) | 16760934 Number of splices: GT/AG | 16881868 Number of splices: GC/AG | 257971 Number of splices: AT/AC | 10073 Number of splices: Non-canonical | 65862 Mismatch rate per base, % | 0.51% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 614067 % of reads mapped to multiple loci | 3.12% Number of reads mapped to too many loci | 185388 % of reads mapped to too many loci | 0.94% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.31% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 939631 939631 939631 N_multimapping 614067 614067 614067 N_noFeature 773903 17842668 917857 N_ambiguous 349322 1607 177952 UnstrandedReadsAssigned:17033976 PositiveStrandReadsAssigned:312926 NegativeStrandReadsAssigned:17061392 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7230789 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230789-trimmed-pair1.fastq SRR7230789-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,672,425 reads, 17,154,008 reads pseudoaligned [quant] estimated average fragment length: 252.375 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52401 SRR7230789.ke.tsv 34699 SRR7230789.se.tsv 87100 total ==> SRR7230789.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.63 1534 47.0352 Potri.005G024800.1.v4.1 1035 783.625 238 16.4517 Potri.004G059700.1.v4.1 961 709.689 5 0.381631 Potri.007G009000.2.v4.1 1416 1164.63 0 0 Potri.003G141000.2.v4.1 2943 2691.63 1093.86 22.0135 Potri.016G087400.1.v4.1 270 76.9323 1271 894.909 Potri.015G069301.1.v4.1 564 319.509 0 0 Potri.010G195200.1.v4.1 1773 1521.63 410 14.5955 Potri.012G127500.1.v4.1 977 725.663 103 7.68854 ==> SRR7230789.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 726 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 312 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 223 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 6 SRR7230789 completed mapping pipeline successfully