Starting /dee2/code/volunteer_pipeline.sh SRR7230791 current disk space = 3055492739072 free memory = 1567847372 SRR7230791 SRAfilesize 35f8a0f26329dbca00885a7610db3068 SRR7230791.sra SRR7230791.sra file validated SRR7230791 is paired end SRR7230791 is conventional basespace SRR7230791 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230791_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7295 33.0 33.0 34.0 32.0 34.0 2 33.13125 34.0 33.0 34.0 32.0 34.0 3 33.29325 34.0 33.0 34.0 33.0 34.0 4 33.36475 34.0 33.0 34.0 33.0 34.0 5 31.90125 34.0 33.0 34.0 27.0 34.0 6 36.52075 38.0 37.0 38.0 33.0 38.0 7 37.20475 38.0 38.0 38.0 36.0 38.0 8 37.4785 38.0 38.0 38.0 37.0 38.0 9 37.41825 38.0 38.0 38.0 37.0 38.0 10-14 37.4393 38.0 38.0 38.0 37.6 38.0 15-19 37.447700000000005 38.0 38.0 38.0 38.0 38.0 20-24 36.95395 38.0 38.0 38.0 35.8 38.0 25-29 37.28340000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.313 38.0 38.0 38.0 37.0 38.0 35-39 37.075149999999994 38.0 38.0 38.0 36.4 38.0 40-44 36.72855 38.0 38.0 38.0 35.2 38.0 45-49 37.19070000000001 38.0 38.0 38.0 36.8 38.0 50-54 37.17285 38.0 38.0 38.0 36.8 38.0 55-59 37.089 38.0 38.0 38.0 36.4 38.0 60-64 37.099000000000004 38.0 38.0 38.0 36.2 38.0 65-69 37.123599999999996 38.0 38.0 38.0 36.4 38.0 70-74 30.2127 38.0 19.0 38.0 15.6 38.0 75-79 31.32 38.0 30.8 38.0 7.2 38.0 80-84 34.83965 38.0 37.2 38.0 27.6 38.0 85-89 36.160199999999996 38.0 38.0 38.0 33.4 38.0 90-94 36.43715 38.0 38.0 38.0 33.8 38.0 95-99 36.431 38.0 38.0 38.0 34.0 38.0 100-104 36.4374 38.0 38.0 38.0 34.0 38.0 105-109 36.49865 38.0 38.0 38.0 34.2 38.0 110-114 36.31195 38.0 38.0 38.0 34.0 38.0 115-119 36.056149999999995 38.0 37.2 38.0 33.4 38.0 120-124 35.53745 38.0 36.6 38.0 30.0 38.0 125-129 35.19695 38.0 36.0 38.0 28.2 38.0 130-134 35.174099999999996 38.0 36.0 38.0 28.6 38.0 135-139 35.141949999999994 38.0 36.0 38.0 29.2 38.0 140-144 34.536950000000004 38.0 35.2 38.0 26.2 38.0 145-149 33.9317 38.0 33.6 38.0 24.2 38.0 150-151 29.868875000000003 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 2.0 10 0.0 11 1.0 12 2.0 13 1.0 14 3.0 15 0.0 16 3.0 17 1.0 18 6.0 19 0.0 20 2.0 21 0.0 22 9.0 23 11.0 24 10.0 25 16.0 26 29.0 27 18.0 28 31.0 29 51.0 30 58.0 31 71.0 32 117.0 33 199.0 34 266.0 35 440.0 36 826.0 37 1826.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.98449612403101 15.65391347836959 11.077769442360589 35.28382095523881 2 22.775000000000002 21.05 33.7 22.475 3 17.7 27.85 27.775 26.674999999999997 4 22.825 33.0 22.025 22.15 5 20.599999999999998 37.2 23.525 18.675 6 17.775 35.449999999999996 25.75 21.025 7 14.075 22.175 44.5 19.25 8 17.75 22.5 30.55 29.2 9 17.8 23.575 32.6 26.025 10-14 20.145 29.744999999999997 26.05 24.060000000000002 15-19 20.206010300515025 28.651432571628582 27.60138006900345 23.541177058852945 20-24 20.32 28.24 27.855 23.585 25-29 20.06200620062006 28.62786278627863 27.96779677967797 23.342334233423344 30-34 19.295 28.610000000000003 28.035 24.060000000000002 35-39 19.895 28.32 28.16 23.625 40-44 20.016008804842663 28.61573865626094 27.830306668667763 23.537945870228626 45-49 19.755 28.825 27.495000000000005 23.925 50-54 19.890967290187056 28.858657597279187 27.843353005901772 23.407022106631988 55-59 20.135135135135133 28.548548548548546 27.91791791791792 23.3983983983984 60-64 20.095095095095093 29.074074074074076 27.47247247247247 23.35835835835836 65-69 20.08008008008008 28.583583583583582 27.36736736736737 23.96896896896897 70-74 20.109722645534898 28.594940566900334 27.875647668393782 23.419689119170982 75-79 19.474381880006916 29.110714079880122 27.779378710160795 23.635525329952163 80-84 20.364169108413563 28.08706571787359 28.113227291753873 23.43553788195898 85-89 20.571486166406288 28.49871491205967 27.702464345109107 23.227334576424933 90-94 20.29 28.32 27.785 23.605 95-99 20.54 28.095 27.639999999999997 23.724999999999998 100-104 20.835 28.485 27.72 22.96 105-109 20.66 28.215 27.99 23.135 110-114 20.979999999999997 28.67 27.200000000000003 23.150000000000002 115-119 20.835 28.645 27.084999999999997 23.435 120-124 20.62 28.605000000000004 27.045 23.73 125-129 20.46 28.73 27.55 23.26 130-134 21.310000000000002 28.599999999999998 26.85 23.24 135-139 20.75 28.645 27.77 22.835 140-144 20.885 28.444999999999997 26.729999999999997 23.94 145-149 21.055 28.744999999999997 26.68 23.52 150-151 21.987499999999997 28.475 25.912499999999998 23.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 1.0 21 1.5 22 3.0 23 3.5 24 3.5 25 5.0 26 5.5 27 12.0 28 22.5 29 25.0 30 29.0 31 40.0 32 47.0 33 55.0 34 69.0 35 87.0 36 112.5 37 139.0 38 158.5 39 198.5 40 225.5 41 235.0 42 242.5 43 242.0 44 252.0 45 260.5 46 241.0 47 222.5 48 206.0 49 161.5 50 142.5 51 130.5 52 101.0 53 77.0 54 69.0 55 53.0 56 30.0 57 24.5 58 18.0 59 11.0 60 8.5 61 8.0 62 7.0 63 4.5 64 2.0 65 0.5 66 1.0 67 0.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.01 30-34 0.0 35-39 0.0 40-44 0.055 45-49 0.0 50-54 0.03 55-59 0.1 60-64 0.1 65-69 0.1 70-74 17.974999999999998 75-79 13.245000000000001 80-84 4.44 85-89 0.7849999999999999 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.07500000000000001 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.7250000000000001 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.1375 0.0 0.0 0.0 0.0 110-111 1.2875 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.5750000000000002 0.0 0.0 0.0 0.0 116-117 1.775 0.0 0.0 0.0 0.0 118-119 1.95 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.55 0.0 0.0 0.0 0.0 124-125 2.9875 0.0 0.0 0.0 0.0 126-127 3.2874999999999996 0.0 0.0 0.0 0.0 128-129 3.7874999999999996 0.0 0.0 0.0 0.0 130-131 4.199999999999999 0.0 0.0 0.0 0.0 132-133 4.6 0.0 0.0 0.0 0.0 134-135 5.075 0.0 0.0 0.0 0.0 136-137 5.4125 0.0 0.0 0.0 0.0 138-139 5.800000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACAAGT 10 0.0074208234 141.0375 3 >>END_MODULE SRR7230791 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230791_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.789 33.0 33.0 34.0 32.0 34.0 2 32.93225 34.0 33.0 34.0 32.0 34.0 3 32.924 34.0 33.0 34.0 32.0 34.0 4 32.91125 34.0 33.0 34.0 32.0 34.0 5 32.528 34.0 33.0 34.0 32.0 34.0 6 36.65875 38.0 38.0 38.0 35.0 38.0 7 36.6755 38.0 38.0 38.0 35.0 38.0 8 36.8385 38.0 38.0 38.0 36.0 38.0 9 36.77225 38.0 38.0 38.0 36.0 38.0 10-14 36.50075 38.0 38.0 38.0 34.2 38.0 15-19 36.97135 38.0 38.0 38.0 36.6 38.0 20-24 36.8333 38.0 38.0 38.0 36.0 38.0 25-29 36.51965 38.0 38.0 38.0 35.0 38.0 30-34 36.7202 38.0 38.0 38.0 35.8 38.0 35-39 36.394 38.0 38.0 38.0 34.4 38.0 40-44 36.08584999999999 38.0 38.0 38.0 32.2 38.0 45-49 36.546 38.0 38.0 38.0 35.0 38.0 50-54 36.650150000000004 38.0 38.0 38.0 35.6 38.0 55-59 36.6151 38.0 38.0 38.0 35.4 38.0 60-64 36.40445 38.0 38.0 38.0 34.0 38.0 65-69 36.13805 38.0 37.8 38.0 33.0 38.0 70-74 36.38845 38.0 38.0 38.0 34.4 38.0 75-79 36.4434 38.0 38.0 38.0 34.4 38.0 80-84 36.32745 38.0 38.0 38.0 34.0 38.0 85-89 36.4253 38.0 38.0 38.0 34.6 38.0 90-94 36.36385 38.0 38.0 38.0 34.6 38.0 95-99 36.071450000000006 38.0 38.0 38.0 33.6 38.0 100-104 35.448150000000005 38.0 37.0 38.0 29.6 38.0 105-109 35.51245 38.0 37.2 38.0 29.8 38.0 110-114 35.6947 38.0 37.6 38.0 31.8 38.0 115-119 35.7337 38.0 38.0 38.0 32.8 38.0 120-124 35.419000000000004 38.0 37.0 38.0 30.6 38.0 125-129 34.9273 38.0 36.2 38.0 27.8 38.0 130-134 34.93755 38.0 36.0 38.0 27.8 38.0 135-139 34.61095 38.0 36.0 38.0 27.2 38.0 140-144 33.98345 38.0 34.8 38.0 23.0 38.0 145-149 33.049549999999996 38.0 33.0 38.0 15.4 38.0 150-151 26.171125 34.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 5.0 4 4.0 5 2.0 6 3.0 7 4.0 8 1.0 9 1.0 10 5.0 11 1.0 12 5.0 13 4.0 14 9.0 15 4.0 16 5.0 17 7.0 18 5.0 19 5.0 20 13.0 21 4.0 22 8.0 23 18.0 24 18.0 25 20.0 26 27.0 27 28.0 28 40.0 29 44.0 30 47.0 31 72.0 32 74.0 33 117.0 34 149.0 35 260.0 36 542.0 37 2445.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.75 19.35 14.475 26.424999999999997 2 25.2 24.975 33.550000000000004 16.275000000000002 3 20.474999999999998 26.85 32.05 20.625 4 23.474999999999998 35.199999999999996 23.375 17.95 5 24.325 35.199999999999996 22.3 18.175 6 18.775 37.1 23.849999999999998 20.275000000000002 7 18.099999999999998 19.1 42.725 20.075000000000003 8 20.4 23.525 28.000000000000004 28.075 9 21.675 23.05 30.5 24.775 10-14 23.005 28.07 27.49 21.435000000000002 15-19 22.975 27.339999999999996 28.444999999999997 21.240000000000002 20-24 22.685 28.139999999999997 27.79 21.385 25-29 23.044999999999998 28.125 28.07 20.76 30-34 22.735 27.805000000000003 28.560000000000002 20.9 35-39 22.085 28.115000000000002 28.389999999999997 21.41 40-44 22.84 27.725 28.634999999999998 20.8 45-49 22.988448267240084 27.98419762964445 28.029204380657095 20.99814972245837 50-54 23.00265145830207 27.745259892941114 28.075441492821053 21.176647155935765 55-59 23.438673811789453 27.59553262883758 27.750788801522514 21.21500475785045 60-64 22.682268226822682 27.987798779877988 28.01780178017802 21.31213121312131 65-69 23.665765495143688 27.756082907780115 27.605887653950134 20.972263943126062 70-74 23.120432475723295 27.440184202622888 27.755531084192615 21.683852237461206 75-79 23.03 27.325 28.34 21.305 80-84 22.76455291058212 27.955591118223644 28.100620124024804 21.179235847169434 85-89 22.955000000000002 27.72 28.29 21.035 90-94 23.01 28.075 28.134999999999998 20.78 95-99 23.150000000000002 27.965 27.765 21.12 100-104 23.46 27.73 28.365000000000002 20.445 105-109 23.09 28.22 28.375 20.315 110-114 23.44 28.015 28.144999999999996 20.4 115-119 23.645 28.139999999999997 27.85 20.365 120-124 23.494999999999997 27.855 28.410000000000004 20.24 125-129 23.48 27.55 28.349999999999998 20.62 130-134 23.71 28.110000000000003 27.725 20.455000000000002 135-139 24.165 27.515 27.72 20.599999999999998 140-144 24.25 27.855 27.529999999999998 20.365 145-149 24.435000000000002 28.000000000000004 27.405 20.16 150-151 25.025 28.549999999999997 26.575 19.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 0.5 17 1.0 18 1.0 19 1.0 20 1.0 21 0.5 22 0.0 23 1.5 24 3.0 25 3.5 26 5.5 27 6.5 28 8.5 29 13.0 30 14.5 31 20.5 32 23.0 33 32.0 34 56.5 35 67.5 36 88.5 37 113.0 38 137.5 39 166.0 40 186.5 41 220.5 42 243.0 43 251.5 44 278.0 45 293.0 46 262.0 47 242.5 48 240.0 49 197.0 50 156.5 51 138.5 52 115.5 53 98.0 54 79.0 55 55.5 56 43.0 57 37.5 58 28.5 59 19.5 60 15.0 61 9.5 62 7.5 63 6.5 64 2.5 65 2.0 66 1.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.015 50-54 0.055 55-59 0.165 60-64 0.01 65-69 0.13 70-74 0.11 75-79 0.0 80-84 0.02 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29471032745592 98.55000000000001 2 0.654911838790932 1.3 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.1375 0.0 0.0 0.0 0.0 110-111 1.3 0.0 0.0 0.0 0.0 112-113 1.425 0.0 0.0 0.0 0.0 114-115 1.6124999999999998 0.0 0.0 0.0 0.0 116-117 1.825 0.0 0.0 0.0 0.0 118-119 1.975 0.0 0.0 0.0 0.0 120-121 2.2 0.0 0.0 0.0 0.0 122-123 2.5625 0.0 0.0 0.0 0.0 124-125 3.0 0.0 0.0 0.0 0.0 126-127 3.3625 0.0 0.0 0.0 0.0 128-129 3.8625 0.0 0.0 0.0 0.0 130-131 4.3125 0.0 0.0 0.0 0.0 132-133 4.725 0.0 0.0 0.0 0.0 134-135 5.1875 0.0 0.0 0.0 0.0 136-137 5.512499999999999 0.0 0.0 0.0 0.0 138-139 5.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAACAA 10 0.006830828 145.0 1 TGAGAGC 10 0.006830828 145.0 8 >>END_MODULE Read 1106262 spots for SRR7230791.sra Written 1106262 spots for SRR7230791.sra Read 1106262 spots for SRR7230791.sra Written 1106262 spots for SRR7230791.sra Read 1106262 spots for SRR7230791.sra Written 1106262 spots for SRR7230791.sra Read 1106262 spots for SRR7230791.sra Written 1106262 spots for SRR7230791.sra Read 1106262 spots for SRR7230791.sra Written 1106262 spots for SRR7230791.sra Read 1106262 spots for SRR7230791.sra Written 1106262 spots for SRR7230791.sra Read 1106262 spots for SRR7230791.sra Written 1106262 spots for SRR7230791.sra Read 1106262 spots for SRR7230791.sra Written 1106262 spots for SRR7230791.sra Read 1106262 spots for SRR7230791.sra Written 1106262 spots for SRR7230791.sra Read 1106262 spots for SRR7230791.sra Written 1106262 spots for SRR7230791.sra Read 1106262 spots for SRR7230791.sra Written 1106262 spots for SRR7230791.sra Read 1106277 spots for SRR7230791.sra Written 1106277 spots for SRR7230791.sra Read 1106262 spots for SRR7230791.sra Written 1106262 spots for SRR7230791.sra Read 1106262 spots for SRR7230791.sra Written 1106262 spots for SRR7230791.sra Read 1106262 spots for SRR7230791.sra Written 1106262 spots for SRR7230791.sra Read 1106262 spots for SRR7230791.sra Written 1106262 spots for SRR7230791.sra Read 1106262 spots for SRR7230791.sra Written 1106262 spots for SRR7230791.sra Read 1106262 spots for SRR7230791.sra Written 1106262 spots for SRR7230791.sra Read 1106262 spots for SRR7230791.sra Written 1106262 spots for SRR7230791.sra Read 1106262 spots for SRR7230791.sra Written 1106262 spots for SRR7230791.sra SRR ids: ['SRR7230791.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2fbq6uqc SRR7230791.sra spots: 22125255 blocks: [[1, 1106262], [1106263, 2212524], [2212525, 3318786], [3318787, 4425048], [4425049, 5531310], [5531311, 6637572], [6637573, 7743834], [7743835, 8850096], [8850097, 9956358], [9956359, 11062620], [11062621, 12168882], [12168883, 13275144], [13275145, 14381406], [14381407, 15487668], [15487669, 16593930], [16593931, 17700192], [17700193, 18806454], [18806455, 19912716], [19912717, 21018978], [21018979, 22125255]] SRR7230791 file size 7475822 SRR7230791 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230791 SRR7230791_1.fastq SRR7230791_2.fastq Input file: SRR7230791_1.fastq Paired file: SRR7230791_2.fastq trimmed: SRR7230791-trimmed-pair1.fastq, SRR7230791-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 05:44:18 2025 >> started Tue Feb 11 05:51:19 2025 >> done (421.042s) 22125255 read pairs processed; of these: 28501 ( 0.13%) short read pairs filtered out after trimming by size control 23800 ( 0.11%) empty read pairs filtered out after trimming by size control 22072954 (99.76%) read pairs available; of these: 9899038 (44.85%) trimmed read pairs available after processing 12173916 (55.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 2 0.00% 20 9 0.00% 21 5 0.00% 22 3 0.00% 23 8 0.00% 24 6 0.00% 25 3 0.00% 26 11 0.00% 27 7 0.00% 28 5 0.00% 29 10 0.00% 30 8 0.00% 31 16 0.00% 32 7 0.00% 33 14 0.00% 34 13 0.00% 35 15 0.00% 36 6 0.00% 37 16 0.00% 38 15 0.00% 39 26 0.00% 40 34 0.00% 41 25 0.00% 42 30 0.00% 43 41 0.00% 44 33 0.00% 45 41 0.00% 46 40 0.00% 47 45 0.00% 48 64 0.00% 49 78 0.00% 50 89 0.00% 51 99 0.00% 52 120 0.00% 53 118 0.00% 54 116 0.00% 55 155 0.00% 56 162 0.00% 57 184 0.00% 58 205 0.00% 59 265 0.00% 60 281 0.00% 61 292 0.00% 62 349 0.00% 63 404 0.00% 64 479 0.00% 65 476 0.00% 66 516 0.00% 67 633 0.00% 68 717 0.00% 69 1376 0.01% 70 1602 0.01% 71 1155 0.01% 72 1232 0.01% 73 1325 0.01% 74 1385 0.01% 75 1653 0.01% 76 1882 0.01% 77 2119 0.01% 78 2226 0.01% 79 2536 0.01% 80 2862 0.01% 81 3192 0.01% 82 3594 0.02% 83 4213 0.02% 84 5911 0.03% 85 6925 0.03% 86 7307 0.03% 87 7729 0.04% 88 8022 0.04% 89 8599 0.04% 90 8923 0.04% 91 9640 0.04% 92 10262 0.05% 93 11116 0.05% 94 11945 0.05% 95 12698 0.06% 96 13404 0.06% 97 14058 0.06% 98 14794 0.07% 99 15580 0.07% 100 16495 0.07% 101 17295 0.08% 102 18402 0.08% 103 19731 0.09% 104 20636 0.09% 105 21672 0.10% 106 22670 0.10% 107 23853 0.11% 108 24762 0.11% 109 26429 0.12% 110 27432 0.12% 111 28783 0.13% 112 30278 0.14% 113 31434 0.14% 114 32843 0.15% 115 34145 0.15% 116 35421 0.16% 117 36952 0.17% 118 38405 0.17% 119 40119 0.18% 120 41383 0.19% 121 43725 0.20% 122 45629 0.21% 123 48035 0.22% 124 50337 0.23% 125 52005 0.24% 126 54587 0.25% 127 56251 0.25% 128 58007 0.26% 129 61105 0.28% 130 63515 0.29% 131 66487 0.30% 132 69943 0.32% 133 74149 0.34% 134 76881 0.35% 135 82268 0.37% 136 86976 0.39% 137 91374 0.41% 138 97081 0.44% 139 105170 0.48% 140 110288 0.50% 141 119900 0.54% 142 132162 0.60% 143 147000 0.67% 144 169408 0.77% 145 206935 0.94% 146 247720 1.12% 147 327951 1.49% 148 473766 2.15% 149 919689 4.17% 150 4965986 22.50% 151 12173916 55.15% 22072954 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.92 fanout-score-rank=6 prefix-density=0.61 prefix-fanout=3.1 sequence=CCATTGCTTGCAATGGAAGTAATGTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=44.40 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.0 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=20 prefix-density=0.61 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=23 fanout-score=10.21 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=6.2 sequence=CAGCAATGGCAGC SRR7230791 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 06:44:35 Started mapping on | Feb 11 06:44:40 Finished on | Feb 11 07:33:18 Mapping speed, Million of reads per hour | 27.23 Number of input reads | 22072954 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 20658784 Uniquely mapped reads % | 93.59% Average mapped length | 294.19 Number of splices: Total | 19750254 Number of splices: Annotated (sjdb) | 19311251 Number of splices: GT/AG | 19372105 Number of splices: GC/AG | 310140 Number of splices: AT/AC | 11619 Number of splices: Non-canonical | 56390 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 595038 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 84940 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.23% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 847878 847878 847878 N_multimapping 595038 595038 595038 N_noFeature 791149 20306301 948869 N_ambiguous 343763 1696 147835 UnstrandedReadsAssigned:19523872 PositiveStrandReadsAssigned:350787 NegativeStrandReadsAssigned:19562080 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7230791 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230791-trimmed-pair1.fastq SRR7230791-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,072,954 reads, 19,597,281 reads pseudoaligned [quant] estimated average fragment length: 249.073 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR7230791.ke.tsv 34699 SRR7230791.se.tsv 87100 total ==> SRR7230791.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.93 971 27.6094 Potri.005G024800.1.v4.1 1035 786.927 145 9.27314 Potri.004G059700.1.v4.1 961 713.003 23 1.62342 Potri.007G009000.2.v4.1 1416 1167.93 0 0 Potri.003G141000.2.v4.1 2943 2694.93 853 15.9293 Potri.016G087400.1.v4.1 270 80.681 1003 625.638 Potri.015G069301.1.v4.1 564 323.953 0 0 Potri.010G195200.1.v4.1 1773 1524.93 42 1.3861 Potri.012G127500.1.v4.1 977 728.955 184 12.7031 ==> SRR7230791.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1171 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 418 Potri.001G212900.v4.1 16 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7230791 completed mapping pipeline successfully