Starting /dee2/code/volunteer_pipeline.sh SRR7230796 current disk space = 3055628128256 free memory = 1493589308 SRR7230796 SRAfilesize bceba2c0ef50f98c4bdcfb724cf84604 SRR7230796.sra SRR7230796.sra file validated SRR7230796 is paired end SRR7230796 is conventional basespace SRR7230796 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230796_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.389 34.0 33.0 34.0 33.0 34.0 2 33.44975 34.0 34.0 34.0 33.0 34.0 3 33.444 34.0 34.0 34.0 33.0 34.0 4 33.37275 34.0 34.0 34.0 33.0 34.0 5 33.38475 34.0 34.0 34.0 33.0 34.0 6 37.17625 38.0 38.0 38.0 36.0 38.0 7 37.446 38.0 38.0 38.0 37.0 38.0 8 37.53225 38.0 38.0 38.0 38.0 38.0 9 37.6275 38.0 38.0 38.0 38.0 38.0 10-14 37.57475 38.0 38.0 38.0 38.0 38.0 15-19 37.246449999999996 38.0 38.0 38.0 36.8 38.0 20-24 37.489399999999996 38.0 38.0 38.0 37.8 38.0 25-29 37.481350000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.4126 38.0 38.0 38.0 37.6 38.0 35-39 37.14495 38.0 38.0 38.0 36.6 38.0 40-44 36.73185 38.0 38.0 38.0 35.0 38.0 45-49 36.815250000000006 38.0 38.0 38.0 35.2 38.0 50-54 36.50404999999999 38.0 37.8 38.0 33.4 38.0 55-59 37.1103 38.0 38.0 38.0 36.2 38.0 60-64 37.12905 38.0 38.0 38.0 36.0 38.0 65-69 37.134350000000005 38.0 38.0 38.0 36.0 38.0 70-74 32.6796 38.0 29.2 38.0 15.4 38.0 75-79 33.2432 38.0 36.0 38.0 14.0 38.0 80-84 35.3158 38.0 37.4 38.0 29.2 38.0 85-89 36.1826 38.0 38.0 38.0 33.6 38.0 90-94 36.31750000000001 38.0 38.0 38.0 34.0 38.0 95-99 36.43575 38.0 38.0 38.0 34.0 38.0 100-104 35.38925 38.0 36.6 38.0 28.6 38.0 105-109 35.86505 38.0 36.8 38.0 32.0 38.0 110-114 35.436150000000005 38.0 36.4 38.0 29.4 38.0 115-119 35.7241 38.0 37.0 38.0 31.4 38.0 120-124 34.896 38.0 35.4 38.0 26.2 38.0 125-129 34.904700000000005 38.0 35.4 38.0 27.2 38.0 130-134 34.343149999999994 38.0 34.8 38.0 24.0 38.0 135-139 34.511900000000004 38.0 35.2 38.0 25.4 38.0 140-144 33.72905 38.0 34.2 38.0 22.2 38.0 145-149 32.876099999999994 38.0 33.4 38.0 15.0 38.0 150-151 29.186 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 0.0 11 1.0 12 2.0 13 2.0 14 4.0 15 1.0 16 2.0 17 5.0 18 4.0 19 2.0 20 3.0 21 5.0 22 5.0 23 14.0 24 24.0 25 14.0 26 24.0 27 24.0 28 30.0 29 42.0 30 78.0 31 62.0 32 107.0 33 178.0 34 260.0 35 415.0 36 854.0 37 1836.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.325 16.5 10.299999999999999 29.875 2 22.75 19.175 34.9 23.175 3 18.05 27.650000000000002 26.724999999999998 27.575 4 21.525 34.125 22.650000000000002 21.7 5 20.525 37.0 25.324999999999996 17.150000000000002 6 18.33416708354177 34.492246123061534 26.18809404702351 20.985492746373186 7 14.374999999999998 22.85 42.95 19.825 8 17.825 24.0 30.65 27.525 9 19.075 23.1 31.825 26.0 10-14 19.86 28.87 27.084999999999997 24.185000000000002 15-19 19.439999999999998 28.255000000000003 27.985 24.32 20-24 19.755 28.565 27.96 23.72 25-29 19.98 28.335 28.205000000000002 23.48 30-34 19.945 28.205000000000002 28.265 23.585 35-39 19.80485364023017 28.696522391793845 28.00100075056292 23.49762321741306 40-44 19.940834336141194 28.173886883273163 28.078620136381872 23.80665864420377 45-49 20.504100820164034 28.280656131226245 27.645529105821165 23.56971394278856 50-54 20.73 28.62 27.16 23.49 55-59 20.46716350722753 28.319911969189214 27.609663382183765 23.60326114139949 60-64 19.91 27.900000000000002 28.449999999999996 23.74 65-69 20.119023804760953 28.755751150230047 27.415483096619326 23.709741948389677 70-74 20.0 27.672389529974666 28.43793976920912 23.88967070081621 75-79 20.55191256830601 28.01639344262295 27.420765027322403 24.010928961748633 80-84 19.895801093572683 28.180129990714946 27.659135458578355 24.264933457134013 85-89 20.192550027723172 28.292756691365494 28.060890165834973 23.453803115076365 90-94 20.357035703570357 27.83778377837784 27.85778577857786 23.94739473947395 95-99 20.768115217282592 27.24908736310447 27.99419912986948 23.98859828974346 100-104 20.5534981483335 28.140326293664298 27.58482634370934 23.721349214292864 105-109 20.757833616978676 27.820602662929222 27.655420963059363 23.766142757032735 110-114 20.52423590615777 27.997598919513784 28.127657445850634 23.350507728477815 115-119 20.57117135140542 28.023407022106632 27.438231469440833 23.967190157047114 120-124 20.97104855242762 28.561428071403572 27.04635231761588 23.42117105855293 125-129 20.641352744009207 28.175496523087702 27.38005903246786 23.80309170043524 130-134 20.939550257925575 28.59718535583713 26.51374768367807 23.949516702559222 135-139 21.34320148022203 27.954193128969347 27.254088113216984 23.448517277591638 140-144 20.922322812984547 27.659680888310913 27.399589856449758 24.01840644225479 145-149 20.880220055013755 28.767191797949486 26.49662415603901 23.85596399099775 150-151 21.445542078279356 28.310616481180446 26.885081905714642 23.35875953482556 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.0 17 0.5 18 1.5 19 1.0 20 0.0 21 1.0 22 3.0 23 4.5 24 5.5 25 3.5 26 3.5 27 12.5 28 16.0 29 13.5 30 20.5 31 30.0 32 48.0 33 62.0 34 70.5 35 90.0 36 110.0 37 124.5 38 144.0 39 165.0 40 174.0 41 204.5 42 243.5 43 252.5 44 246.5 45 244.5 46 248.5 47 246.0 48 227.5 49 201.0 50 164.0 51 132.5 52 114.0 53 87.0 54 66.5 55 54.0 56 40.5 57 31.0 58 25.5 59 20.5 60 14.5 61 9.0 62 6.5 63 3.5 64 0.0 65 0.0 66 0.5 67 2.0 68 1.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.075 40-44 0.27999999999999997 45-49 0.02 50-54 0.0 55-59 0.034999999999999996 60-64 0.0 65-69 0.02 70-74 11.175 75-79 8.5 80-84 3.0700000000000003 85-89 0.8049999999999999 90-94 0.01 95-99 0.015 100-104 0.09 105-109 0.11 110-114 0.045 115-119 0.03 120-124 0.005 125-129 0.055 130-134 0.165 135-139 0.015 140-144 0.034999999999999996 145-149 0.025 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37106918238993 98.75 2 0.628930817610063 1.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6000000000000001 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.425 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.675 0.0 0.0 0.0 0.0 112-113 1.9 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.325 0.0 0.0 0.0 0.0 118-119 2.575 0.0 0.0 0.0 0.0 120-121 2.925 0.0 0.0 0.0 0.0 122-123 3.2874999999999996 0.0 0.0 0.0 0.0 124-125 3.675 0.0 0.0 0.0 0.0 126-127 4.012499999999999 0.0 0.0 0.0 0.0 128-129 4.575 0.0 0.0 0.0 0.0 130-131 5.112500000000001 0.0 0.0 0.0 0.0 132-133 5.475 0.0 0.0 0.0 0.0 134-135 5.800000000000001 0.0 0.0 0.0 0.0 136-137 6.137499999999999 0.0 0.0 0.0 0.0 138-139 6.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 115 0.0029690037 9.905217 120-124 >>END_MODULE SRR7230796 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230796_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.653 33.0 33.0 34.0 32.0 34.0 2 32.76975 34.0 33.0 34.0 32.0 34.0 3 32.835 34.0 33.0 34.0 32.0 34.0 4 32.801 34.0 33.0 34.0 32.0 34.0 5 32.75025 34.0 33.0 34.0 32.0 34.0 6 36.87825 38.0 38.0 38.0 36.0 38.0 7 36.96175 38.0 38.0 38.0 37.0 38.0 8 36.9495 38.0 38.0 38.0 37.0 38.0 9 36.816 38.0 38.0 38.0 36.0 38.0 10-14 36.753 38.0 38.0 38.0 36.0 38.0 15-19 36.78775 38.0 38.0 38.0 36.6 38.0 20-24 36.7248 38.0 38.0 38.0 36.2 38.0 25-29 36.6681 38.0 38.0 38.0 36.0 38.0 30-34 36.663599999999995 38.0 38.0 38.0 36.0 38.0 35-39 36.393600000000006 38.0 38.0 38.0 35.2 38.0 40-44 36.463849999999994 38.0 38.0 38.0 35.6 38.0 45-49 36.453050000000005 38.0 38.0 38.0 35.6 38.0 50-54 36.488249999999994 38.0 38.0 38.0 35.8 38.0 55-59 36.2119 38.0 38.0 38.0 34.4 38.0 60-64 36.2956 38.0 38.0 38.0 34.8 38.0 65-69 36.1927 38.0 38.0 38.0 34.2 38.0 70-74 35.955799999999996 38.0 38.0 38.0 33.4 38.0 75-79 36.21495 38.0 38.0 38.0 34.2 38.0 80-84 36.194449999999996 38.0 38.0 38.0 34.2 38.0 85-89 36.15355 38.0 38.0 38.0 34.6 38.0 90-94 35.98975 38.0 38.0 38.0 34.0 38.0 95-99 35.9046 38.0 38.0 38.0 33.8 38.0 100-104 35.688500000000005 38.0 38.0 38.0 32.6 38.0 105-109 35.4269 38.0 38.0 38.0 31.0 38.0 110-114 35.44005 38.0 38.0 38.0 31.0 38.0 115-119 35.3631 38.0 37.8 38.0 31.0 38.0 120-124 35.02610000000001 38.0 37.0 38.0 28.2 38.0 125-129 34.82635 38.0 36.0 38.0 28.0 38.0 130-134 34.681149999999995 38.0 36.0 38.0 26.8 38.0 135-139 34.04600000000001 38.0 34.8 38.0 23.8 38.0 140-144 33.57000000000001 38.0 33.6 38.0 21.0 38.0 145-149 32.4528 38.0 32.6 38.0 10.8 38.0 150-151 26.916625 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 12.0 4 6.0 5 3.0 6 7.0 7 2.0 8 0.0 9 1.0 10 5.0 11 9.0 12 2.0 13 1.0 14 5.0 15 7.0 16 9.0 17 5.0 18 10.0 19 11.0 20 8.0 21 13.0 22 11.0 23 12.0 24 17.0 25 25.0 26 25.0 27 28.0 28 39.0 29 28.0 30 37.0 31 47.0 32 76.0 33 94.0 34 130.0 35 223.0 36 544.0 37 2531.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.6777749937359 20.8970182911551 12.277624655474819 21.147582059634175 2 26.170798898071624 24.893563736538944 31.204608064112193 17.731029301277236 3 21.3 27.625 31.35 19.725 4 25.05 34.599999999999994 21.675 18.675 5 22.875 39.15 20.75 17.224999999999998 6 20.424999999999997 36.9 22.725 19.950000000000003 7 18.725 19.375 40.25 21.65 8 20.424999999999997 24.2 27.55 27.825 9 22.605651412853213 23.25581395348837 28.95723930982746 25.18129532383096 10-14 23.010354659596818 28.112650692811762 26.987144214896702 21.889850432694715 15-19 22.96303706297204 27.664682638923622 28.08482969039164 21.2874506077127 20-24 22.610827579305514 28.169718803162212 28.229760832582805 20.989692784949465 25-29 23.224741029875396 27.878696892358505 27.678526747735578 21.218035330030528 30-34 22.559663781457946 28.56356631810677 27.873117526392154 21.003652374043128 35-39 23.0426511814177 27.638165798958752 28.384060873047655 20.935122146575893 40-44 22.427942353883108 28.69295436349079 28.077461969575662 20.80164131305044 45-49 23.39860770270947 27.570491310662593 28.24159863775229 20.789302348875644 50-54 22.99443804178985 27.92002806032971 27.57428471213108 21.511249185749364 55-59 23.25569696664822 27.234770360682127 28.16037023995171 21.349162432717943 60-64 23.348725155591247 27.58482232483437 28.277454326440477 20.78899819313391 65-69 23.298824002412303 27.72137903306865 27.927429892451507 21.052367072067543 70-74 23.428628849922124 27.9254383761242 27.623976284982167 21.02195648897151 75-79 23.515284935207887 27.848101265822784 27.59293540801521 21.04367839095412 80-84 23.35455411298812 27.790866710110784 27.80590505789764 21.048674119003458 85-89 23.310489720374168 28.317742984342953 27.56740533239958 20.8043619628833 90-94 23.610346725371492 27.512883374193226 28.128283384199733 20.748486516235552 95-99 23.29130391273892 27.77444210947663 28.564995496847796 20.369258480936654 100-104 23.730932733183295 27.87696924231058 27.80195048762191 20.59014753688422 105-109 23.464692938587717 28.32066413282657 27.725545109021805 20.489097819563913 110-114 23.776854123892033 28.21373128348941 28.173669187240225 19.835745405378336 115-119 24.204204204204206 27.652652652652655 27.74274274274274 20.4004004004004 120-124 24.48367255088263 28.58928839325899 27.024053608041203 19.902985447817173 125-129 24.59868980347052 27.69415412311847 27.16407461119168 20.543081462219334 130-134 24.61115278819705 28.43710927731933 26.626656664166042 20.32508127031758 135-139 24.39146549133527 28.43834518681759 26.940799358910144 20.22938996293699 140-144 24.318647797169575 28.34425163774566 27.32409861479222 20.013001950292544 145-149 25.468820323048458 28.074211131669752 26.61399209881482 19.84297644646697 150-151 25.85 28.175 27.075 18.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.5 18 1.5 19 1.5 20 1.5 21 1.5 22 2.0 23 1.0 24 1.5 25 4.5 26 5.0 27 6.5 28 11.0 29 19.5 30 22.5 31 24.5 32 33.0 33 46.5 34 57.5 35 60.0 36 70.0 37 99.0 38 136.0 39 162.0 40 188.0 41 215.5 42 227.5 43 245.5 44 281.0 45 280.0 46 255.0 47 236.5 48 220.0 49 212.5 50 168.5 51 123.5 52 115.0 53 105.0 54 87.5 55 60.0 56 49.5 57 44.0 58 25.0 59 24.0 60 22.5 61 14.0 62 9.0 63 3.5 64 3.0 65 3.0 66 2.0 67 1.5 68 1.5 69 1.5 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.045 15-19 0.034999999999999996 20-24 0.06999999999999999 25-29 0.08499999999999999 30-34 0.065 35-39 0.12 40-44 0.08 45-49 0.165 50-54 0.215 55-59 0.605 60-64 0.38 65-69 0.51 70-74 0.485 75-79 0.065 80-84 0.255 85-89 0.045 90-94 0.065 95-99 0.06999999999999999 100-104 0.025 105-109 0.02 110-114 0.155 115-119 0.1 120-124 0.015 125-129 0.015 130-134 0.025 135-139 0.16999999999999998 140-144 0.015 145-149 0.015 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39577039274926 98.7 2 0.5287009063444109 1.05 3 0.050352467270896276 0.15 4 0.025176233635448138 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.1749999999999998 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.6125 0.0 0.0 0.0 0.0 112-113 1.825 0.0 0.0 0.0 0.0 114-115 1.975 0.0 0.0 0.0 0.0 116-117 2.2249999999999996 0.0 0.0 0.0 0.0 118-119 2.475 0.0 0.0 0.0 0.0 120-121 2.825 0.0 0.0 0.0 0.0 122-123 3.1624999999999996 0.0 0.0 0.0 0.0 124-125 3.575 0.0 0.0 0.0 0.0 126-127 3.975 0.0 0.0 0.0 0.0 128-129 4.55 0.0 0.0 0.0 0.0 130-131 5.0875 0.0 0.0 0.0 0.0 132-133 5.487500000000001 0.0 0.0 0.0 0.0 134-135 5.800000000000001 0.0 0.0 0.0 0.0 136-137 6.1625 0.0 0.0 0.0 0.0 138-139 6.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCCAG 10 0.0069682184 144.03749 3 >>END_MODULE Read 673812 spots for SRR7230796.sra Written 673812 spots for SRR7230796.sra Read 673812 spots for SRR7230796.sra Written 673812 spots for SRR7230796.sra Read 673812 spots for SRR7230796.sra Written 673812 spots for SRR7230796.sra Read 673812 spots for SRR7230796.sra Written 673812 spots for SRR7230796.sra Read 673812 spots for SRR7230796.sra Written 673812 spots for SRR7230796.sra Read 673812 spots for SRR7230796.sra Written 673812 spots for SRR7230796.sra Read 673812 spots for SRR7230796.sra Written 673812 spots for SRR7230796.sra Read 673812 spots for SRR7230796.sra Written 673812 spots for SRR7230796.sra Read 673812 spots for SRR7230796.sra Written 673812 spots for SRR7230796.sra Read 673812 spots for SRR7230796.sra Written 673812 spots for SRR7230796.sra Read 673812 spots for SRR7230796.sra Written 673812 spots for SRR7230796.sra Read 673812 spots for SRR7230796.sra Written 673812 spots for SRR7230796.sra Read 673812 spots for SRR7230796.sra Written 673812 spots for SRR7230796.sra Read 673812 spots for SRR7230796.sra Written 673812 spots for SRR7230796.sra Read 673812 spots for SRR7230796.sra Written 673812 spots for SRR7230796.sra Read 673812 spots for SRR7230796.sra Written 673812 spots for SRR7230796.sra Read 673812 spots for SRR7230796.sra Written 673812 spots for SRR7230796.sra Read 673812 spots for SRR7230796.sra Written 673812 spots for SRR7230796.sra Read 673812 spots for SRR7230796.sra Written 673812 spots for SRR7230796.sra Read 673825 spots for SRR7230796.sra Written 673825 spots for SRR7230796.sra SRR ids: ['SRR7230796.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gdlwdzzf SRR7230796.sra spots: 13476253 blocks: [[1, 673812], [673813, 1347624], [1347625, 2021436], [2021437, 2695248], [2695249, 3369060], [3369061, 4042872], [4042873, 4716684], [4716685, 5390496], [5390497, 6064308], [6064309, 6738120], [6738121, 7411932], [7411933, 8085744], [8085745, 8759556], [8759557, 9433368], [9433369, 10107180], [10107181, 10780992], [10780993, 11454804], [11454805, 12128616], [12128617, 12802428], [12802429, 13476253]] SRR7230796 file size 4544959 SRR7230796 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230796 SRR7230796_1.fastq SRR7230796_2.fastq Input file: SRR7230796_1.fastq Paired file: SRR7230796_2.fastq trimmed: SRR7230796-trimmed-pair1.fastq, SRR7230796-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:35:59 2025 >> started Tue Feb 11 07:36:13 2025 >> done (14.435s) 13476253 read pairs processed; of these: 30925 ( 0.23%) short read pairs filtered out after trimming by size control 19766 ( 0.15%) empty read pairs filtered out after trimming by size control 13425562 (99.62%) read pairs available; of these: 6096024 (45.41%) trimmed read pairs available after processing 7329538 (54.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 9 0.00% 20 3 0.00% 21 4 0.00% 22 3 0.00% 23 7 0.00% 24 7 0.00% 25 9 0.00% 26 7 0.00% 27 9 0.00% 28 8 0.00% 29 13 0.00% 30 10 0.00% 31 7 0.00% 32 7 0.00% 33 4 0.00% 34 10 0.00% 35 16 0.00% 36 13 0.00% 37 19 0.00% 38 12 0.00% 39 16 0.00% 40 23 0.00% 41 26 0.00% 42 35 0.00% 43 19 0.00% 44 36 0.00% 45 29 0.00% 46 45 0.00% 47 55 0.00% 48 46 0.00% 49 62 0.00% 50 56 0.00% 51 85 0.00% 52 94 0.00% 53 97 0.00% 54 133 0.00% 55 113 0.00% 56 158 0.00% 57 159 0.00% 58 220 0.00% 59 197 0.00% 60 198 0.00% 61 221 0.00% 62 245 0.00% 63 295 0.00% 64 353 0.00% 65 364 0.00% 66 466 0.00% 67 580 0.00% 68 899 0.01% 69 1647 0.01% 70 1667 0.01% 71 968 0.01% 72 915 0.01% 73 1078 0.01% 74 1080 0.01% 75 1148 0.01% 76 1267 0.01% 77 1410 0.01% 78 1616 0.01% 79 1812 0.01% 80 2198 0.02% 81 2885 0.02% 82 2604 0.02% 83 2998 0.02% 84 5030 0.04% 85 5199 0.04% 86 5599 0.04% 87 5907 0.04% 88 6146 0.05% 89 6538 0.05% 90 7017 0.05% 91 7347 0.05% 92 7847 0.06% 93 8412 0.06% 94 8757 0.07% 95 9383 0.07% 96 9858 0.07% 97 10063 0.07% 98 10685 0.08% 99 11554 0.09% 100 12255 0.09% 101 12776 0.10% 102 13721 0.10% 103 14516 0.11% 104 15111 0.11% 105 16141 0.12% 106 16679 0.12% 107 17485 0.13% 108 18064 0.13% 109 19458 0.14% 110 20197 0.15% 111 21627 0.16% 112 22258 0.17% 113 23425 0.17% 114 24289 0.18% 115 25492 0.19% 116 26481 0.20% 117 27301 0.20% 118 28125 0.21% 119 28809 0.21% 120 30248 0.23% 121 31600 0.24% 122 32806 0.24% 123 34871 0.26% 124 36339 0.27% 125 37425 0.28% 126 38712 0.29% 127 39960 0.30% 128 41280 0.31% 129 43219 0.32% 130 44213 0.33% 131 45724 0.34% 132 48162 0.36% 133 50226 0.37% 134 52760 0.39% 135 55347 0.41% 136 57912 0.43% 137 60358 0.45% 138 63288 0.47% 139 67139 0.50% 140 70635 0.53% 141 76160 0.57% 142 81823 0.61% 143 91011 0.68% 144 102443 0.76% 145 118922 0.89% 146 142980 1.06% 147 185347 1.38% 148 270967 2.02% 149 520260 3.88% 150 2963536 22.07% 151 7329538 54.59% 13425562 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=19 prefix-density=0.60 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=506.26 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=17.7 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=25 prefix-density=0.59 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=78.72 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.7 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGTATGCTTTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR7230796 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:36:58 Started mapping on | Feb 11 07:36:59 Finished on | Feb 11 07:38:34 Mapping speed, Million of reads per hour | 508.76 Number of input reads | 13425562 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12442127 Uniquely mapped reads % | 92.67% Average mapped length | 293.21 Number of splices: Total | 12126870 Number of splices: Annotated (sjdb) | 11836733 Number of splices: GT/AG | 11885367 Number of splices: GC/AG | 198969 Number of splices: AT/AC | 6889 Number of splices: Non-canonical | 35645 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 320614 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 157779 % of reads mapped to too many loci | 1.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.50% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 693414 693414 693414 N_multimapping 320614 320614 320614 N_noFeature 583542 12226994 677849 N_ambiguous 214041 1125 92525 UnstrandedReadsAssigned:11644544 PositiveStrandReadsAssigned:214008 NegativeStrandReadsAssigned:11671753 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7230796 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230796-trimmed-pair1.fastq SRR7230796-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,425,562 reads, 11,783,239 reads pseudoaligned [quant] estimated average fragment length: 246.31 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52401 SRR7230796.ke.tsv 34699 SRR7230796.se.tsv 87100 total ==> SRR7230796.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.69 372 16.9787 Potri.005G024800.1.v4.1 1035 789.69 125 12.807 Potri.004G059700.1.v4.1 961 715.789 3 0.339101 Potri.007G009000.2.v4.1 1416 1170.69 0 0 Potri.003G141000.2.v4.1 2943 2697.69 666.375 19.9857 Potri.016G087400.1.v4.1 270 84.3707 565 541.814 Potri.015G069301.1.v4.1 564 326.947 0 0 Potri.010G195200.1.v4.1 1773 1527.69 8 0.42369 Potri.012G127500.1.v4.1 977 731.738 56 6.19193 ==> SRR7230796.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 368 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 227 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 1 SRR7230796 completed mapping pipeline successfully