Starting /dee2/code/volunteer_pipeline.sh SRR7230794 current disk space = 3055094673408 free memory = 1560436324 SRR7230794 SRAfilesize 5ace981eb2d320be8a2e310cdb9c88e4 SRR7230794.sra SRR7230794.sra file validated SRR7230794 is paired end SRR7230794 is conventional basespace SRR7230794 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230794_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9265 34.0 33.0 34.0 32.0 34.0 2 32.9165 34.0 33.0 34.0 32.0 34.0 3 32.9615 34.0 33.0 34.0 32.0 34.0 4 32.999 34.0 33.0 34.0 32.0 34.0 5 33.1265 34.0 33.0 34.0 32.0 34.0 6 36.771 38.0 37.0 38.0 35.0 38.0 7 37.16125 38.0 38.0 38.0 36.0 38.0 8 37.22625 38.0 38.0 38.0 36.0 38.0 9 37.2505 38.0 38.0 38.0 37.0 38.0 10-14 37.348400000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.2461 38.0 38.0 38.0 36.8 38.0 20-24 37.11355 38.0 38.0 38.0 36.2 38.0 25-29 36.95745000000001 38.0 38.0 38.0 36.0 38.0 30-34 36.956050000000005 38.0 38.0 38.0 35.8 38.0 35-39 37.01175 38.0 38.0 38.0 36.0 38.0 40-44 36.9885 38.0 38.0 38.0 36.0 38.0 45-49 36.9447 38.0 38.0 38.0 36.0 38.0 50-54 36.89065000000001 38.0 38.0 38.0 35.2 38.0 55-59 36.72005 38.0 38.0 38.0 34.8 38.0 60-64 36.63465 38.0 38.0 38.0 34.6 38.0 65-69 36.73745 38.0 38.0 38.0 34.6 38.0 70-74 36.1476 38.0 37.4 38.0 32.4 38.0 75-79 36.408699999999996 38.0 37.8 38.0 33.8 38.0 80-84 36.38945 38.0 38.0 38.0 34.0 38.0 85-89 36.2206 38.0 37.6 38.0 33.6 38.0 90-94 35.9078 38.0 37.0 38.0 31.6 38.0 95-99 35.66545 38.0 36.6 38.0 30.8 38.0 100-104 35.30265 38.0 36.4 38.0 29.0 38.0 105-109 34.70895 38.0 35.4 38.0 25.0 38.0 110-114 35.331 38.0 36.0 38.0 29.0 38.0 115-119 34.95485 38.0 35.4 38.0 27.4 38.0 120-124 34.875249999999994 38.0 35.2 38.0 27.6 38.0 125-129 34.18155 38.0 34.6 38.0 22.0 38.0 130-134 33.730450000000005 38.0 34.2 38.0 21.0 38.0 135-139 33.0596 38.0 33.6 38.0 16.2 38.0 140-144 32.4673 37.6 32.4 38.0 14.0 38.0 145-149 30.7332 36.0 30.6 38.0 8.6 38.0 150-151 25.511000000000003 33.5 14.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 2.0 12 0.0 13 2.0 14 1.0 15 1.0 16 6.0 17 1.0 18 3.0 19 6.0 20 7.0 21 2.0 22 10.0 23 17.0 24 16.0 25 31.0 26 26.0 27 38.0 28 46.0 29 65.0 30 73.0 31 103.0 32 116.0 33 160.0 34 283.0 35 382.0 36 803.0 37 1798.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.71309771309771 14.838877338877337 7.5623700623700625 29.885654885654883 2 19.875 19.625 36.65 23.849999999999998 3 18.829707426856714 28.032008002000502 26.25656414103526 26.881720430107524 4 23.200000000000003 34.65 21.525 20.625 5 22.275 36.75 22.1 18.875 6 17.1 36.075 26.625 20.200000000000003 7 12.675 23.849999999999998 44.85 18.625 8 16.650000000000002 22.075 32.975 28.299999999999997 9 18.15 22.15 32.05 27.650000000000002 10-14 19.89 29.544999999999998 26.855 23.71 15-19 20.165 27.865000000000002 27.97 24.0 20-24 20.395 28.825 27.169999999999998 23.61 25-29 19.82 28.910000000000004 27.765 23.505000000000003 30-34 19.78 28.87 27.694999999999997 23.655 35-39 20.055 28.715000000000003 27.500000000000004 23.73 40-44 19.98 28.37 27.965 23.685000000000002 45-49 19.900000000000002 29.18 26.795 24.125 50-54 19.805 28.470000000000002 27.975 23.75 55-59 20.275000000000002 28.89 27.38 23.455000000000002 60-64 20.349999999999998 28.7 27.589999999999996 23.36 65-69 19.85 28.63 27.83 23.69 70-74 20.125 29.205 27.155 23.515 75-79 19.865 29.07 27.68 23.385 80-84 20.39815926370548 28.87154861944778 27.435974389755902 23.294317727090835 85-89 19.75648862611484 28.534923339011925 28.32448141096302 23.38410662391021 90-94 20.568050894154187 28.973601162149976 27.270450333116266 23.187897610579572 95-99 20.705000000000002 28.415000000000003 27.650000000000002 23.23 100-104 19.786956084815596 28.459451311425987 27.861521455130138 23.892071148628276 105-109 19.938834854106087 28.161034793943646 28.0657775995187 23.834352752431563 110-114 20.630000000000003 28.384999999999998 27.779999999999998 23.205000000000002 115-119 20.630000000000003 28.65 27.560000000000002 23.16 120-124 20.39 28.87 27.415 23.325000000000003 125-129 20.635 28.965000000000003 26.845000000000002 23.555 130-134 21.325 28.34 27.02 23.315 135-139 20.97 28.22 27.025 23.785 140-144 20.825 28.485 26.840000000000003 23.849999999999998 145-149 20.792079207920793 28.487848784878487 26.772677267726774 23.94739473947395 150-151 20.9 28.050000000000004 27.400000000000002 23.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 1.5 17 2.0 18 0.5 19 0.5 20 1.0 21 1.5 22 5.0 23 5.5 24 3.0 25 4.5 26 7.5 27 10.5 28 11.5 29 15.0 30 22.0 31 26.5 32 37.0 33 51.5 34 63.5 35 78.5 36 95.0 37 112.5 38 130.5 39 158.5 40 195.0 41 214.0 42 230.5 43 253.5 44 264.5 45 269.5 46 261.5 47 238.5 48 220.0 49 204.0 50 174.0 51 132.5 52 106.0 53 93.5 54 74.5 55 52.5 56 40.0 57 32.5 58 29.5 59 24.0 60 16.0 61 13.0 62 6.5 63 2.0 64 2.0 65 2.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.8 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.04 85-89 0.21 90-94 0.185 95-99 0.0 100-104 0.49 105-109 0.27 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31972789115646 98.55000000000001 2 0.6046863189720333 1.2 3 0.05039052658100278 0.15 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.1124999999999998 0.0 0.0 0.0 0.0 112-113 1.3125 0.0 0.0 0.0 0.0 114-115 1.5125 0.0 0.0 0.0 0.0 116-117 1.7999999999999998 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.2 0.0 0.0 0.0 0.0 122-123 2.5125 0.0 0.0 0.0 0.0 124-125 2.825 0.0 0.0 0.0 0.0 126-127 3.2125 0.0 0.0 0.0 0.0 128-129 3.675 0.0 0.0 0.0 0.0 130-131 4.0875 0.0 0.0 0.0 0.0 132-133 4.475 0.0 0.0 0.0 0.0 134-135 4.7125 0.0 0.0 0.0 0.0 136-137 5.1 0.0 0.0 0.0 0.0 138-139 5.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7230794 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230794_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7055 33.0 33.0 34.0 32.0 34.0 2 32.84225 34.0 33.0 34.0 32.0 34.0 3 32.86775 34.0 33.0 34.0 32.0 34.0 4 32.65625 34.0 33.0 34.0 32.0 34.0 5 32.68975 34.0 33.0 34.0 32.0 34.0 6 36.769 38.0 38.0 38.0 36.0 38.0 7 36.86725 38.0 38.0 38.0 36.0 38.0 8 36.7935 38.0 38.0 38.0 36.0 38.0 9 36.70325 38.0 38.0 38.0 36.0 38.0 10-14 36.369150000000005 38.0 37.8 38.0 33.8 38.0 15-19 36.67335 38.0 38.0 38.0 35.4 38.0 20-24 36.64585 38.0 38.0 38.0 35.8 38.0 25-29 36.6024 38.0 38.0 38.0 35.4 38.0 30-34 36.2481 38.0 38.0 38.0 33.4 38.0 35-39 36.47315 38.0 38.0 38.0 34.8 38.0 40-44 36.4103 38.0 38.0 38.0 34.4 38.0 45-49 36.3411 38.0 38.0 38.0 33.8 38.0 50-54 36.42715 38.0 38.0 38.0 34.6 38.0 55-59 36.47835 38.0 38.0 38.0 35.0 38.0 60-64 36.385349999999995 38.0 38.0 38.0 34.4 38.0 65-69 36.3517 38.0 38.0 38.0 34.2 38.0 70-74 36.0504 38.0 38.0 38.0 32.8 38.0 75-79 36.097350000000006 38.0 38.0 38.0 33.6 38.0 80-84 36.0647 38.0 38.0 38.0 33.4 38.0 85-89 35.96245 38.0 38.0 38.0 33.0 38.0 90-94 35.59335 38.0 37.8 38.0 31.0 38.0 95-99 35.70545 38.0 37.4 38.0 31.8 38.0 100-104 35.69215 38.0 37.2 38.0 31.4 38.0 105-109 35.193 38.0 36.8 38.0 28.4 38.0 110-114 35.1065 38.0 36.6 38.0 28.6 38.0 115-119 35.0281 38.0 36.0 38.0 28.0 38.0 120-124 34.83900000000001 38.0 36.0 38.0 27.2 38.0 125-129 34.17205 38.0 35.2 38.0 23.2 38.0 130-134 33.415099999999995 38.0 34.2 38.0 19.4 38.0 135-139 32.816199999999995 38.0 33.4 38.0 17.0 38.0 140-144 32.39164999999999 38.0 32.4 38.0 13.6 38.0 145-149 31.3344 38.0 31.8 38.0 8.6 38.0 150-151 27.308 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 8.0 4 3.0 5 1.0 6 4.0 7 1.0 8 5.0 9 2.0 10 5.0 11 1.0 12 2.0 13 2.0 14 5.0 15 3.0 16 7.0 17 9.0 18 8.0 19 12.0 20 7.0 21 13.0 22 12.0 23 23.0 24 22.0 25 27.0 26 31.0 27 31.0 28 41.0 29 44.0 30 66.0 31 64.0 32 108.0 33 149.0 34 179.0 35 312.0 36 671.0 37 2109.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.025 20.599999999999998 10.15 22.225 2 24.2 25.624999999999996 33.324999999999996 16.85 3 20.875 26.724999999999998 32.824999999999996 19.575 4 24.474999999999998 34.75 22.075 18.7 5 23.474999999999998 37.525 22.5 16.5 6 18.525 38.05 24.675 18.75 7 19.55 20.025000000000002 40.550000000000004 19.875 8 19.1 22.625 30.5 27.775 9 22.6 23.175 28.95 25.275 10-14 23.18 29.085 26.43 21.305 15-19 23.085 28.04 28.175 20.7 20-24 22.955000000000002 28.360000000000003 28.08 20.605 25-29 23.105 28.465 28.075 20.355 30-34 23.005 28.335 28.050000000000004 20.61 35-39 22.705000000000002 28.16 27.965 21.17 40-44 23.075000000000003 27.715 28.71 20.5 45-49 23.11 27.634999999999998 28.025 21.23 50-54 23.145 28.105000000000004 27.925 20.825 55-59 22.6 27.284999999999997 28.83 21.285 60-64 23.355 27.839999999999996 27.85 20.955 65-69 23.035 27.445000000000004 28.71 20.810000000000002 70-74 22.865 27.384999999999998 27.889999999999997 21.86 75-79 23.24 27.400000000000002 28.000000000000004 21.36 80-84 23.16 27.534999999999997 27.96 21.345 85-89 23.75 28.265 27.245 20.74 90-94 23.47 27.87 27.74 20.919999999999998 95-99 23.485 27.765 28.375 20.375 100-104 22.905 27.83 28.16 21.105 105-109 23.189999999999998 27.76 28.43 20.62 110-114 23.985 28.03 27.83 20.155 115-119 23.56 28.255000000000003 27.62 20.565 120-124 24.08 27.560000000000002 27.965 20.395 125-129 23.93 27.73 27.839999999999996 20.5 130-134 23.93 27.93 27.665 20.474999999999998 135-139 24.535 27.515 27.485 20.465 140-144 24.465 27.445000000000004 27.560000000000002 20.53 145-149 24.515 27.589999999999996 27.894999999999996 20.0 150-151 24.775 28.8875 27.275 19.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 1.0 21 1.0 22 0.0 23 1.0 24 2.5 25 2.0 26 2.0 27 8.0 28 15.0 29 17.0 30 19.0 31 27.0 32 34.0 33 39.0 34 48.0 35 65.0 36 92.0 37 125.5 38 135.5 39 155.0 40 200.0 41 225.0 42 243.5 43 244.5 44 270.5 45 276.5 46 248.0 47 227.5 48 211.0 49 197.0 50 161.5 51 139.5 52 119.0 53 101.0 54 85.0 55 59.5 56 49.0 57 42.0 58 29.0 59 21.0 60 15.5 61 14.5 62 10.0 63 5.5 64 4.0 65 1.5 66 1.0 67 0.5 68 0.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19171507956554 98.175 2 0.7072493053801465 1.4000000000000001 3 0.050517807527153326 0.15 4 0.0 0.0 5 0.025258903763576663 0.125 6 0.025258903763576663 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.2375 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.725 0.0 0.0 0.0 0.0 118-119 1.925 0.0 0.0 0.0 0.0 120-121 2.1125 0.0 0.0 0.0 0.0 122-123 2.4000000000000004 0.0 0.0 0.0 0.0 124-125 2.675 0.0 0.0 0.0 0.0 126-127 3.05 0.0 0.0 0.0 0.0 128-129 3.525 0.0 0.0 0.0 0.0 130-131 3.95 0.0 0.0 0.0 0.0 132-133 4.425000000000001 0.0 0.0 0.0 0.0 134-135 4.6625 0.0 0.0 0.0 0.0 136-137 5.0375 0.0 0.0 0.0 0.0 138-139 5.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTTGGT 10 0.006830828 145.0 1 >>END_MODULE Read 920317 spots for SRR7230794.sra Written 920317 spots for SRR7230794.sra Read 920317 spots for SRR7230794.sra Written 920317 spots for SRR7230794.sra Read 920317 spots for SRR7230794.sra Written 920317 spots for SRR7230794.sra Read 920317 spots for SRR7230794.sra Written 920317 spots for SRR7230794.sra Read 920317 spots for SRR7230794.sra Written 920317 spots for SRR7230794.sra Read 920317 spots for SRR7230794.sra Written 920317 spots for SRR7230794.sra Read 920317 spots for SRR7230794.sra Written 920317 spots for SRR7230794.sra Read 920317 spots for SRR7230794.sra Written 920317 spots for SRR7230794.sra Read 920317 spots for SRR7230794.sra Written 920317 spots for SRR7230794.sra Read 920317 spots for SRR7230794.sra Written 920317 spots for SRR7230794.sra Read 920317 spots for SRR7230794.sra Written 920317 spots for SRR7230794.sra Read 920323 spots for SRR7230794.sra Written 920323 spots for SRR7230794.sra Read 920317 spots for SRR7230794.sra Written 920317 spots for SRR7230794.sra Read 920317 spots for SRR7230794.sra Written 920317 spots for SRR7230794.sra Read 920317 spots for SRR7230794.sra Written 920317 spots for SRR7230794.sra Read 920317 spots for SRR7230794.sra Written 920317 spots for SRR7230794.sra Read 920317 spots for SRR7230794.sra Written 920317 spots for SRR7230794.sra Read 920317 spots for SRR7230794.sra Written 920317 spots for SRR7230794.sra Read 920317 spots for SRR7230794.sra Written 920317 spots for SRR7230794.sra Read 920317 spots for SRR7230794.sra Written 920317 spots for SRR7230794.sra SRR ids: ['SRR7230794.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uqwxtbl_ SRR7230794.sra spots: 18406346 blocks: [[1, 920317], [920318, 1840634], [1840635, 2760951], [2760952, 3681268], [3681269, 4601585], [4601586, 5521902], [5521903, 6442219], [6442220, 7362536], [7362537, 8282853], [8282854, 9203170], [9203171, 10123487], [10123488, 11043804], [11043805, 11964121], [11964122, 12884438], [12884439, 13804755], [13804756, 14725072], [14725073, 15645389], [15645390, 16565706], [16565707, 17486023], [17486024, 18406346]] SRR7230794 file size 6215606 SRR7230794 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230794 SRR7230794_1.fastq SRR7230794_2.fastq Input file: SRR7230794_1.fastq Paired file: SRR7230794_2.fastq trimmed: SRR7230794-trimmed-pair1.fastq, SRR7230794-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:35:49 2025 >> started Tue Feb 11 07:36:08 2025 >> done (19.822s) 18406346 read pairs processed; of these: 27340 ( 0.15%) short read pairs filtered out after trimming by size control 17406 ( 0.09%) empty read pairs filtered out after trimming by size control 18361600 (99.76%) read pairs available; of these: 10249614 (55.82%) trimmed read pairs available after processing 8111986 (44.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 6 0.00% 21 4 0.00% 22 6 0.00% 23 9 0.00% 24 12 0.00% 25 15 0.00% 26 14 0.00% 27 15 0.00% 28 12 0.00% 29 8 0.00% 30 21 0.00% 31 10 0.00% 32 21 0.00% 33 20 0.00% 34 8 0.00% 35 25 0.00% 36 20 0.00% 37 25 0.00% 38 24 0.00% 39 26 0.00% 40 38 0.00% 41 40 0.00% 42 33 0.00% 43 46 0.00% 44 43 0.00% 45 46 0.00% 46 54 0.00% 47 57 0.00% 48 58 0.00% 49 88 0.00% 50 88 0.00% 51 104 0.00% 52 114 0.00% 53 106 0.00% 54 144 0.00% 55 177 0.00% 56 172 0.00% 57 190 0.00% 58 218 0.00% 59 255 0.00% 60 266 0.00% 61 329 0.00% 62 345 0.00% 63 446 0.00% 64 458 0.00% 65 535 0.00% 66 507 0.00% 67 608 0.00% 68 731 0.00% 69 972 0.01% 70 1075 0.01% 71 1096 0.01% 72 1107 0.01% 73 1321 0.01% 74 1530 0.01% 75 1597 0.01% 76 1698 0.01% 77 1936 0.01% 78 2231 0.01% 79 2467 0.01% 80 2841 0.02% 81 3026 0.02% 82 3507 0.02% 83 4125 0.02% 84 5577 0.03% 85 6419 0.03% 86 6814 0.04% 87 7448 0.04% 88 7867 0.04% 89 8408 0.05% 90 8813 0.05% 91 9508 0.05% 92 9842 0.05% 93 10601 0.06% 94 11041 0.06% 95 11862 0.06% 96 12390 0.07% 97 13059 0.07% 98 13816 0.08% 99 14717 0.08% 100 15731 0.09% 101 16216 0.09% 102 17091 0.09% 103 18244 0.10% 104 19117 0.10% 105 20216 0.11% 106 21389 0.12% 107 22376 0.12% 108 23625 0.13% 109 24982 0.14% 110 26178 0.14% 111 27289 0.15% 112 28578 0.16% 113 30270 0.16% 114 31329 0.17% 115 32681 0.18% 116 34173 0.19% 117 36123 0.20% 118 37602 0.20% 119 38774 0.21% 120 40890 0.22% 121 42468 0.23% 122 44843 0.24% 123 47048 0.26% 124 49412 0.27% 125 51333 0.28% 126 53944 0.29% 127 56739 0.31% 128 59894 0.33% 129 62873 0.34% 130 65943 0.36% 131 69420 0.38% 132 73636 0.40% 133 77497 0.42% 134 82172 0.45% 135 88018 0.48% 136 92780 0.51% 137 100316 0.55% 138 107794 0.59% 139 117854 0.64% 140 126969 0.69% 141 141211 0.77% 142 157723 0.86% 143 179336 0.98% 144 207892 1.13% 145 246865 1.34% 146 309892 1.69% 147 417729 2.28% 148 619039 3.37% 149 1169579 6.37% 150 4571204 24.90% 151 8111986 44.18% 18361600 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=21 prefix-density=0.51 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=406.74 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=18.1 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGT criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=26 prefix-density=0.75 prefix-fanout=2.0 sequence=ACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=68.78 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.7 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGC SRR7230794 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:36:54 Started mapping on | Feb 11 07:36:54 Finished on | Feb 11 07:39:12 Mapping speed, Million of reads per hour | 479.00 Number of input reads | 18361600 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 16965546 Uniquely mapped reads % | 92.40% Average mapped length | 292.49 Number of splices: Total | 16229871 Number of splices: Annotated (sjdb) | 15863527 Number of splices: GT/AG | 15904350 Number of splices: GC/AG | 265074 Number of splices: AT/AC | 9023 Number of splices: Non-canonical | 51424 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 503799 % of reads mapped to multiple loci | 2.74% Number of reads mapped to too many loci | 123555 % of reads mapped to too many loci | 0.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.03% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 923373 923373 923373 N_multimapping 503799 503799 503799 N_noFeature 710708 16660535 846676 N_ambiguous 296977 1255 127108 UnstrandedReadsAssigned:15957861 PositiveStrandReadsAssigned:303756 NegativeStrandReadsAssigned:15991762 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7230794 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230794-trimmed-pair1.fastq SRR7230794-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,361,600 reads, 16,060,526 reads pseudoaligned [quant] estimated average fragment length: 250.715 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52401 SRR7230794.ke.tsv 34699 SRR7230794.se.tsv 87100 total ==> SRR7230794.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.29 756 24.8978 Potri.005G024800.1.v4.1 1035 785.285 149 11.0497 Potri.004G059700.1.v4.1 961 711.344 5 0.409338 Potri.007G009000.2.v4.1 1416 1166.29 0 0 Potri.003G141000.2.v4.1 2943 2693.29 1122.49 24.2712 Potri.016G087400.1.v4.1 270 80.8024 656 472.793 Potri.015G069301.1.v4.1 564 321.378 0 0 Potri.010G195200.1.v4.1 1773 1523.29 118.932 4.54682 Potri.012G127500.1.v4.1 977 727.312 128 10.249 ==> SRR7230794.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 735 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 246 Potri.001G212900.v4.1 24 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7230794 completed mapping pipeline successfully