Starting /dee2/code/volunteer_pipeline.sh SRR7230790 current disk space = 3056966270976 free memory = 1225879716 SRR7230790 SRAfilesize 6eb344ce5edc46ca218e0c93ed4bdce5 SRR7230790.sra SRR7230790.sra file validated SRR7230790 is paired end SRR7230790 is conventional basespace SRR7230790 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230790_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.33575 34.0 33.0 34.0 33.0 34.0 2 33.41575 34.0 33.0 34.0 33.0 34.0 3 33.43 34.0 34.0 34.0 33.0 34.0 4 33.40825 34.0 34.0 34.0 33.0 34.0 5 33.3405 34.0 33.0 34.0 33.0 34.0 6 37.27125 38.0 38.0 38.0 36.0 38.0 7 37.5375 38.0 38.0 38.0 37.0 38.0 8 37.36825 38.0 38.0 38.0 37.0 38.0 9 37.5075 38.0 38.0 38.0 38.0 38.0 10-14 37.5647 38.0 38.0 38.0 38.0 38.0 15-19 37.476 38.0 38.0 38.0 37.6 38.0 20-24 37.58669999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.49635 38.0 38.0 38.0 37.8 38.0 30-34 37.370799999999996 38.0 38.0 38.0 37.4 38.0 35-39 37.31555 38.0 38.0 38.0 37.0 38.0 40-44 36.8908 38.0 38.0 38.0 35.8 38.0 45-49 37.28075 38.0 38.0 38.0 36.8 38.0 50-54 37.306200000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.26655 38.0 38.0 38.0 37.0 38.0 60-64 37.17819999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.20225000000001 38.0 38.0 38.0 36.4 38.0 70-74 31.731650000000002 38.0 26.6 38.0 15.4 38.0 75-79 32.65355 38.0 34.6 38.0 9.2 38.0 80-84 35.15655 38.0 37.4 38.0 29.2 38.0 85-89 36.27435 38.0 38.0 38.0 33.6 38.0 90-94 36.480549999999994 38.0 38.0 38.0 34.4 38.0 95-99 36.639599999999994 38.0 38.0 38.0 35.0 38.0 100-104 36.4833 38.0 38.0 38.0 34.2 38.0 105-109 35.82695 38.0 37.2 38.0 30.2 38.0 110-114 36.02495 38.0 37.2 38.0 32.6 38.0 115-119 35.9772 38.0 37.6 38.0 32.6 38.0 120-124 35.71565 38.0 37.0 38.0 31.4 38.0 125-129 35.070049999999995 38.0 35.6 38.0 27.2 38.0 130-134 35.330799999999996 38.0 36.0 38.0 29.6 38.0 135-139 35.247 38.0 36.0 38.0 30.6 38.0 140-144 35.08905 38.0 35.8 38.0 30.0 38.0 145-149 34.27745 38.0 34.4 38.0 26.6 38.0 150-151 30.70975 35.5 29.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 1.0 15 0.0 16 6.0 17 1.0 18 4.0 19 1.0 20 3.0 21 4.0 22 8.0 23 5.0 24 7.0 25 12.0 26 18.0 27 22.0 28 30.0 29 42.0 30 63.0 31 69.0 32 93.0 33 137.0 34 255.0 35 434.0 36 728.0 37 2054.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.875 15.35 10.424999999999999 37.35 2 21.025 22.125 35.5 21.349999999999998 3 19.0 26.325 26.200000000000003 28.475 4 22.475 35.425000000000004 21.5 20.599999999999998 5 20.95 38.175 23.474999999999998 17.4 6 16.025 37.275000000000006 25.074999999999996 21.625 7 13.0 22.6 44.375 20.025000000000002 8 16.85 22.8 31.2 29.15 9 17.4 21.75 33.875 26.974999999999998 10-14 20.205000000000002 30.11 26.52 23.165 15-19 19.994999999999997 28.23 27.66 24.115000000000002 20-24 20.125 28.175 27.92 23.78 25-29 20.405 28.375 27.715 23.505000000000003 30-34 20.57 28.970000000000002 26.93 23.53 35-39 19.870993549677486 28.186409320466023 27.821391069553474 24.121206060303017 40-44 20.468187274909962 28.9515806322529 27.62104841936775 22.95918367346939 45-49 20.16 28.51 27.685 23.645 50-54 19.935 28.07 27.55 24.445 55-59 20.53 28.439999999999998 27.43 23.599999999999998 60-64 20.03801520608243 28.401360544217685 27.69107643057223 23.86954781912765 65-69 20.455000000000002 28.46 27.644999999999996 23.44 70-74 20.560204556020455 28.539051603905158 27.31287773128777 23.587866108786613 75-79 20.610473256790815 28.238588630635675 27.280873704844584 23.87006440772893 80-84 20.274215410280473 28.25044312376186 28.062767177562296 23.412574288395373 85-89 20.844073793277737 28.117260550922417 27.33383876674248 23.70482688905737 90-94 20.556251566023555 28.859934853420192 27.256326735154097 23.327486845402152 95-99 20.25025025025025 28.68868868868869 27.53253253253253 23.52852852852853 100-104 20.572029653376077 27.9853736726107 27.75495892606692 23.6876377479463 105-109 20.425212606303152 28.21910955477739 27.433716858429214 23.921960980490244 110-114 20.828124218632794 27.889183377506626 27.149072360854127 24.133620043006452 115-119 20.576441102756892 28.275689223057643 27.518796992481203 23.629072681704262 120-124 20.880831617536284 27.9365238788731 27.012504394114394 24.170140109476222 125-129 20.95 28.315 27.134999999999998 23.599999999999998 130-134 21.345 28.29 27.295 23.07 135-139 21.32 28.46 26.445 23.775 140-144 21.237123712371236 28.36283628362836 26.222622262226224 24.17741774177418 145-149 20.657888149001153 28.49847293846693 26.515796325038803 24.327842587493116 150-151 21.09081811358519 28.3087315486615 25.68176132099074 24.91868901676257 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 2.0 19 2.0 20 1.5 21 1.5 22 1.0 23 2.0 24 5.0 25 7.0 26 7.5 27 11.5 28 15.0 29 21.5 30 26.0 31 27.5 32 38.0 33 59.0 34 81.0 35 96.0 36 108.0 37 121.5 38 139.5 39 171.0 40 203.0 41 213.5 42 229.0 43 253.5 44 263.5 45 259.0 46 241.5 47 224.5 48 216.5 49 187.0 50 161.0 51 147.0 52 114.5 53 90.5 54 64.5 55 47.5 56 41.5 57 27.0 58 20.5 59 19.0 60 10.5 61 3.0 62 3.5 63 3.5 64 2.5 65 1.0 66 1.0 67 1.5 68 0.5 69 0.5 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.04 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.04 65-69 0.0 70-74 13.96 75-79 10.725 80-84 4.09 85-89 1.075 90-94 0.22499999999999998 95-99 0.1 100-104 0.18 105-109 0.05 110-114 0.015 115-119 0.25 120-124 0.43499999999999994 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.135 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24357034795764 98.4 2 0.6555723651033787 1.3 3 0.10085728693898136 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.6499999999999999 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.1375000000000002 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.6875 0.0 0.0 0.0 0.0 110-111 1.8875000000000002 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.75 0.0 0.0 0.0 0.0 118-119 3.0 0.0 0.0 0.0 0.0 120-121 3.1875 0.0 0.0 0.0 0.0 122-123 3.6 0.0 0.0 0.0 0.0 124-125 4.25 0.0 0.0 0.0 0.0 126-127 4.7375 0.0 0.0 0.0 0.0 128-129 5.1875 0.0 0.0 0.0 0.0 130-131 5.699999999999999 0.0 0.0 0.0 0.0 132-133 6.3125 0.0 0.0 0.0 0.0 134-135 6.9125 0.0 0.0 0.0 0.0 136-137 7.475 0.0 0.0 0.0 0.0 138-139 8.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTATGGC 10 0.007371881 141.34999 9 TATCGTA 10 0.007371881 141.34999 5 TTATCGT 10 0.007371881 141.34999 4 TATCTAA 10 0.007371881 141.34999 5 CGTATGG 10 0.007371881 141.34999 8 CGTATGC 10 0.007371881 141.34999 145 GTCTTAT 10 0.007371881 141.34999 1 ATCGTAT 10 0.007371881 141.34999 6 >>END_MODULE SRR7230790 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230790_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.46025 33.0 33.0 34.0 32.0 34.0 2 32.95625 34.0 33.0 34.0 32.0 34.0 3 32.9955 34.0 33.0 34.0 32.0 34.0 4 32.975 34.0 33.0 34.0 32.0 34.0 5 33.01075 34.0 33.0 34.0 33.0 34.0 6 37.0935 38.0 38.0 38.0 37.0 38.0 7 37.0285 38.0 38.0 38.0 37.0 38.0 8 36.992 38.0 38.0 38.0 37.0 38.0 9 36.89175 38.0 38.0 38.0 37.0 38.0 10-14 36.77499999999999 38.0 38.0 38.0 35.8 38.0 15-19 37.048 38.0 38.0 38.0 37.0 38.0 20-24 36.9553 38.0 38.0 38.0 36.8 38.0 25-29 36.90415 38.0 38.0 38.0 36.8 38.0 30-34 36.884 38.0 38.0 38.0 36.6 38.0 35-39 36.60855 38.0 38.0 38.0 35.6 38.0 40-44 36.38565 38.0 38.0 38.0 34.4 38.0 45-49 36.630849999999995 38.0 38.0 38.0 35.4 38.0 50-54 36.64025 38.0 38.0 38.0 35.4 38.0 55-59 36.6131 38.0 38.0 38.0 35.4 38.0 60-64 36.650349999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.7082 38.0 38.0 38.0 35.8 38.0 70-74 36.6237 38.0 38.0 38.0 35.8 38.0 75-79 36.611450000000005 38.0 38.0 38.0 35.6 38.0 80-84 36.5447 38.0 38.0 38.0 35.0 38.0 85-89 36.5027 38.0 38.0 38.0 35.4 38.0 90-94 36.32995 38.0 38.0 38.0 34.4 38.0 95-99 36.215599999999995 38.0 38.0 38.0 34.0 38.0 100-104 35.53625 38.0 37.2 38.0 30.6 38.0 105-109 35.86785 38.0 38.0 38.0 33.2 38.0 110-114 35.950300000000006 38.0 38.0 38.0 33.4 38.0 115-119 35.91725 38.0 38.0 38.0 33.6 38.0 120-124 35.55155 38.0 37.4 38.0 31.4 38.0 125-129 35.11915 38.0 36.6 38.0 29.0 38.0 130-134 34.98265 38.0 36.0 38.0 28.4 38.0 135-139 34.69545 38.0 36.0 38.0 27.2 38.0 140-144 34.29709999999999 38.0 35.2 38.0 25.2 38.0 145-149 33.6042 38.0 34.0 38.0 20.8 38.0 150-151 28.95675 35.5 18.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 3.0 4 5.0 5 6.0 6 1.0 7 0.0 8 0.0 9 3.0 10 0.0 11 5.0 12 4.0 13 4.0 14 4.0 15 3.0 16 4.0 17 8.0 18 1.0 19 4.0 20 6.0 21 15.0 22 20.0 23 9.0 24 16.0 25 17.0 26 19.0 27 22.0 28 27.0 29 36.0 30 46.0 31 58.0 32 54.0 33 92.0 34 150.0 35 216.0 36 487.0 37 2644.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.17237877633917 18.075653719218078 14.03909621731404 28.71287128712871 2 24.925 25.95 32.85 16.275000000000002 3 20.775 27.825 30.625000000000004 20.775 4 23.5 35.4 22.15 18.95 5 22.95 37.675 20.724999999999998 18.65 6 19.0 37.824999999999996 23.925 19.25 7 19.175 19.2 40.825 20.8 8 20.7 23.7 28.425 27.175 9 21.975 23.599999999999998 30.5 23.925 10-14 23.17781337605126 27.90348418101722 26.907288746495794 22.01141369643572 15-19 23.055 28.735 27.105 21.105 20-24 22.812812812812812 28.048048048048045 28.10810810810811 21.03103103103103 25-29 22.939910942112373 27.993195577125128 27.97818582078351 21.088707659978986 30-34 22.570956600090103 28.2124443109576 27.94213345347149 21.2744656354808 35-39 22.821680596566736 27.656273459786796 28.40198188278865 21.120064060857814 40-44 23.136607098162887 27.30139660609701 28.13735796165591 21.424638334084197 45-49 22.823800460783332 27.937493739356906 28.443353701292196 20.795352098567566 50-54 22.321831021184956 28.066309410527367 27.71072269244253 21.901136875845147 55-59 23.023383906664662 27.089279455210054 28.27600020029042 21.61133643783486 60-64 22.856713878184276 27.13577899004054 28.612181572493867 21.395325559281318 65-69 22.71293375394322 27.800310450152722 28.250963897651594 21.235791898252465 70-74 23.179702747335234 27.273182204874143 28.128909573137168 21.41820547465346 75-79 22.572402044293018 27.73825032568394 28.109028960817717 21.58031866920533 80-84 22.96796796796797 28.363363363363366 27.52752752752753 21.14114114114114 85-89 23.80331812941707 27.522429953385796 27.677810636058343 20.99644128113879 90-94 23.27003056571629 28.02024352357569 28.01022197725109 20.699503933456935 95-99 23.220449202140962 27.372317542894304 28.117652943824723 21.289580311140014 100-104 23.659463785514205 28.276310524209684 27.490996398559425 20.573229291716686 105-109 23.479087452471482 28.231939163498097 27.41144686812087 20.877526515909544 110-114 23.845 27.82 27.79 20.544999999999998 115-119 24.175 28.38 27.700000000000003 19.744999999999997 120-124 24.56473884330598 27.9467680608365 26.85111066639984 20.637382429457674 125-129 24.237568230757674 27.868195703340177 27.89323451349592 20.00100155240623 130-134 24.902490249024904 27.61776177617762 27.26772677267727 20.212021202120212 135-139 24.731129008053625 26.967135210844877 28.02261017457856 20.279125606522935 140-144 25.499524262607043 27.622815363813913 26.98682958585808 19.89083078772097 145-149 25.12256128064032 28.044022011005502 27.008504252126066 19.824912456228112 150-151 25.75965987245217 28.09803676378642 26.73502563461298 19.407277729148433 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.5 22 0.5 23 1.0 24 4.0 25 6.5 26 4.5 27 5.0 28 12.5 29 15.5 30 15.0 31 21.5 32 28.5 33 38.5 34 52.0 35 63.5 36 83.0 37 110.5 38 134.5 39 156.5 40 187.5 41 227.5 42 238.0 43 239.0 44 265.5 45 272.0 46 261.0 47 250.0 48 231.0 49 197.5 50 167.0 51 143.0 52 123.0 53 98.0 54 83.0 55 69.5 56 49.0 57 47.0 58 38.0 59 22.0 60 11.5 61 7.0 62 3.0 63 1.5 64 1.0 65 0.0 66 0.0 67 1.5 68 2.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.12 15-19 0.0 20-24 0.1 25-29 0.065 30-34 0.11499999999999999 35-39 0.095 40-44 0.11499999999999999 45-49 0.16999999999999998 50-54 0.165 55-59 0.145 60-64 0.095 65-69 0.145 70-74 0.08499999999999999 75-79 0.21 80-84 0.1 85-89 0.245 90-94 0.215 95-99 0.045 100-104 0.04 105-109 0.06 110-114 0.0 115-119 0.0 120-124 0.06 125-129 0.155 130-134 0.01 135-139 0.045 140-144 0.155 145-149 0.05 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24357034795764 98.4 2 0.7060010085728694 1.4000000000000001 3 0.02521432173474534 0.075 4 0.0 0.0 5 0.02521432173474534 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.48750000000000004 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.45 0.0 0.0 0.0 0.0 108-109 1.7375 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.0875 0.0 0.0 0.0 0.0 114-115 2.4125 0.0 0.0 0.0 0.0 116-117 2.8125 0.0 0.0 0.0 0.0 118-119 3.0250000000000004 0.0 0.0 0.0 0.0 120-121 3.2249999999999996 0.0 0.0 0.0 0.0 122-123 3.625 0.0 0.0 0.0 0.0 124-125 4.2375 0.0 0.0 0.0 0.0 126-127 4.75 0.0 0.0 0.0 0.0 128-129 5.2375 0.0 0.0 0.0 0.0 130-131 5.7625 0.0 0.0 0.0 0.0 132-133 6.387499999999999 0.0 0.0 0.0 0.0 134-135 6.9625 0.0 0.0 0.0 0.0 136-137 7.55 0.0 0.0 0.0 0.0 138-139 8.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGTCC 10 0.006553726 146.97437 7 GTCGCCG 10 0.007075994 143.3 145 >>END_MODULE Read 774029 spots for SRR7230790.sra Written 774029 spots for SRR7230790.sra Read 774029 spots for SRR7230790.sra Written 774029 spots for SRR7230790.sra Read 774029 spots for SRR7230790.sra Written 774029 spots for SRR7230790.sra Read 774038 spots for SRR7230790.sra Written 774038 spots for SRR7230790.sra Read 774029 spots for SRR7230790.sra Written 774029 spots for SRR7230790.sra Read 774029 spots for SRR7230790.sra Written 774029 spots for SRR7230790.sra Read 774029 spots for SRR7230790.sra Written 774029 spots for SRR7230790.sra Read 774029 spots for SRR7230790.sra Written 774029 spots for SRR7230790.sra Read 774029 spots for SRR7230790.sra Written 774029 spots for SRR7230790.sra Read 774029 spots for SRR7230790.sra Written 774029 spots for SRR7230790.sra Read 774029 spots for SRR7230790.sra Written 774029 spots for SRR7230790.sra Read 774029 spots for SRR7230790.sra Written 774029 spots for SRR7230790.sra Read 774029 spots for SRR7230790.sra Written 774029 spots for SRR7230790.sra Read 774029 spots for SRR7230790.sra Written 774029 spots for SRR7230790.sra Read 774029 spots for SRR7230790.sra Written 774029 spots for SRR7230790.sra Read 774029 spots for SRR7230790.sra Written 774029 spots for SRR7230790.sra Read 774029 spots for SRR7230790.sra Written 774029 spots for SRR7230790.sra Read 774029 spots for SRR7230790.sra Written 774029 spots for SRR7230790.sra Read 774029 spots for SRR7230790.sra Written 774029 spots for SRR7230790.sra Read 774029 spots for SRR7230790.sra Written 774029 spots for SRR7230790.sra SRR ids: ['SRR7230790.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o2zwgqs3 SRR7230790.sra spots: 15480589 blocks: [[1, 774029], [774030, 1548058], [1548059, 2322087], [2322088, 3096116], [3096117, 3870145], [3870146, 4644174], [4644175, 5418203], [5418204, 6192232], [6192233, 6966261], [6966262, 7740290], [7740291, 8514319], [8514320, 9288348], [9288349, 10062377], [10062378, 10836406], [10836407, 11610435], [11610436, 12384464], [12384465, 13158493], [13158494, 13932522], [13932523, 14706551], [14706552, 15480589]] SRR7230790 file size 5224163 SRR7230790 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230790 SRR7230790_1.fastq SRR7230790_2.fastq Input file: SRR7230790_1.fastq Paired file: SRR7230790_2.fastq trimmed: SRR7230790-trimmed-pair1.fastq, SRR7230790-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 03:17:09 2025 >> started Tue Feb 11 03:21:20 2025 >> done (251.614s) 15480589 read pairs processed; of these: 14592 ( 0.09%) short read pairs filtered out after trimming by size control 11725 ( 0.08%) empty read pairs filtered out after trimming by size control 15454272 (99.83%) read pairs available; of these: 7218408 (46.71%) trimmed read pairs available after processing 8235864 (53.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 2 0.00% 21 1 0.00% 22 8 0.00% 23 5 0.00% 24 4 0.00% 25 8 0.00% 26 4 0.00% 27 3 0.00% 28 6 0.00% 29 2 0.00% 30 8 0.00% 31 8 0.00% 32 2 0.00% 33 4 0.00% 34 7 0.00% 35 13 0.00% 36 10 0.00% 37 15 0.00% 38 14 0.00% 39 10 0.00% 40 16 0.00% 41 21 0.00% 42 19 0.00% 43 37 0.00% 44 29 0.00% 45 32 0.00% 46 52 0.00% 47 26 0.00% 48 60 0.00% 49 52 0.00% 50 69 0.00% 51 84 0.00% 52 81 0.00% 53 96 0.00% 54 93 0.00% 55 111 0.00% 56 114 0.00% 57 140 0.00% 58 160 0.00% 59 201 0.00% 60 209 0.00% 61 246 0.00% 62 275 0.00% 63 298 0.00% 64 354 0.00% 65 376 0.00% 66 417 0.00% 67 530 0.00% 68 694 0.00% 69 1051 0.01% 70 959 0.01% 71 810 0.01% 72 926 0.01% 73 976 0.01% 74 1213 0.01% 75 1285 0.01% 76 1480 0.01% 77 1633 0.01% 78 1774 0.01% 79 1973 0.01% 80 2358 0.02% 81 2562 0.02% 82 3026 0.02% 83 3308 0.02% 84 4539 0.03% 85 5105 0.03% 86 5330 0.03% 87 5776 0.04% 88 6194 0.04% 89 6760 0.04% 90 7192 0.05% 91 7697 0.05% 92 8288 0.05% 93 9002 0.06% 94 9631 0.06% 95 10456 0.07% 96 11067 0.07% 97 11774 0.08% 98 12575 0.08% 99 13363 0.09% 100 14003 0.09% 101 14917 0.10% 102 16030 0.10% 103 16678 0.11% 104 17769 0.11% 105 18862 0.12% 106 19890 0.13% 107 20645 0.13% 108 21840 0.14% 109 22898 0.15% 110 24179 0.16% 111 25363 0.16% 112 26171 0.17% 113 27477 0.18% 114 28937 0.19% 115 29698 0.19% 116 31374 0.20% 117 32414 0.21% 118 33728 0.22% 119 35291 0.23% 120 36451 0.24% 121 37746 0.24% 122 39329 0.25% 123 41467 0.27% 124 42699 0.28% 125 43868 0.28% 126 46119 0.30% 127 47514 0.31% 128 49206 0.32% 129 51382 0.33% 130 53087 0.34% 131 54620 0.35% 132 57763 0.37% 133 60616 0.39% 134 63695 0.41% 135 66677 0.43% 136 69552 0.45% 137 73056 0.47% 138 77490 0.50% 139 81651 0.53% 140 85668 0.55% 141 91454 0.59% 142 98749 0.64% 143 111133 0.72% 144 126056 0.82% 145 146074 0.95% 146 182540 1.18% 147 229444 1.48% 148 355400 2.30% 149 660654 4.27% 150 3393968 21.96% 151 8235864 53.29% 15454272 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=13 prefix-density=0.58 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=22 fanout-score=8.23 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=2.0 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCAC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=18 prefix-density=0.65 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=47.89 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.5 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGA SRR7230790 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 04:12:36 Started mapping on | Feb 11 04:12:50 Finished on | Feb 11 06:07:22 Mapping speed, Million of reads per hour | 8.10 Number of input reads | 15454272 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14490207 Uniquely mapped reads % | 93.76% Average mapped length | 293.11 Number of splices: Total | 14410151 Number of splices: Annotated (sjdb) | 14100606 Number of splices: GT/AG | 14128681 Number of splices: GC/AG | 236026 Number of splices: AT/AC | 7403 Number of splices: Non-canonical | 38041 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.02% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 391548 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 90039 % of reads mapped to too many loci | 0.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.95% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 588370 588370 588370 N_multimapping 391548 391548 391548 N_noFeature 538957 14253813 640386 N_ambiguous 233756 927 98149 UnstrandedReadsAssigned:13717494 PositiveStrandReadsAssigned:235467 NegativeStrandReadsAssigned:13751672 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7230790 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230790-trimmed-pair1.fastq SRR7230790-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,454,272 reads, 13,819,230 reads pseudoaligned [quant] estimated average fragment length: 237.536 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 974 rounds 52401 SRR7230790.ke.tsv 34699 SRR7230790.se.tsv 87100 total ==> SRR7230790.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.46 481 18.1309 Potri.005G024800.1.v4.1 1035 798.464 155 13.0355 Potri.004G059700.1.v4.1 961 724.518 6 0.556099 Potri.007G009000.2.v4.1 1416 1179.46 0 0 Potri.003G141000.2.v4.1 2943 2706.46 1021.09 25.3346 Potri.016G087400.1.v4.1 270 84.9458 687.816 543.727 Potri.015G069301.1.v4.1 564 333.925 0 0 Potri.010G195200.1.v4.1 1773 1536.46 10 0.437047 Potri.012G127500.1.v4.1 977 740.505 41 3.71797 ==> SRR7230790.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 141 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 198 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 16 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7230790 completed mapping pipeline successfully