Starting /dee2/code/volunteer_pipeline.sh SRR7230793 current disk space = 3054992515072 free memory = 1480216076 SRR7230793 SRAfilesize aa3b1f47d700271fda15187d10ef5975 SRR7230793.sra SRR7230793.sra file validated SRR7230793 is paired end SRR7230793 is conventional basespace SRR7230793 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230793_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6755 34.0 33.0 34.0 32.0 34.0 2 33.10975 34.0 33.0 34.0 32.0 34.0 3 33.30775 34.0 33.0 34.0 33.0 34.0 4 33.29375 34.0 33.0 34.0 33.0 34.0 5 32.20225 34.0 33.0 34.0 30.0 34.0 6 36.628 38.0 37.0 38.0 34.0 38.0 7 37.246 38.0 38.0 38.0 36.0 38.0 8 37.50625 38.0 38.0 38.0 37.0 38.0 9 37.5005 38.0 38.0 38.0 38.0 38.0 10-14 37.4957 38.0 38.0 38.0 38.0 38.0 15-19 37.4773 38.0 38.0 38.0 37.8 38.0 20-24 37.0268 38.0 38.0 38.0 35.8 38.0 25-29 37.362849999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.334950000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.0339 38.0 38.0 38.0 36.0 38.0 40-44 36.859700000000004 38.0 38.0 38.0 35.6 38.0 45-49 37.234950000000005 38.0 38.0 38.0 36.8 38.0 50-54 37.1914 38.0 38.0 38.0 36.8 38.0 55-59 37.18695 38.0 38.0 38.0 36.6 38.0 60-64 37.18305 38.0 38.0 38.0 36.6 38.0 65-69 37.1681 38.0 38.0 38.0 36.4 38.0 70-74 31.73895 38.0 26.4 38.0 15.4 38.0 75-79 32.48335000000001 38.0 33.6 38.0 9.4 38.0 80-84 35.124 38.0 37.4 38.0 28.6 38.0 85-89 36.2518 38.0 38.0 38.0 33.6 38.0 90-94 36.48 38.0 38.0 38.0 34.0 38.0 95-99 36.431349999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.471199999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.40025 38.0 38.0 38.0 34.0 38.0 110-114 36.241949999999996 38.0 37.8 38.0 33.6 38.0 115-119 35.95815 38.0 37.0 38.0 32.8 38.0 120-124 35.63275 38.0 36.6 38.0 30.8 38.0 125-129 35.2196 38.0 36.0 38.0 29.2 38.0 130-134 34.983450000000005 38.0 35.6 38.0 27.8 38.0 135-139 34.85985000000001 38.0 35.2 38.0 28.0 38.0 140-144 34.22025 38.0 34.8 38.0 24.0 38.0 145-149 33.4774 38.0 33.4 38.0 20.2 38.0 150-151 29.128375 35.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 1.0 14 2.0 15 1.0 16 1.0 17 0.0 18 2.0 19 4.0 20 3.0 21 6.0 22 7.0 23 10.0 24 12.0 25 17.0 26 20.0 27 27.0 28 34.0 29 39.0 30 56.0 31 83.0 32 98.0 33 185.0 34 262.0 35 422.0 36 789.0 37 1917.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.03350837709427 15.103775943985998 11.177794448612154 39.68492123030758 2 20.375 19.875 36.775000000000006 22.975 3 19.575 26.275 25.25 28.9 4 22.75 34.699999999999996 20.974999999999998 21.575 5 19.950000000000003 36.375 24.8 18.875 6 17.549999999999997 35.925000000000004 26.575 19.950000000000003 7 13.4 22.95 45.225 18.425 8 16.875 24.125 31.1 27.900000000000002 9 17.724999999999998 23.625 33.425 25.224999999999998 10-14 19.29 30.37 26.669999999999998 23.669999999999998 15-19 19.771977197719774 28.83788378837884 27.682768276827684 23.707370737073706 20-24 19.855 29.415000000000003 27.229999999999997 23.5 25-29 19.776977697769777 29.62796279627963 26.817681768176815 23.77737773777378 30-34 19.545 29.28 27.495000000000005 23.68 35-39 19.470000000000002 29.68 27.395000000000003 23.455000000000002 40-44 19.91695017010206 29.182509505703425 27.58655193115869 23.31398839303582 45-49 19.725 28.835 27.834999999999997 23.605 50-54 20.180045011252815 28.992248062015502 27.316829207301822 23.510877719429857 55-59 20.20722795074582 28.47632395635199 27.930723796175794 23.385724296726398 60-64 19.67672521643397 28.74943702146825 27.373267277185608 24.200570484912177 65-69 19.57054907653036 29.02547675058812 27.754141848941387 23.64983232394014 70-74 19.79984872287194 28.52155699074882 27.99790539361145 23.68068889276779 75-79 19.681653169505726 28.88578609327004 27.82462999162245 23.607930745601788 80-84 20.157013621711553 28.101278985130495 27.55537069772278 24.186336695435166 85-89 20.50186060545107 27.733078547722016 28.029769687217136 23.735291159609776 90-94 20.080000000000002 28.035 28.144999999999996 23.74 95-99 20.41 28.694999999999997 27.47 23.425 100-104 20.46 28.89 26.97 23.68 105-109 20.445 28.515 27.644999999999996 23.395 110-114 21.17 28.535 27.02 23.275000000000002 115-119 21.099999999999998 28.4 27.165 23.335 120-124 20.72 28.535 26.555 24.19 125-129 21.135 28.549999999999997 26.619999999999997 23.695 130-134 21.365000000000002 28.025 26.255 24.355 135-139 21.42 28.485 26.155 23.94 140-144 21.19 27.865000000000002 26.889999999999997 24.055 145-149 21.834999999999997 28.185 25.669999999999998 24.310000000000002 150-151 21.512500000000003 28.3125 26.0 24.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 2.5 20 2.5 21 1.5 22 2.0 23 3.5 24 4.5 25 6.0 26 9.0 27 13.0 28 20.0 29 30.0 30 31.0 31 37.5 32 54.0 33 71.5 34 91.0 35 111.5 36 116.0 37 128.5 38 157.0 39 175.0 40 201.5 41 215.5 42 231.5 43 244.5 44 235.5 45 223.0 46 235.5 47 229.5 48 188.5 49 171.5 50 154.5 51 128.0 52 101.0 53 76.5 54 68.0 55 64.5 56 50.5 57 32.0 58 19.0 59 18.0 60 15.0 61 9.5 62 6.0 63 2.5 64 1.5 65 1.5 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.0 25-29 0.01 30-34 0.0 35-39 0.0 40-44 0.06 45-49 0.0 50-54 0.025 55-59 0.11 60-64 0.08499999999999999 65-69 0.105 70-74 14.065 75-79 10.475 80-84 3.83 85-89 0.5700000000000001 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98964384945693 97.975 2 0.9850972467794897 1.95 3 0.025258903763576663 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.2 0.0 0.0 0.0 0.0 98-99 1.4 0.0 0.0 0.0 0.0 100-101 1.55 0.0 0.0 0.0 0.0 102-103 1.7 0.0 0.0 0.0 0.0 104-105 1.9625 0.0 0.0 0.0 0.0 106-107 2.2125 0.0 0.0 0.0 0.0 108-109 2.6 0.0 0.0 0.0 0.0 110-111 2.9625 0.0 0.0 0.0 0.0 112-113 3.35 0.0 0.0 0.0 0.0 114-115 3.7 0.0 0.0 0.0 0.0 116-117 4.225 0.0 0.0 0.0 0.0 118-119 4.675 0.0 0.0 0.0 0.0 120-121 5.1625 0.0 0.0 0.0 0.0 122-123 5.7625 0.0 0.0 0.0 0.0 124-125 6.35 0.0 0.0 0.0 0.0 126-127 6.925000000000001 0.0 0.0 0.0 0.0 128-129 7.5125 0.0 0.0 0.0 0.0 130-131 8.1875 0.0 0.0 0.0 0.0 132-133 8.85 0.0 0.0 0.0 0.0 134-135 9.6125 0.0 0.0 0.0 0.0 136-137 10.2875 0.0 0.0 0.0 0.0 138-139 11.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTCAA 10 0.00728678 141.90001 4 GGATTCT 10 0.00728678 141.90001 5 ATTGTCA 10 0.00728678 141.90001 6 GATTCTA 10 0.00728678 141.90001 6 TTCTACC 10 0.00728678 141.90001 8 ATTCTAC 10 0.00728678 141.90001 7 TCTTAAC 10 0.00728678 141.90001 145 >>END_MODULE SRR7230793 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230793_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.80975 33.0 33.0 34.0 32.0 34.0 2 33.00575 34.0 33.0 34.0 32.0 34.0 3 33.0895 34.0 33.0 34.0 32.0 34.0 4 33.05075 34.0 33.0 34.0 32.0 34.0 5 32.6205 34.0 33.0 34.0 32.0 34.0 6 36.8225 38.0 38.0 38.0 35.0 38.0 7 36.932 38.0 38.0 38.0 36.0 38.0 8 37.067 38.0 38.0 38.0 36.0 38.0 9 37.024 38.0 38.0 38.0 37.0 38.0 10-14 36.6977 38.0 38.0 38.0 34.6 38.0 15-19 37.1726 38.0 38.0 38.0 37.0 38.0 20-24 37.1218 38.0 38.0 38.0 37.0 38.0 25-29 36.855399999999996 38.0 38.0 38.0 36.0 38.0 30-34 36.96535 38.0 38.0 38.0 36.6 38.0 35-39 36.7643 38.0 38.0 38.0 35.6 38.0 40-44 36.454750000000004 38.0 38.0 38.0 34.2 38.0 45-49 36.771550000000005 38.0 38.0 38.0 35.6 38.0 50-54 36.88824999999999 38.0 38.0 38.0 36.2 38.0 55-59 36.81224999999999 38.0 38.0 38.0 36.0 38.0 60-64 36.7082 38.0 38.0 38.0 35.6 38.0 65-69 36.555400000000006 38.0 38.0 38.0 34.6 38.0 70-74 36.62495 38.0 38.0 38.0 35.2 38.0 75-79 36.6866 38.0 38.0 38.0 35.6 38.0 80-84 36.659800000000004 38.0 38.0 38.0 35.2 38.0 85-89 36.674549999999996 38.0 38.0 38.0 35.2 38.0 90-94 36.64135 38.0 38.0 38.0 35.4 38.0 95-99 36.41225 38.0 38.0 38.0 34.4 38.0 100-104 35.65535 38.0 37.2 38.0 31.0 38.0 105-109 35.80285000000001 38.0 37.4 38.0 32.2 38.0 110-114 35.995050000000006 38.0 38.0 38.0 33.8 38.0 115-119 35.865899999999996 38.0 38.0 38.0 33.0 38.0 120-124 35.706450000000004 38.0 37.6 38.0 32.2 38.0 125-129 35.175149999999995 38.0 36.0 38.0 28.8 38.0 130-134 35.1283 38.0 36.0 38.0 29.4 38.0 135-139 34.76275 38.0 36.0 38.0 28.0 38.0 140-144 33.872899999999994 38.0 33.8 38.0 22.2 38.0 145-149 32.8189 38.0 33.0 38.0 15.0 38.0 150-151 26.31875 34.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 4.0 5 2.0 6 1.0 7 2.0 8 1.0 9 0.0 10 4.0 11 3.0 12 1.0 13 1.0 14 0.0 15 3.0 16 4.0 17 6.0 18 7.0 19 4.0 20 6.0 21 4.0 22 11.0 23 11.0 24 12.0 25 19.0 26 25.0 27 25.0 28 41.0 29 39.0 30 46.0 31 76.0 32 85.0 33 93.0 34 162.0 35 249.0 36 610.0 37 2437.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.85 18.625 15.85 29.675 2 25.025 24.224999999999998 34.125 16.625 3 20.775 25.775 33.300000000000004 20.150000000000002 4 24.175 35.449999999999996 22.625 17.75 5 24.3 35.949999999999996 21.85 17.9 6 18.5 39.275 23.25 18.975 7 17.9 18.375 41.8 21.925 8 21.25 22.45 28.95 27.35 9 21.75 23.474999999999998 30.45 24.325 10-14 23.49 28.065 26.745 21.7 15-19 23.375 28.265 27.3 21.060000000000002 20-24 24.035 28.16 27.125 20.68 25-29 22.715 28.375 27.805000000000003 21.105 30-34 24.005000000000003 27.935 27.365000000000002 20.695 35-39 23.44 28.060000000000002 27.62 20.880000000000003 40-44 23.79 27.715 27.755000000000003 20.74 45-49 23.3023302330233 27.65776577657766 28.072807280728075 20.96709670967097 50-54 23.68868868868869 27.3973973973974 27.882882882882882 21.03103103103103 55-59 23.671279582831932 27.446851183313274 27.93822703569996 20.943642198154834 60-64 23.22232223222322 27.782778277827784 28.03780378037804 20.957095709570957 65-69 23.534422286802283 27.81340815712997 28.063934261950095 20.588235294117645 70-74 23.641100145283303 27.54371023495817 27.663944692149695 21.151244927608836 75-79 23.39 28.285 28.139999999999997 20.185 80-84 24.051012753188296 27.176794198549636 27.786946736684172 20.985246311577892 85-89 24.33 27.355 28.075 20.24 90-94 23.315 27.82 28.084999999999997 20.78 95-99 23.849999999999998 28.355000000000004 27.534999999999997 20.26 100-104 23.76 27.565 28.325 20.349999999999998 105-109 23.345 28.360000000000003 27.775 20.52 110-114 24.025 28.194999999999997 27.925 19.855 115-119 24.595 28.275 27.615000000000002 19.515 120-124 24.305 27.565 28.189999999999998 19.939999999999998 125-129 25.11 28.16 27.195000000000004 19.535 130-134 25.665 27.49 27.415 19.43 135-139 26.0 28.005000000000003 26.825 19.17 140-144 25.919999999999998 28.134999999999998 26.935 19.009999999999998 145-149 26.06 28.435 26.97 18.535 150-151 25.837500000000002 29.15 26.1 18.912499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 1.0 22 1.5 23 1.5 24 1.5 25 3.0 26 4.0 27 4.5 28 8.0 29 16.5 30 20.0 31 21.0 32 29.5 33 41.0 34 51.0 35 73.5 36 87.5 37 95.5 38 126.0 39 164.0 40 182.5 41 209.0 42 242.5 43 256.5 44 270.0 45 264.5 46 250.0 47 238.0 48 211.5 49 196.5 50 185.0 51 147.5 52 114.5 53 102.0 54 95.0 55 71.0 56 48.0 57 41.5 58 34.5 59 21.0 60 13.0 61 14.0 62 15.0 63 12.0 64 5.0 65 1.5 66 1.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.1 55-59 0.27999999999999997 60-64 0.01 65-69 0.21 70-74 0.19499999999999998 75-79 0.0 80-84 0.025 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93778452200304 97.8 2 0.9863429438543246 1.95 3 0.05058168942842691 0.15 4 0.025290844714213456 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.36250000000000004 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.2 0.0 0.0 0.0 0.0 98-99 1.4 0.0 0.0 0.0 0.0 100-101 1.5625 0.0 0.0 0.0 0.0 102-103 1.725 0.0 0.0 0.0 0.0 104-105 1.9874999999999998 0.0 0.0 0.0 0.0 106-107 2.2375 0.0 0.0 0.0 0.0 108-109 2.6375 0.0 0.0 0.0 0.0 110-111 3.0 0.0 0.0 0.0 0.0 112-113 3.4 0.0 0.0 0.0 0.0 114-115 3.775 0.0 0.0 0.0 0.0 116-117 4.3 0.0 0.0 0.0 0.0 118-119 4.75 0.0 0.0 0.0 0.0 120-121 5.2625 0.0 0.0 0.0 0.0 122-123 5.8625 0.0 0.0 0.0 0.0 124-125 6.449999999999999 0.0 0.0 0.0 0.0 126-127 7.012499999999999 0.0 0.0 0.0 0.0 128-129 7.6 0.0 0.0 0.0 0.0 130-131 8.275 0.0 0.0 0.0 0.0 132-133 8.925 0.0 0.0 0.0 0.0 134-135 9.6625 0.0 0.0 0.0 0.0 136-137 10.350000000000001 0.0 0.0 0.0 0.0 138-139 11.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTCTCA 30 0.0018041289 72.431244 3 >>END_MODULE Read 826634 spots for SRR7230793.sra Written 826634 spots for SRR7230793.sra Read 826635 spots for SRR7230793.sra Written 826635 spots for SRR7230793.sra Read 826634 spots for SRR7230793.sra Written 826634 spots for SRR7230793.sra Read 826634 spots for SRR7230793.sra Written 826634 spots for SRR7230793.sra Read 826634 spots for SRR7230793.sra Written 826634 spots for SRR7230793.sra Read 826634 spots for SRR7230793.sra Written 826634 spots for SRR7230793.sra Read 826634 spots for SRR7230793.sra Written 826634 spots for SRR7230793.sra Read 826634 spots for SRR7230793.sra Written 826634 spots for SRR7230793.sra Read 826634 spots for SRR7230793.sra Written 826634 spots for SRR7230793.sra Read 826634 spots for SRR7230793.sra Written 826634 spots for SRR7230793.sra Read 826634 spots for SRR7230793.sra Written 826634 spots for SRR7230793.sra Read 826634 spots for SRR7230793.sra Written 826634 spots for SRR7230793.sra Read 826634 spots for SRR7230793.sra Written 826634 spots for SRR7230793.sra Read 826634 spots for SRR7230793.sra Written 826634 spots for SRR7230793.sra Read 826634 spots for SRR7230793.sra Written 826634 spots for SRR7230793.sra Read 826634 spots for SRR7230793.sra Written 826634 spots for SRR7230793.sra Read 826634 spots for SRR7230793.sra Written 826634 spots for SRR7230793.sra Read 826634 spots for SRR7230793.sra Written 826634 spots for SRR7230793.sra Read 826634 spots for SRR7230793.sra Written 826634 spots for SRR7230793.sra Read 826634 spots for SRR7230793.sra Written 826634 spots for SRR7230793.sra SRR ids: ['SRR7230793.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w4g2_1bf SRR7230793.sra spots: 16532681 blocks: [[1, 826634], [826635, 1653268], [1653269, 2479902], [2479903, 3306536], [3306537, 4133170], [4133171, 4959804], [4959805, 5786438], [5786439, 6613072], [6613073, 7439706], [7439707, 8266340], [8266341, 9092974], [9092975, 9919608], [9919609, 10746242], [10746243, 11572876], [11572877, 12399510], [12399511, 13226144], [13226145, 14052778], [14052779, 14879412], [14879413, 15706046], [15706047, 16532681]] SRR7230793 file size 5580682 SRR7230793 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230793 SRR7230793_1.fastq SRR7230793_2.fastq Input file: SRR7230793_1.fastq Paired file: SRR7230793_2.fastq trimmed: SRR7230793-trimmed-pair1.fastq, SRR7230793-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:31:53 2025 >> started Tue Feb 11 07:33:26 2025 >> done (93.085s) 16532681 read pairs processed; of these: 16842 ( 0.10%) short read pairs filtered out after trimming by size control 19725 ( 0.12%) empty read pairs filtered out after trimming by size control 16496114 (99.78%) read pairs available; of these: 8478926 (51.40%) trimmed read pairs available after processing 8017188 (48.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 6 0.00% 21 6 0.00% 22 1 0.00% 23 4 0.00% 24 6 0.00% 25 8 0.00% 26 4 0.00% 27 11 0.00% 28 7 0.00% 29 4 0.00% 30 18 0.00% 31 15 0.00% 32 9 0.00% 33 16 0.00% 34 11 0.00% 35 21 0.00% 36 20 0.00% 37 11 0.00% 38 18 0.00% 39 29 0.00% 40 21 0.00% 41 38 0.00% 42 52 0.00% 43 48 0.00% 44 53 0.00% 45 51 0.00% 46 60 0.00% 47 75 0.00% 48 98 0.00% 49 95 0.00% 50 121 0.00% 51 148 0.00% 52 155 0.00% 53 162 0.00% 54 171 0.00% 55 193 0.00% 56 231 0.00% 57 259 0.00% 58 288 0.00% 59 302 0.00% 60 402 0.00% 61 469 0.00% 62 499 0.00% 63 566 0.00% 64 685 0.00% 65 799 0.00% 66 807 0.00% 67 966 0.01% 68 1414 0.01% 69 2960 0.02% 70 2040 0.01% 71 1616 0.01% 72 1810 0.01% 73 1996 0.01% 74 2276 0.01% 75 2472 0.01% 76 2803 0.02% 77 3041 0.02% 78 3232 0.02% 79 3857 0.02% 80 4429 0.03% 81 4899 0.03% 82 5377 0.03% 83 6299 0.04% 84 8003 0.05% 85 8948 0.05% 86 9580 0.06% 87 10097 0.06% 88 10852 0.07% 89 11587 0.07% 90 12533 0.08% 91 13541 0.08% 92 14556 0.09% 93 16357 0.10% 94 17057 0.10% 95 18336 0.11% 96 19385 0.12% 97 20581 0.12% 98 21380 0.13% 99 22620 0.14% 100 23810 0.14% 101 24587 0.15% 102 26608 0.16% 103 28544 0.17% 104 30195 0.18% 105 31314 0.19% 106 32679 0.20% 107 34019 0.21% 108 35461 0.21% 109 37495 0.23% 110 38758 0.23% 111 39486 0.24% 112 41439 0.25% 113 43342 0.26% 114 45068 0.27% 115 47396 0.29% 116 48854 0.30% 117 49425 0.30% 118 51128 0.31% 119 52725 0.32% 120 54315 0.33% 121 55931 0.34% 122 57695 0.35% 123 60121 0.36% 124 62409 0.38% 125 64208 0.39% 126 66057 0.40% 127 67828 0.41% 128 68816 0.42% 129 71286 0.43% 130 72984 0.44% 131 75508 0.46% 132 77760 0.47% 133 81042 0.49% 134 83818 0.51% 135 87945 0.53% 136 90025 0.55% 137 94832 0.57% 138 98621 0.60% 139 103799 0.63% 140 106042 0.64% 141 113792 0.69% 142 120986 0.73% 143 131796 0.80% 144 148018 0.90% 145 173480 1.05% 146 204088 1.24% 147 260343 1.58% 148 371759 2.25% 149 707037 4.29% 150 3590274 21.76% 151 8017188 48.60% 16496114 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=13 prefix-density=0.65 prefix-fanout=2.3 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=72.70 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.8 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=0.47 prefix-fanout=2.0 sequence=CTACCCATGTTTGGATGCACTGAGGCATCTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=52.88 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.2 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT SRR7230793 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:34:09 Started mapping on | Feb 11 07:34:09 Finished on | Feb 11 07:36:12 Mapping speed, Million of reads per hour | 482.81 Number of input reads | 16496114 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 15090623 Uniquely mapped reads % | 91.48% Average mapped length | 290.35 Number of splices: Total | 13148485 Number of splices: Annotated (sjdb) | 12814244 Number of splices: GT/AG | 12880232 Number of splices: GC/AG | 221387 Number of splices: AT/AC | 8486 Number of splices: Non-canonical | 38380 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.51 Insertion rate per base | 0.03% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 403346 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 222068 % of reads mapped to too many loci | 1.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.41% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1017568 1017568 1017568 N_multimapping 403346 403346 403346 N_noFeature 715698 14717926 848693 N_ambiguous 342444 1337 101933 UnstrandedReadsAssigned:14032481 PositiveStrandReadsAssigned:371360 NegativeStrandReadsAssigned:14139997 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7230793 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230793-trimmed-pair1.fastq SRR7230793-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,496,114 reads, 14,259,569 reads pseudoaligned [quant] estimated average fragment length: 215.562 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR7230793.ke.tsv 34699 SRR7230793.se.tsv 87100 total ==> SRR7230793.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1803.44 579 18.3746 Potri.005G024800.1.v4.1 1035 820.438 177 12.3472 Potri.004G059700.1.v4.1 961 746.453 15 1.15008 Potri.007G009000.2.v4.1 1416 1201.44 0 0 Potri.003G141000.2.v4.1 2943 2728.44 791.049 16.5932 Potri.016G087400.1.v4.1 270 92.1874 735.762 456.78 Potri.015G069301.1.v4.1 564 352.296 0 0 Potri.010G195200.1.v4.1 1773 1558.44 28 1.02827 Potri.012G127500.1.v4.1 977 762.448 94 7.056 ==> SRR7230793.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 805 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 464 Potri.001G212900.v4.1 25 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7230793 completed mapping pipeline successfully