Starting /dee2/code/volunteer_pipeline.sh SRR7230792 current disk space = 3055189196800 free memory = 1491886216 SRR7230792 SRAfilesize e34de1337e89e1e6c179af4a936b79ac SRR7230792.sra SRR7230792.sra file validated SRR7230792 is paired end SRR7230792 is conventional basespace SRR7230792 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230792_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.4965 34.0 33.0 34.0 33.0 34.0 2 33.535 34.0 34.0 34.0 33.0 34.0 3 33.4805 34.0 34.0 34.0 33.0 34.0 4 33.379 34.0 34.0 34.0 33.0 34.0 5 33.46475 34.0 34.0 34.0 33.0 34.0 6 37.25425 38.0 38.0 38.0 36.0 38.0 7 37.50775 38.0 38.0 38.0 37.0 38.0 8 37.57075 38.0 38.0 38.0 38.0 38.0 9 37.62775 38.0 38.0 38.0 38.0 38.0 10-14 37.6166 38.0 38.0 38.0 38.0 38.0 15-19 37.2746 38.0 38.0 38.0 37.0 38.0 20-24 37.566599999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.488299999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.510200000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.278800000000004 38.0 38.0 38.0 37.4 38.0 40-44 36.797250000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.89385 38.0 38.0 38.0 35.8 38.0 50-54 36.50535 38.0 37.6 38.0 33.2 38.0 55-59 37.1847 38.0 38.0 38.0 36.6 38.0 60-64 37.191700000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.15815 38.0 38.0 38.0 36.8 38.0 70-74 29.312900000000003 37.4 16.4 38.0 15.6 38.0 75-79 30.1315 37.8 27.0 38.0 2.0 38.0 80-84 33.973400000000005 38.0 36.4 38.0 20.2 38.0 85-89 35.67335 38.0 38.0 38.0 29.0 38.0 90-94 36.325 38.0 38.0 38.0 33.8 38.0 95-99 36.46435 38.0 38.0 38.0 34.2 38.0 100-104 35.371249999999996 38.0 36.2 38.0 28.2 38.0 105-109 36.180150000000005 38.0 37.6 38.0 33.6 38.0 110-114 36.04945 38.0 37.4 38.0 33.0 38.0 115-119 36.09645 38.0 37.8 38.0 33.4 38.0 120-124 34.74335 38.0 34.8 38.0 27.2 38.0 125-129 35.24015 38.0 36.0 38.0 28.8 38.0 130-134 34.039300000000004 38.0 33.6 38.0 23.6 38.0 135-139 34.902550000000005 38.0 35.4 38.0 28.4 38.0 140-144 34.45825 38.0 35.0 38.0 26.4 38.0 145-149 33.6327 38.0 34.0 38.0 21.8 38.0 150-151 29.92525 35.5 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 2.0 8 0.0 9 1.0 10 1.0 11 2.0 12 2.0 13 2.0 14 0.0 15 2.0 16 1.0 17 4.0 18 4.0 19 1.0 20 4.0 21 4.0 22 6.0 23 14.0 24 12.0 25 13.0 26 36.0 27 23.0 28 39.0 29 42.0 30 51.0 31 88.0 32 111.0 33 218.0 34 310.0 35 454.0 36 933.0 37 1618.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.0 15.5 11.275 31.225 2 21.675 18.625 34.525 25.174999999999997 3 18.825 26.825 26.900000000000002 27.450000000000003 4 21.9 32.2 23.325000000000003 22.575 5 20.3 37.2 24.65 17.849999999999998 6 17.00425106276569 35.45886471617904 26.756689172293076 20.78019504876219 7 14.85 21.425 44.875 18.85 8 16.7 23.775 29.925 29.599999999999998 9 16.25 24.675 32.9 26.174999999999997 10-14 20.03 29.9 26.745 23.325000000000003 15-19 20.07 28.54 27.43 23.96 20-24 19.765 28.76 27.589999999999996 23.885 25-29 19.66 28.749999999999996 27.52 24.07 30-34 19.21 28.694999999999997 27.855 24.240000000000002 35-39 19.630704563650923 28.753002401921535 27.892313851080864 23.723979183346678 40-44 19.882600842865745 29.214328717639976 26.86634557495485 24.036724864539433 45-49 20.173025953893085 29.43441516227434 27.104065609841477 23.288493273991097 50-54 19.535 28.715000000000003 27.405 24.345 55-59 20.527052705270528 27.952795279527955 28.092809280928094 23.427342734273427 60-64 19.86 28.28 27.915 23.945 65-69 20.505000000000003 28.660000000000004 27.389999999999997 23.445 70-74 20.133007089528828 28.514963297571995 27.56760148064496 23.78442813225422 75-79 19.763888056570984 27.72217894169114 28.081740276862227 24.43219272487565 80-84 20.128342245989305 28.304812834224595 27.748663101604276 23.81818181818182 85-89 20.22002648466945 28.129774880309665 27.600081491290616 24.050117143730265 90-94 20.580000000000002 28.58 27.084999999999997 23.755000000000003 95-99 20.506025301265062 28.961448072403623 26.836341817090855 23.69618480924046 100-104 20.380190095047524 29.004502251125565 26.588294147073537 24.027013506753377 105-109 19.966980188112867 28.301981188713228 27.966780068040826 23.76425855513308 110-114 21.532153215321532 27.29272927292729 27.827782778277825 23.347334733473346 115-119 21.141057052852645 28.50142507125356 26.756337816890845 23.60118005900295 120-124 20.544999999999998 28.095 27.015 24.345 125-129 20.76946197775774 28.71455765955315 26.715759943893396 23.80022041879571 130-134 20.847559750954005 27.882104840329387 27.44024904599317 23.83008636272344 135-139 21.2345555499975 27.457355810114553 27.07218248211695 24.235906157770998 140-144 21.372137213721373 28.06780678067807 26.697669766976695 23.862386238623863 145-149 21.97648236177133 27.73580185138854 26.389792344258193 23.897923442581938 150-151 21.63142749906168 27.761791567621668 26.83598148379832 23.77079944951833 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.5 17 1.0 18 0.0 19 0.0 20 1.0 21 2.0 22 3.0 23 3.5 24 5.0 25 7.0 26 9.0 27 12.5 28 15.5 29 23.0 30 36.5 31 44.0 32 49.0 33 68.5 34 91.5 35 112.5 36 132.0 37 135.0 38 150.5 39 178.5 40 198.5 41 203.0 42 212.5 43 250.5 44 249.5 45 224.5 46 229.5 47 233.5 48 207.0 49 171.0 50 149.5 51 116.0 52 96.5 53 86.0 54 62.5 55 54.5 56 49.5 57 31.5 58 19.0 59 21.0 60 14.5 61 6.0 62 5.5 63 6.5 64 4.0 65 1.5 66 2.5 67 2.5 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.08 40-44 0.33999999999999997 45-49 0.015 50-54 0.0 55-59 0.01 60-64 0.0 65-69 0.0 70-74 20.305 75-79 16.564999999999998 80-84 6.5 85-89 1.83 90-94 0.0 95-99 0.005 100-104 0.05 105-109 0.06 110-114 0.01 115-119 0.005 120-124 0.0 125-129 0.19 130-134 0.42 135-139 0.045 140-144 0.01 145-149 0.075 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.72838250254323 97.05 2 1.093591047812818 2.15 3 0.0762970498474059 0.22499999999999998 4 0.050864699898270596 0.2 5 0.0 0.0 6 0.0 0.0 7 0.025432349949135298 0.17500000000000002 8 0.025432349949135298 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 8 0.2 No Hit GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.0499999999999998 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.6375 0.0 0.0 0.0 0.0 108-109 1.775 0.0 0.0 0.0 0.0 110-111 2.05 0.0 0.0 0.0 0.0 112-113 2.375 0.0 0.0 0.0 0.0 114-115 2.55 0.0 0.0 0.0 0.0 116-117 2.675 0.0 0.0 0.0 0.0 118-119 3.2 0.0 0.0 0.0 0.0 120-121 3.6125 0.0 0.0 0.0 0.0 122-123 3.9625 0.0 0.0 0.0 0.0 124-125 4.3125 0.0 0.0 0.0 0.0 126-127 4.8125 0.0 0.0 0.0 0.0 128-129 5.2375 0.0 0.0 0.0 0.0 130-131 5.6875 0.0 0.0 0.0 0.0 132-133 6.1875 0.0 0.0 0.0 0.0 134-135 6.7 0.0 0.0 0.0 0.0 136-137 7.275 0.0 0.0 0.0 0.0 138-139 8.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAAAT 10 0.007647533 139.625 1 >>END_MODULE SRR7230792 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230792_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92075 34.0 33.0 34.0 32.0 34.0 2 32.99175 34.0 33.0 34.0 32.0 34.0 3 32.96625 34.0 33.0 34.0 33.0 34.0 4 32.9665 34.0 33.0 34.0 33.0 34.0 5 32.92875 34.0 33.0 34.0 33.0 34.0 6 36.9645 38.0 38.0 38.0 37.0 38.0 7 37.01875 38.0 38.0 38.0 37.0 38.0 8 37.00075 38.0 38.0 38.0 37.0 38.0 9 36.93425 38.0 38.0 38.0 37.0 38.0 10-14 36.90875 38.0 38.0 38.0 36.8 38.0 15-19 36.92725 38.0 38.0 38.0 37.0 38.0 20-24 36.872499999999995 38.0 38.0 38.0 37.0 38.0 25-29 36.7821 38.0 38.0 38.0 36.8 38.0 30-34 36.74335 38.0 38.0 38.0 36.6 38.0 35-39 36.53415 38.0 38.0 38.0 36.0 38.0 40-44 36.6142 38.0 38.0 38.0 36.0 38.0 45-49 36.67785 38.0 38.0 38.0 36.6 38.0 50-54 36.7048 38.0 38.0 38.0 36.8 38.0 55-59 36.190999999999995 38.0 38.0 38.0 34.8 38.0 60-64 36.51195 38.0 38.0 38.0 35.8 38.0 65-69 36.324400000000004 38.0 38.0 38.0 35.4 38.0 70-74 36.1203 38.0 38.0 38.0 34.4 38.0 75-79 36.47055 38.0 38.0 38.0 35.8 38.0 80-84 36.3457 38.0 38.0 38.0 35.2 38.0 85-89 36.4423 38.0 38.0 38.0 35.8 38.0 90-94 36.32925 38.0 38.0 38.0 35.0 38.0 95-99 36.2282 38.0 38.0 38.0 35.0 38.0 100-104 35.991350000000004 38.0 38.0 38.0 34.0 38.0 105-109 35.816250000000004 38.0 38.0 38.0 33.6 38.0 110-114 35.8779 38.0 38.0 38.0 33.8 38.0 115-119 35.7879 38.0 38.0 38.0 33.4 38.0 120-124 35.45805 38.0 38.0 38.0 31.6 38.0 125-129 35.20195 38.0 37.0 38.0 30.4 38.0 130-134 35.21495 38.0 37.2 38.0 31.0 38.0 135-139 34.4722 38.0 36.0 38.0 26.2 38.0 140-144 34.238 38.0 35.8 38.0 25.2 38.0 145-149 33.011849999999995 38.0 34.2 38.0 17.0 38.0 150-151 27.190375 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 9.0 4 5.0 5 1.0 6 4.0 7 3.0 8 6.0 9 2.0 10 3.0 11 5.0 12 6.0 13 7.0 14 7.0 15 7.0 16 5.0 17 5.0 18 6.0 19 5.0 20 7.0 21 10.0 22 9.0 23 13.0 24 19.0 25 18.0 26 7.0 27 23.0 28 24.0 29 22.0 30 30.0 31 53.0 32 46.0 33 76.0 34 165.0 35 201.0 36 507.0 37 2668.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.52690863579475 19.62453066332916 14.918648310387987 23.92991239048811 2 25.512756378189096 25.212606303151574 31.615807903951975 17.658829414707352 3 21.9 29.025000000000002 30.025000000000002 19.05 4 24.375 34.825 21.725 19.075 5 23.625 36.449999999999996 21.325 18.6 6 21.025 35.75 23.974999999999998 19.25 7 20.175 19.8 39.275 20.75 8 20.349999999999998 23.7 29.125 26.825 9 21.95 24.75 28.549999999999997 24.75 10-14 23.93098274568642 27.771942985746435 26.596649162290575 21.70042510627657 15-19 23.682368236823685 27.35273527352735 27.422742274227424 21.54215421542154 20-24 23.675654044319945 28.352758741433643 27.07718473312991 20.894402481116504 25-29 23.621810905452726 28.064032016008007 27.61880940470235 20.69534767383692 30-34 23.693554033104967 28.18422763414512 27.234085112766916 20.888133219982997 35-39 23.262446835126344 28.126094570928196 27.36552414310733 21.245934450838128 40-44 23.43351502725409 27.804170625593837 27.489123368505275 21.2731909786468 45-49 23.432260647615237 27.916520694659923 27.250888343926732 21.400330313798108 50-54 23.840296563470595 27.512273319306686 27.532311391644125 21.1151187255786 55-59 24.08895628001011 27.520849128127367 27.647207480414455 20.742987111448066 60-64 23.49430820921719 27.285492201995886 27.89228223258613 21.327917356200793 65-69 23.757630795620805 27.27914837798295 27.50113515967913 21.46208566671712 70-74 23.158851143304222 28.20150421483015 27.252536469638077 21.38710817222755 75-79 24.2110527631908 27.73693423355839 27.00675168792198 21.04526131532883 80-84 24.145545796737768 27.442910915934753 26.991217063989964 21.420326223337515 85-89 24.09240924092409 27.95779577957796 26.937693769376935 21.012101210121013 90-94 24.113439703896365 27.159505827039464 27.844745660981346 20.88230880808283 95-99 23.998599789968495 27.619142871430714 27.69415412311847 20.68810321548232 100-104 23.991199559978 27.651382569128458 27.651382569128458 20.706035301765088 105-109 24.341217060853044 27.146357317865892 28.05140257012851 20.46102305115256 110-114 24.38206744721305 27.89952967076954 27.294105874111878 20.424297007905533 115-119 24.088248536695183 27.885336935314424 27.90034518985442 20.126069338135974 120-124 24.709999999999997 28.32 26.705000000000002 20.265 125-129 24.68 27.495000000000005 27.279999999999998 20.544999999999998 130-134 24.856242812140607 27.841392069603483 26.88134406720336 20.421021051052552 135-139 25.521774031707807 27.744330724463172 26.926550270921133 19.807344972907888 140-144 25.131256562828142 27.69138456922846 26.516325816290813 20.661033051652584 145-149 25.956297814890743 28.41142057102855 26.606330316515823 19.025951297564877 150-151 26.0125 28.050000000000004 26.625 19.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 0.5 22 1.0 23 2.5 24 3.0 25 4.5 26 4.0 27 3.5 28 7.0 29 9.0 30 11.0 31 13.0 32 21.5 33 35.0 34 51.0 35 65.0 36 80.0 37 104.0 38 128.0 39 147.5 40 170.5 41 203.0 42 235.5 43 250.0 44 250.0 45 245.0 46 251.0 47 248.5 48 230.5 49 214.0 50 190.0 51 158.5 52 126.0 53 107.5 54 98.5 55 79.5 56 64.5 57 50.5 58 33.5 59 23.0 60 16.0 61 14.0 62 13.5 63 11.5 64 6.5 65 5.0 66 2.5 67 1.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.025 15-19 0.01 20-24 0.045 25-29 0.05 30-34 0.015 35-39 0.075 40-44 0.015 45-49 0.095 50-54 0.19 55-59 1.075 60-64 0.295 65-69 0.895 70-74 0.9450000000000001 75-79 0.025 80-84 0.375 85-89 0.01 90-94 0.034999999999999996 95-99 0.015 100-104 0.005 105-109 0.005 110-114 0.06999999999999999 115-119 0.055 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.33999999999999997 140-144 0.005 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70229007633587 96.975 2 1.0941475826972011 2.15 3 0.1272264631043257 0.375 4 0.02544529262086514 0.1 5 0.0 0.0 6 0.02544529262086514 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02544529262086514 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 10 0.25 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.85 0.0 0.0 0.0 0.0 96-97 0.9875 0.0 0.0 0.0 0.0 98-99 1.1625 0.0 0.0 0.0 0.0 100-101 1.2000000000000002 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.55 0.0 0.0 0.0 0.0 106-107 1.8125 0.0 0.0 0.0 0.0 108-109 1.9500000000000002 0.0 0.0 0.0 0.0 110-111 2.2375 0.0 0.0 0.0 0.0 112-113 2.55 0.0 0.0 0.0 0.0 114-115 2.7125 0.0 0.0 0.0 0.0 116-117 2.8499999999999996 0.0 0.0 0.0 0.0 118-119 3.3875 0.0 0.0 0.0 0.0 120-121 3.8125 0.0 0.0 0.0 0.0 122-123 4.175000000000001 0.0 0.0 0.0 0.0 124-125 4.6 0.0 0.0 0.0 0.0 126-127 5.1625 0.0 0.0 0.0 0.0 128-129 5.6875 0.0 0.0 0.0 0.0 130-131 6.2 0.0 0.0 0.0 0.0 132-133 6.6875 0.0 0.0 0.0 0.0 134-135 7.225 0.0 0.0 0.0 0.0 136-137 7.7875 0.0 0.0 0.0 0.0 138-139 8.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTGCC 10 0.00709263 143.1875 6 GGTTTGC 10 0.00709263 143.1875 5 >>END_MODULE Read 1212147 spots for SRR7230792.sra Written 1212147 spots for SRR7230792.sra Read 1212147 spots for SRR7230792.sra Written 1212147 spots for SRR7230792.sra Read 1212147 spots for SRR7230792.sra Written 1212147 spots for SRR7230792.sra Read 1212147 spots for SRR7230792.sra Written 1212147 spots for SRR7230792.sra Read 1212164 spots for SRR7230792.sra Written 1212164 spots for SRR7230792.sra Read 1212147 spots for SRR7230792.sra Written 1212147 spots for SRR7230792.sra Read 1212147 spots for SRR7230792.sra Written 1212147 spots for SRR7230792.sra Read 1212147 spots for SRR7230792.sra Written 1212147 spots for SRR7230792.sra Read 1212147 spots for SRR7230792.sra Written 1212147 spots for SRR7230792.sra Read 1212147 spots for SRR7230792.sra Written 1212147 spots for SRR7230792.sra Read 1212147 spots for SRR7230792.sra Written 1212147 spots for SRR7230792.sra Read 1212147 spots for SRR7230792.sra Written 1212147 spots for SRR7230792.sra Read 1212147 spots for SRR7230792.sra Written 1212147 spots for SRR7230792.sra Read 1212147 spots for SRR7230792.sra Written 1212147 spots for SRR7230792.sra Read 1212147 spots for SRR7230792.sra Written 1212147 spots for SRR7230792.sra Read 1212147 spots for SRR7230792.sra Written 1212147 spots for SRR7230792.sra Read 1212147 spots for SRR7230792.sra Written 1212147 spots for SRR7230792.sra Read 1212147 spots for SRR7230792.sra Written 1212147 spots for SRR7230792.sra Read 1212147 spots for SRR7230792.sra Written 1212147 spots for SRR7230792.sra Read 1212147 spots for SRR7230792.sra Written 1212147 spots for SRR7230792.sra SRR ids: ['SRR7230792.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vrgof9hl SRR7230792.sra spots: 24242957 blocks: [[1, 1212147], [1212148, 2424294], [2424295, 3636441], [3636442, 4848588], [4848589, 6060735], [6060736, 7272882], [7272883, 8485029], [8485030, 9697176], [9697177, 10909323], [10909324, 12121470], [12121471, 13333617], [13333618, 14545764], [14545765, 15757911], [15757912, 16970058], [16970059, 18182205], [18182206, 19394352], [19394353, 20606499], [20606500, 21818646], [21818647, 23030793], [23030794, 24242957]] SRR7230792 file size 8193442 SRR7230792 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230792 SRR7230792_1.fastq SRR7230792_2.fastq Input file: SRR7230792_1.fastq Paired file: SRR7230792_2.fastq trimmed: SRR7230792-trimmed-pair1.fastq, SRR7230792-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 06:39:37 2025 >> started Tue Feb 11 06:45:25 2025 >> done (348.497s) 24242957 read pairs processed; of these: 53156 ( 0.22%) short read pairs filtered out after trimming by size control 38758 ( 0.16%) empty read pairs filtered out after trimming by size control 24151043 (99.62%) read pairs available; of these: 10932108 (45.27%) trimmed read pairs available after processing 13218935 (54.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 2 0.00% 21 8 0.00% 22 13 0.00% 23 13 0.00% 24 14 0.00% 25 13 0.00% 26 18 0.00% 27 15 0.00% 28 15 0.00% 29 22 0.00% 30 25 0.00% 31 18 0.00% 32 28 0.00% 33 23 0.00% 34 26 0.00% 35 33 0.00% 36 22 0.00% 37 28 0.00% 38 40 0.00% 39 38 0.00% 40 53 0.00% 41 52 0.00% 42 54 0.00% 43 51 0.00% 44 64 0.00% 45 91 0.00% 46 109 0.00% 47 111 0.00% 48 106 0.00% 49 126 0.00% 50 147 0.00% 51 181 0.00% 52 207 0.00% 53 251 0.00% 54 203 0.00% 55 278 0.00% 56 317 0.00% 57 347 0.00% 58 440 0.00% 59 403 0.00% 60 483 0.00% 61 493 0.00% 62 577 0.00% 63 649 0.00% 64 723 0.00% 65 877 0.00% 66 996 0.00% 67 1220 0.01% 68 1802 0.01% 69 5017 0.02% 70 4693 0.02% 71 2174 0.01% 72 2196 0.01% 73 2328 0.01% 74 2476 0.01% 75 2610 0.01% 76 2996 0.01% 77 3244 0.01% 78 3673 0.02% 79 4182 0.02% 80 4966 0.02% 81 6346 0.03% 82 6070 0.03% 83 6959 0.03% 84 10933 0.05% 85 11479 0.05% 86 12329 0.05% 87 13553 0.06% 88 14221 0.06% 89 14879 0.06% 90 15883 0.07% 91 16865 0.07% 92 17222 0.07% 93 19130 0.08% 94 19602 0.08% 95 21433 0.09% 96 22331 0.09% 97 23314 0.10% 98 24415 0.10% 99 26105 0.11% 100 27959 0.12% 101 28561 0.12% 102 31071 0.13% 103 32974 0.14% 104 34931 0.14% 105 37335 0.15% 106 38288 0.16% 107 39594 0.16% 108 41284 0.17% 109 43363 0.18% 110 45329 0.19% 111 47233 0.20% 112 49316 0.20% 113 51885 0.21% 114 53905 0.22% 115 56076 0.23% 116 58311 0.24% 117 59143 0.24% 118 60470 0.25% 119 63051 0.26% 120 65971 0.27% 121 68094 0.28% 122 70284 0.29% 123 73248 0.30% 124 76601 0.32% 125 78023 0.32% 126 80732 0.33% 127 83305 0.34% 128 85317 0.35% 129 87965 0.36% 130 90141 0.37% 131 92815 0.38% 132 96422 0.40% 133 100638 0.42% 134 104635 0.43% 135 109362 0.45% 136 113763 0.47% 137 117795 0.49% 138 122441 0.51% 139 127869 0.53% 140 132867 0.55% 141 141876 0.59% 142 150702 0.62% 143 164051 0.68% 144 182584 0.76% 145 206842 0.86% 146 242995 1.01% 147 306347 1.27% 148 438973 1.82% 149 824636 3.41% 150 5039280 20.87% 151 13218935 54.73% 24151043 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=19 prefix-density=0.62 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=46.13 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=3.4 sequence=AAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.16 fanout-score-rank=11 prefix-density=1.68 prefix-fanout=1.0 sequence=ATCGTCGAGACTGAGAAGAACTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=72.91 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=9.0 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT SRR7230792 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:07:01 Started mapping on | Feb 11 07:07:08 Finished on | Feb 11 07:33:15 Mapping speed, Million of reads per hour | 55.48 Number of input reads | 24151043 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 19679767 Uniquely mapped reads % | 81.49% Average mapped length | 289.66 Number of splices: Total | 18784819 Number of splices: Annotated (sjdb) | 18367016 Number of splices: GT/AG | 18408368 Number of splices: GC/AG | 307067 Number of splices: AT/AC | 10962 Number of splices: Non-canonical | 58422 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 516816 % of reads mapped to multiple loci | 2.14% Number of reads mapped to too many loci | 215464 % of reads mapped to too many loci | 0.89% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.32% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4006467 4006467 4006467 N_multimapping 516816 516816 516816 N_noFeature 734278 19159724 866270 N_ambiguous 599266 3208 208970 UnstrandedReadsAssigned:18346223 PositiveStrandReadsAssigned:516835 NegativeStrandReadsAssigned:18604527 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7230792 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230792-trimmed-pair1.fastq SRR7230792-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,151,043 reads, 20,724,257 reads pseudoaligned [quant] estimated average fragment length: 225.979 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52401 SRR7230792.ke.tsv 34699 SRR7230792.se.tsv 87100 total ==> SRR7230792.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.02 805 15.8268 Potri.005G024800.1.v4.1 1035 810.021 203 8.83448 Potri.004G059700.1.v4.1 961 736.053 27 1.29311 Potri.007G009000.2.v4.1 1416 1191.02 0 0 Potri.003G141000.2.v4.1 2943 2718.02 851 11.0372 Potri.016G087400.1.v4.1 270 90.7365 1074 417.257 Potri.015G069301.1.v4.1 564 343.649 0 0 Potri.010G195200.1.v4.1 1773 1548.02 107 2.43662 Potri.012G127500.1.v4.1 977 752.047 87 4.07808 ==> SRR7230792.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 957 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 520 Potri.001G212900.v4.1 15 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 57 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR7230792 completed mapping pipeline successfully