Starting /dee2/code/volunteer_pipeline.sh SRR7230795 current disk space = 3055122501632 free memory = 1560430716 SRR7230795 SRAfilesize df816ef382aa3bfb462a803675d2d3f3 SRR7230795.sra SRR7230795.sra file validated SRR7230795 is paired end SRR7230795 is conventional basespace SRR7230795 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230795_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7425 34.0 33.0 34.0 32.0 34.0 2 32.811 34.0 33.0 34.0 31.0 34.0 3 32.899 34.0 33.0 34.0 32.0 34.0 4 32.9855 34.0 33.0 34.0 32.0 34.0 5 33.088 34.0 33.0 34.0 32.0 34.0 6 36.81225 38.0 37.0 38.0 35.0 38.0 7 37.1525 38.0 38.0 38.0 36.0 38.0 8 37.208 38.0 38.0 38.0 36.0 38.0 9 37.3165 38.0 38.0 38.0 37.0 38.0 10-14 37.29815 38.0 38.0 38.0 37.0 38.0 15-19 37.233799999999995 38.0 38.0 38.0 36.8 38.0 20-24 37.13625 38.0 38.0 38.0 36.4 38.0 25-29 37.009699999999995 38.0 38.0 38.0 36.0 38.0 30-34 37.019400000000005 38.0 38.0 38.0 36.0 38.0 35-39 37.03054999999999 38.0 38.0 38.0 36.0 38.0 40-44 36.963049999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.931349999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.954550000000005 38.0 38.0 38.0 36.0 38.0 55-59 36.7598 38.0 38.0 38.0 35.0 38.0 60-64 36.7182 38.0 38.0 38.0 34.8 38.0 65-69 36.6759 38.0 38.0 38.0 34.6 38.0 70-74 36.1477 38.0 37.4 38.0 32.4 38.0 75-79 36.3665 38.0 37.8 38.0 33.8 38.0 80-84 36.3752 38.0 38.0 38.0 33.8 38.0 85-89 36.217 38.0 37.8 38.0 33.6 38.0 90-94 36.017849999999996 38.0 37.0 38.0 32.8 38.0 95-99 35.666450000000005 38.0 36.6 38.0 30.4 38.0 100-104 35.419399999999996 38.0 36.8 38.0 30.0 38.0 105-109 34.839000000000006 38.0 35.6 38.0 25.6 38.0 110-114 35.32505 38.0 36.0 38.0 28.6 38.0 115-119 35.0866 38.0 35.6 38.0 27.8 38.0 120-124 34.950599999999994 38.0 35.4 38.0 27.4 38.0 125-129 34.19285 38.0 34.6 38.0 21.8 38.0 130-134 33.8711 38.0 34.2 38.0 22.2 38.0 135-139 33.19035 38.0 33.8 38.0 17.4 38.0 140-144 32.61815 38.0 32.4 38.0 14.2 38.0 145-149 30.980849999999997 36.6 31.0 38.0 8.6 38.0 150-151 25.993625 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 2.0 6 0.0 7 0.0 8 2.0 9 0.0 10 0.0 11 2.0 12 1.0 13 2.0 14 1.0 15 2.0 16 1.0 17 2.0 18 3.0 19 2.0 20 4.0 21 8.0 22 12.0 23 10.0 24 11.0 25 18.0 26 45.0 27 39.0 28 41.0 29 67.0 30 70.0 31 94.0 32 126.0 33 162.0 34 256.0 35 388.0 36 767.0 37 1860.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.549019607843135 15.686274509803921 9.254901960784313 26.509803921568626 2 20.925 19.275000000000002 33.925 25.874999999999996 3 19.204801200300075 28.582145536384097 26.481620405101275 25.731432858214554 4 22.35 33.825 23.549999999999997 20.275000000000002 5 21.825 36.375 23.95 17.849999999999998 6 18.625 34.725 26.150000000000002 20.5 7 14.524999999999999 23.549999999999997 42.95 18.975 8 17.075000000000003 22.45 31.3 29.175 9 18.4 22.25 32.6 26.75 10-14 20.355 29.335 26.395000000000003 23.915 15-19 19.81 28.125 27.74 24.325 20-24 19.84 28.215 28.24 23.705000000000002 25-29 19.72 28.810000000000002 28.09 23.380000000000003 30-34 19.830000000000002 28.575 27.900000000000002 23.695 35-39 20.445 28.335 28.110000000000003 23.11 40-44 20.135 28.335 28.110000000000003 23.419999999999998 45-49 20.59 28.544999999999998 27.165 23.7 50-54 19.775000000000002 28.15 28.185 23.89 55-59 20.150000000000002 28.465 27.52 23.865 60-64 20.4 28.655 27.584999999999997 23.36 65-69 20.565 28.360000000000003 27.29 23.785 70-74 20.175 28.939999999999998 27.21 23.674999999999997 75-79 20.09 28.215 28.005000000000003 23.69 80-84 20.609121824364873 28.080616123224644 27.475495099019803 23.83476695339068 85-89 20.91054793148352 28.48843033156366 26.90073124311329 23.700290493839525 90-94 20.579695634761713 28.163796555867037 28.003604325190228 23.25290348418102 95-99 20.77 28.025 27.46 23.745 100-104 20.59355227478156 28.964547554484284 26.79019785075826 23.651702319975897 105-109 20.531195189175644 28.73966424455024 27.30643948884991 23.422701077424204 110-114 20.875 27.644999999999996 27.565 23.915 115-119 21.04 28.139999999999997 27.515 23.305 120-124 20.84 28.285 27.11 23.765 125-129 20.815 28.17 27.015 24.0 130-134 21.265 28.815 26.245 23.674999999999997 135-139 21.18 28.335 27.07 23.415 140-144 21.255 28.07 26.889999999999997 23.785 145-149 20.936046802340115 28.626431321566077 26.87634381719086 23.561178058902946 150-151 21.4125 28.237499999999997 26.987499999999997 23.3625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 2.5 24 4.0 25 4.5 26 5.5 27 8.0 28 10.5 29 16.0 30 21.0 31 33.0 32 46.0 33 46.5 34 54.5 35 70.5 36 88.5 37 112.0 38 137.0 39 157.0 40 184.0 41 211.0 42 230.5 43 266.0 44 259.0 45 237.5 46 249.5 47 248.0 48 227.5 49 203.5 50 176.5 51 148.0 52 122.5 53 102.0 54 78.0 55 55.5 56 47.5 57 36.0 58 25.0 59 20.5 60 18.0 61 13.0 62 7.5 63 3.5 64 2.5 65 1.0 66 1.0 67 1.5 68 1.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.375 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.02 85-89 0.16999999999999998 90-94 0.12 95-99 0.0 100-104 0.43 105-109 0.22499999999999998 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29471032745592 98.55000000000001 2 0.654911838790932 1.3 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.125 0.0 0.0 0.0 0.0 98-99 1.3375 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.575 0.0 0.0 0.0 0.0 104-105 1.7875 0.0 0.0 0.0 0.0 106-107 2.0875 0.0 0.0 0.0 0.0 108-109 2.4000000000000004 0.0 0.0 0.0 0.0 110-111 2.6 0.0 0.0 0.0 0.0 112-113 2.8125 0.0 0.0 0.0 0.0 114-115 3.175 0.0 0.0 0.0 0.0 116-117 3.5625 0.0 0.0 0.0 0.0 118-119 3.9124999999999996 0.0 0.0 0.0 0.0 120-121 4.387499999999999 0.0 0.0 0.0 0.0 122-123 4.875 0.0 0.0 0.0 0.0 124-125 5.25 0.0 0.0 0.0 0.0 126-127 5.6625 0.0 0.0 0.0 0.0 128-129 6.1 0.0 0.0 0.0 0.0 130-131 6.6 0.0 0.0 0.0 0.0 132-133 7.2625 0.0 0.0 0.0 0.0 134-135 7.800000000000001 0.0 0.0 0.0 0.0 136-137 8.3125 0.0 0.0 0.0 0.0 138-139 8.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGAGA 10 0.0069196247 144.375 6 GGTAGAG 10 0.0069196247 144.375 5 >>END_MODULE SRR7230795 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230795_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.83075 33.0 33.0 34.0 32.0 34.0 2 32.87475 34.0 33.0 34.0 32.0 34.0 3 32.845 34.0 33.0 34.0 32.0 34.0 4 32.72125 34.0 33.0 34.0 32.0 34.0 5 32.72025 34.0 33.0 34.0 32.0 34.0 6 36.78425 38.0 38.0 38.0 36.0 38.0 7 36.834 38.0 38.0 38.0 36.0 38.0 8 36.77325 38.0 38.0 38.0 36.0 38.0 9 36.8825 38.0 38.0 38.0 37.0 38.0 10-14 36.31955000000001 38.0 38.0 38.0 33.8 38.0 15-19 36.6483 38.0 38.0 38.0 35.8 38.0 20-24 36.61355 38.0 38.0 38.0 35.6 38.0 25-29 36.5261 38.0 38.0 38.0 35.6 38.0 30-34 36.26379999999999 38.0 38.0 38.0 34.0 38.0 35-39 36.51465 38.0 38.0 38.0 35.4 38.0 40-44 36.40135 38.0 38.0 38.0 34.8 38.0 45-49 36.27025 38.0 38.0 38.0 33.8 38.0 50-54 36.3909 38.0 38.0 38.0 34.8 38.0 55-59 36.3985 38.0 38.0 38.0 34.8 38.0 60-64 36.331450000000004 38.0 38.0 38.0 34.6 38.0 65-69 36.297000000000004 38.0 38.0 38.0 34.4 38.0 70-74 36.0194 38.0 38.0 38.0 33.4 38.0 75-79 36.091 38.0 38.0 38.0 33.8 38.0 80-84 35.99835 38.0 38.0 38.0 33.8 38.0 85-89 35.84695000000001 38.0 38.0 38.0 33.2 38.0 90-94 35.51395 38.0 37.8 38.0 30.8 38.0 95-99 35.56285 38.0 37.6 38.0 31.2 38.0 100-104 35.55735 38.0 37.6 38.0 31.4 38.0 105-109 35.039199999999994 38.0 36.8 38.0 28.0 38.0 110-114 34.957049999999995 38.0 36.6 38.0 27.6 38.0 115-119 34.9717 38.0 36.6 38.0 28.0 38.0 120-124 34.6349 38.0 36.0 38.0 25.8 38.0 125-129 34.05899999999999 38.0 35.2 38.0 22.6 38.0 130-134 33.1871 38.0 34.0 38.0 19.0 38.0 135-139 32.6051 38.0 33.4 38.0 14.2 38.0 140-144 32.1443 38.0 32.4 38.0 13.2 38.0 145-149 31.1235 38.0 31.6 38.0 6.4 38.0 150-151 27.209375 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 9.0 4 7.0 5 3.0 6 2.0 7 2.0 8 6.0 9 3.0 10 3.0 11 2.0 12 10.0 13 5.0 14 8.0 15 9.0 16 7.0 17 9.0 18 2.0 19 9.0 20 15.0 21 12.0 22 22.0 23 17.0 24 21.0 25 27.0 26 26.0 27 27.0 28 44.0 29 42.0 30 64.0 31 72.0 32 90.0 33 116.0 34 166.0 35 301.0 36 654.0 37 2175.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.825 18.6 11.425 22.15 2 23.425 25.35 33.7 17.525 3 20.65 26.8 32.574999999999996 19.975 4 25.55 35.175 21.65 17.625 5 24.7 36.125 21.375 17.8 6 19.6 36.525 24.55 19.325 7 19.475 18.875 41.125 20.525 8 20.3 22.25 29.9 27.55 9 22.825 24.45 28.299999999999997 24.425 10-14 23.635 28.439999999999998 26.565 21.36 15-19 23.525 27.750000000000004 27.66 21.065 20-24 22.835 28.375 27.655 21.135 25-29 23.474999999999998 27.894999999999996 28.075 20.555 30-34 23.474999999999998 27.060000000000002 28.544999999999998 20.919999999999998 35-39 22.825 28.175 28.04 20.96 40-44 23.055 27.92 28.449999999999996 20.575 45-49 23.025000000000002 27.634999999999998 28.310000000000002 21.029999999999998 50-54 22.55 27.150000000000002 28.73 21.57 55-59 23.345 27.544999999999998 28.144999999999996 20.965 60-64 23.200000000000003 27.944999999999997 28.005000000000003 20.849999999999998 65-69 22.73 28.15 28.175 20.945 70-74 23.080000000000002 26.939999999999998 28.410000000000004 21.57 75-79 23.044999999999998 27.865000000000002 27.689999999999998 21.4 80-84 23.44 28.249999999999996 27.61 20.7 85-89 23.369999999999997 27.975 28.32 20.335 90-94 24.065 28.1 27.384999999999998 20.45 95-99 23.474999999999998 27.705000000000002 28.015 20.805 100-104 23.445 28.000000000000004 27.935 20.62 105-109 23.56 27.785 28.115000000000002 20.54 110-114 24.095 28.235 27.35 20.32 115-119 24.33 28.77 27.189999999999998 19.71 120-124 23.605 28.349999999999998 27.76 20.285 125-129 24.44 28.189999999999998 26.805 20.565 130-134 24.69 27.77 27.57 19.97 135-139 25.055 27.694999999999997 27.02 20.23 140-144 24.91 27.455000000000002 27.339999999999996 20.294999999999998 145-149 25.785000000000004 28.105000000000004 26.815 19.295 150-151 25.7375 28.8375 25.7 19.725 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.5 18 1.5 19 1.0 20 1.5 21 3.0 22 3.0 23 4.0 24 6.5 25 6.0 26 7.5 27 7.5 28 10.0 29 14.5 30 14.0 31 20.0 32 29.0 33 41.5 34 50.5 35 57.5 36 79.0 37 107.0 38 124.5 39 156.0 40 189.5 41 204.5 42 238.5 43 258.0 44 276.0 45 265.0 46 242.5 47 260.5 48 245.5 49 201.0 50 167.5 51 143.5 52 111.5 53 95.5 54 88.0 55 65.0 56 48.5 57 41.0 58 27.5 59 21.5 60 17.0 61 8.0 62 10.5 63 10.0 64 5.0 65 2.0 66 0.5 67 1.0 68 0.5 69 1.5 70 1.5 71 0.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37059415911381 98.675 2 0.5538771399798591 1.0999999999999999 3 0.0755287009063444 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4875 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.7250000000000001 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.3875 0.0 0.0 0.0 0.0 100-101 1.4875 0.0 0.0 0.0 0.0 102-103 1.675 0.0 0.0 0.0 0.0 104-105 1.875 0.0 0.0 0.0 0.0 106-107 2.2125 0.0 0.0 0.0 0.0 108-109 2.5250000000000004 0.0 0.0 0.0 0.0 110-111 2.7125 0.0 0.0 0.0 0.0 112-113 2.9125 0.0 0.0 0.0 0.0 114-115 3.2750000000000004 0.0 0.0 0.0 0.0 116-117 3.6875 0.0 0.0 0.0 0.0 118-119 4.074999999999999 0.0 0.0 0.0 0.0 120-121 4.625 0.0 0.0 0.0 0.0 122-123 5.1 0.0 0.0 0.0 0.0 124-125 5.4625 0.0 0.0 0.0 0.0 126-127 5.8625 0.0 0.0 0.0 0.0 128-129 6.325 0.0 0.0 0.0 0.0 130-131 6.8375 0.0 0.0 0.0 0.0 132-133 7.5 0.0 0.0 0.0 0.0 134-135 8.0 0.0 0.0 0.0 0.0 136-137 8.4375 0.0 0.0 0.0 0.0 138-139 9.037500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTGGCC 10 0.006830828 145.0 6 GCCAAAG 10 0.006830828 145.0 145 >>END_MODULE Read 889158 spots for SRR7230795.sra Written 889158 spots for SRR7230795.sra Read 889158 spots for SRR7230795.sra Written 889158 spots for SRR7230795.sra Read 889158 spots for SRR7230795.sra Written 889158 spots for SRR7230795.sra Read 889158 spots for SRR7230795.sra Written 889158 spots for SRR7230795.sra Read 889158 spots for SRR7230795.sra Written 889158 spots for SRR7230795.sra Read 889158 spots for SRR7230795.sra Written 889158 spots for SRR7230795.sra Read 889158 spots for SRR7230795.sra Written 889158 spots for SRR7230795.sra Read 889158 spots for SRR7230795.sra Written 889158 spots for SRR7230795.sra Read 889158 spots for SRR7230795.sra Written 889158 spots for SRR7230795.sra Read 889158 spots for SRR7230795.sra Written 889158 spots for SRR7230795.sra Read 889158 spots for SRR7230795.sra Written 889158 spots for SRR7230795.sra Read 889158 spots for SRR7230795.sra Written 889158 spots for SRR7230795.sra Read 889165 spots for SRR7230795.sra Written 889165 spots for SRR7230795.sra Read 889158 spots for SRR7230795.sra Written 889158 spots for SRR7230795.sra Read 889158 spots for SRR7230795.sra Written 889158 spots for SRR7230795.sra Read 889158 spots for SRR7230795.sra Written 889158 spots for SRR7230795.sra Read 889158 spots for SRR7230795.sra Written 889158 spots for SRR7230795.sra Read 889158 spots for SRR7230795.sra Written 889158 spots for SRR7230795.sra Read 889158 spots for SRR7230795.sra Written 889158 spots for SRR7230795.sra Read 889158 spots for SRR7230795.sra Written 889158 spots for SRR7230795.sra SRR ids: ['SRR7230795.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3q2uabat SRR7230795.sra spots: 17783167 blocks: [[1, 889158], [889159, 1778316], [1778317, 2667474], [2667475, 3556632], [3556633, 4445790], [4445791, 5334948], [5334949, 6224106], [6224107, 7113264], [7113265, 8002422], [8002423, 8891580], [8891581, 9780738], [9780739, 10669896], [10669897, 11559054], [11559055, 12448212], [12448213, 13337370], [13337371, 14226528], [14226529, 15115686], [15115687, 16004844], [16004845, 16894002], [16894003, 17783167]] SRR7230795 file size 6004431 SRR7230795 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230795 SRR7230795_1.fastq SRR7230795_2.fastq Input file: SRR7230795_1.fastq Paired file: SRR7230795_2.fastq trimmed: SRR7230795-trimmed-pair1.fastq, SRR7230795-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:35:46 2025 >> started Tue Feb 11 07:36:05 2025 >> done (18.845s) 17783167 read pairs processed; of these: 36254 ( 0.20%) short read pairs filtered out after trimming by size control 22792 ( 0.13%) empty read pairs filtered out after trimming by size control 17724121 (99.67%) read pairs available; of these: 10217542 (57.65%) trimmed read pairs available after processing 7506579 (42.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 9 0.00% 20 8 0.00% 21 15 0.00% 22 7 0.00% 23 13 0.00% 24 10 0.00% 25 15 0.00% 26 13 0.00% 27 16 0.00% 28 21 0.00% 29 22 0.00% 30 28 0.00% 31 22 0.00% 32 28 0.00% 33 30 0.00% 34 20 0.00% 35 33 0.00% 36 29 0.00% 37 25 0.00% 38 40 0.00% 39 33 0.00% 40 42 0.00% 41 52 0.00% 42 62 0.00% 43 67 0.00% 44 67 0.00% 45 74 0.00% 46 75 0.00% 47 81 0.00% 48 112 0.00% 49 125 0.00% 50 139 0.00% 51 168 0.00% 52 155 0.00% 53 219 0.00% 54 196 0.00% 55 220 0.00% 56 268 0.00% 57 315 0.00% 58 354 0.00% 59 405 0.00% 60 458 0.00% 61 539 0.00% 62 561 0.00% 63 678 0.00% 64 738 0.00% 65 889 0.01% 66 951 0.01% 67 1014 0.01% 68 1232 0.01% 69 1846 0.01% 70 2214 0.01% 71 1966 0.01% 72 2263 0.01% 73 2328 0.01% 74 2586 0.01% 75 2987 0.02% 76 3152 0.02% 77 3637 0.02% 78 4061 0.02% 79 4635 0.03% 80 4905 0.03% 81 5594 0.03% 82 6288 0.04% 83 7114 0.04% 84 9421 0.05% 85 10626 0.06% 86 11192 0.06% 87 12187 0.07% 88 12973 0.07% 89 13673 0.08% 90 14028 0.08% 91 15236 0.09% 92 16246 0.09% 93 17266 0.10% 94 18038 0.10% 95 19578 0.11% 96 20287 0.11% 97 20565 0.12% 98 21686 0.12% 99 23028 0.13% 100 24095 0.14% 101 25197 0.14% 102 26427 0.15% 103 27695 0.16% 104 29256 0.17% 105 30287 0.17% 106 31432 0.18% 107 32573 0.18% 108 34390 0.19% 109 35875 0.20% 110 36792 0.21% 111 38483 0.22% 112 39774 0.22% 113 41708 0.24% 114 44118 0.25% 115 44656 0.25% 116 46552 0.26% 117 47136 0.27% 118 49359 0.28% 119 50168 0.28% 120 52911 0.30% 121 54357 0.31% 122 57071 0.32% 123 59004 0.33% 124 61435 0.35% 125 62687 0.35% 126 65221 0.37% 127 67457 0.38% 128 70123 0.40% 129 73266 0.41% 130 76055 0.43% 131 78730 0.44% 132 82681 0.47% 133 86838 0.49% 134 90837 0.51% 135 96624 0.55% 136 100678 0.57% 137 106203 0.60% 138 114127 0.64% 139 121905 0.69% 140 131334 0.74% 141 143037 0.81% 142 157779 0.89% 143 177595 1.00% 144 203961 1.15% 145 238179 1.34% 146 295052 1.66% 147 390595 2.20% 148 573668 3.24% 149 1070314 6.04% 150 4199542 23.69% 151 7506579 42.35% 17724121 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=20 prefix-density=0.44 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=541.80 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=19.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCT criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=22 prefix-density=0.58 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=65.63 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.9 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7230795 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:36:51 Started mapping on | Feb 11 07:36:51 Finished on | Feb 11 07:39:10 Mapping speed, Million of reads per hour | 459.04 Number of input reads | 17724121 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 16156631 Uniquely mapped reads % | 91.16% Average mapped length | 289.98 Number of splices: Total | 15212959 Number of splices: Annotated (sjdb) | 14855779 Number of splices: GT/AG | 14917939 Number of splices: GC/AG | 236461 Number of splices: AT/AC | 9066 Number of splices: Non-canonical | 49493 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 490655 % of reads mapped to multiple loci | 2.77% Number of reads mapped to too many loci | 164088 % of reads mapped to too many loci | 0.93% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.94% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1114876 1114876 1114876 N_multimapping 490655 490655 490655 N_noFeature 727179 15840137 888042 N_ambiguous 269558 1490 112828 UnstrandedReadsAssigned:15159894 PositiveStrandReadsAssigned:315004 NegativeStrandReadsAssigned:15155761 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7230795 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230795-trimmed-pair1.fastq SRR7230795-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,724,121 reads, 15,292,978 reads pseudoaligned [quant] estimated average fragment length: 239.51 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52401 SRR7230795.ke.tsv 34699 SRR7230795.se.tsv 87100 total ==> SRR7230795.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.49 536 19.3772 Potri.005G024800.1.v4.1 1035 796.49 241 19.4652 Potri.004G059700.1.v4.1 961 722.553 22 1.95873 Potri.007G009000.2.v4.1 1416 1177.49 0 0 Potri.003G141000.2.v4.1 2943 2704.49 851.36 20.2512 Potri.016G087400.1.v4.1 270 88.2553 851 620.314 Potri.015G069301.1.v4.1 564 332.703 0 0 Potri.010G195200.1.v4.1 1773 1534.49 50 2.09618 Potri.012G127500.1.v4.1 977 738.501 157 13.6764 ==> SRR7230795.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1580 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 310 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 21 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 7 SRR7230795 completed mapping pipeline successfully