Starting /dee2/code/volunteer_pipeline.sh SRR7230797 current disk space = 3055617650688 free memory = 1565503180 SRR7230797 SRAfilesize 2f8091da24342c3e76713b7f78023e89 SRR7230797.sra SRR7230797.sra file validated SRR7230797 is paired end SRR7230797 is conventional basespace SRR7230797 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230797_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.4925 34.0 34.0 34.0 33.0 34.0 2 33.52575 34.0 34.0 34.0 33.0 34.0 3 33.59325 34.0 34.0 34.0 33.0 34.0 4 33.56075 34.0 34.0 34.0 33.0 34.0 5 33.522 34.0 34.0 34.0 33.0 34.0 6 37.27375 38.0 38.0 38.0 36.0 38.0 7 37.42425 38.0 38.0 38.0 37.0 38.0 8 37.421 38.0 38.0 38.0 38.0 38.0 9 37.52575 38.0 38.0 38.0 38.0 38.0 10-14 37.49375 38.0 38.0 38.0 37.8 38.0 15-19 37.47895 38.0 38.0 38.0 38.0 38.0 20-24 37.32125 38.0 38.0 38.0 37.4 38.0 25-29 37.123400000000004 38.0 38.0 38.0 36.8 38.0 30-34 37.0164 38.0 38.0 38.0 35.8 38.0 35-39 37.000299999999996 38.0 38.0 38.0 36.0 38.0 40-44 36.781600000000005 38.0 38.0 38.0 35.4 38.0 45-49 36.746449999999996 38.0 37.8 38.0 34.8 38.0 50-54 36.9141 38.0 38.0 38.0 35.8 38.0 55-59 37.0607 38.0 38.0 38.0 36.2 38.0 60-64 37.0969 38.0 38.0 38.0 36.2 38.0 65-69 37.090849999999996 38.0 38.0 38.0 36.6 38.0 70-74 33.60535 38.0 36.0 38.0 15.6 38.0 75-79 34.2327 38.0 37.4 38.0 24.8 38.0 80-84 36.0438 38.0 38.0 38.0 33.0 38.0 85-89 36.70675 38.0 38.0 38.0 35.8 38.0 90-94 36.724199999999996 38.0 38.0 38.0 35.2 38.0 95-99 36.761399999999995 38.0 38.0 38.0 35.2 38.0 100-104 36.589349999999996 38.0 38.0 38.0 34.6 38.0 105-109 36.4338 38.0 38.0 38.0 34.6 38.0 110-114 36.14730000000001 38.0 37.8 38.0 33.0 38.0 115-119 35.3405 38.0 36.2 38.0 29.8 38.0 120-124 35.5559 38.0 36.6 38.0 31.2 38.0 125-129 35.168600000000005 38.0 35.6 38.0 29.0 38.0 130-134 34.812549999999995 38.0 35.4 38.0 26.2 38.0 135-139 35.21395 38.0 36.0 38.0 30.6 38.0 140-144 34.487700000000004 38.0 35.2 38.0 25.8 38.0 145-149 33.96535 38.0 33.6 38.0 25.2 38.0 150-151 30.258875000000003 35.5 28.5 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 3.0 15 2.0 16 4.0 17 2.0 18 8.0 19 11.0 20 5.0 21 9.0 22 11.0 23 2.0 24 6.0 25 8.0 26 18.0 27 19.0 28 30.0 29 32.0 30 43.0 31 44.0 32 81.0 33 147.0 34 228.0 35 360.0 36 780.0 37 2144.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.675000000000004 14.374999999999998 12.875 36.075 2 20.674999999999997 19.15 34.8 25.374999999999996 3 19.1 25.5 26.125 29.275000000000002 4 21.349999999999998 33.2 22.1 23.35 5 21.075 36.1 23.674999999999997 19.15 6 17.5 35.3 27.075 20.125 7 13.850000000000001 22.85 45.15 18.15 8 17.075000000000003 24.275 30.75 27.900000000000002 9 17.2 23.724999999999998 32.7 26.375 10-14 19.105 30.485 26.55 23.86 15-19 19.365 29.13 27.405 24.099999999999998 20-24 19.505 30.020000000000003 27.189999999999998 23.285 25-29 19.48 29.805 27.16 23.555 30-34 19.325 29.765000000000004 26.735 24.175 35-39 19.824868651488618 29.527145359019265 26.760070052539405 23.887915936952712 40-44 20.079154350984417 29.65783277390912 26.72210811081609 23.540904764290367 45-49 20.116034810443136 28.73362008602581 26.793037911373414 24.35730719215765 50-54 19.525000000000002 28.92 27.445000000000004 24.11 55-59 19.86 28.735 27.49 23.915 60-64 19.72 28.01 27.875 24.395 65-69 19.625 29.095 26.61 24.67 70-74 19.55147584235695 29.21453306216677 26.65860495795086 24.57538613752542 75-79 19.725777944405763 29.334261689250713 26.85448020995126 24.085480156392265 80-84 19.655857048312374 28.829608511938094 26.864531894313497 24.650002545436035 85-89 19.55693664795509 28.41820368885325 27.13512429831596 24.8897353648757 90-94 20.375 28.095 27.250000000000004 24.279999999999998 95-99 19.950000000000003 28.78 26.965 24.305 100-104 20.605 28.48 26.534999999999997 24.38 105-109 20.599999999999998 27.900000000000002 27.04 24.46 110-114 20.275000000000002 28.110000000000003 26.945000000000004 24.67 115-119 20.385 28.549999999999997 26.27 24.795 120-124 20.74 28.215 26.015 25.03 125-129 21.48 27.584999999999997 26.525 24.41 130-134 21.055 28.01 26.51 24.425 135-139 20.745 27.639999999999997 26.484999999999996 25.130000000000003 140-144 21.495 27.634999999999998 25.95 24.92 145-149 20.974999999999998 27.77 25.765 25.490000000000002 150-151 21.625 27.487499999999997 26.3125 24.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.5 14 1.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 3.5 22 3.0 23 4.0 24 6.0 25 6.5 26 10.0 27 17.5 28 22.5 29 29.0 30 40.5 31 54.5 32 68.5 33 70.0 34 86.5 35 122.0 36 142.5 37 144.0 38 151.0 39 166.5 40 185.5 41 191.0 42 183.0 43 194.0 44 207.0 45 196.0 46 182.0 47 179.0 48 164.0 49 151.5 50 143.0 51 135.5 52 125.5 53 106.0 54 101.0 55 92.5 56 69.0 57 54.5 58 48.5 59 34.5 60 26.5 61 25.0 62 21.5 63 13.5 64 4.0 65 1.5 66 0.0 67 0.0 68 1.5 69 3.0 70 1.5 71 1.0 72 2.0 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.075 40-44 0.19499999999999998 45-49 0.03 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 9.035 75-79 6.645 80-84 1.7850000000000001 85-89 0.24 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.25 #Duplication Level Percentage of deduplicated Percentage of total 1 96.37795275590551 91.8 2 2.9133858267716537 5.55 3 0.4461942257217848 1.275 4 0.13123359580052493 0.5 5 0.05249343832020997 0.25 6 0.026246719160104987 0.15 7 0.0 0.0 8 0.0 0.0 9 0.026246719160104987 0.22499999999999998 >10 0.026246719160104987 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGGTTCGGTCCTCCAGTTAGTGTTACCCAACCTTCAACCTGCCCATGG 10 0.25 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC 9 0.22499999999999998 TruSeq Adapter, Index 6 (100% over 50bp) GCTTCTTCTGCGGGTAACGTCAATGAGCAAAGGTATTAACTTTACTCCCT 6 0.15 No Hit CGGGAACGTATTCACCGTGGCATTCTGATCCACGATTACTAGCGATTCCG 5 0.125 No Hit CCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.625 0.0 0.0 0.0 0.0 106-107 1.8875000000000002 0.0 0.0 0.0 0.0 108-109 2.175 0.0 0.0 0.0 0.0 110-111 2.4625 0.0 0.0 0.0 0.0 112-113 2.925 0.0 0.0 0.0 0.0 114-115 3.4625 0.0 0.0 0.0 0.0 116-117 3.9125 0.0 0.0 0.0 0.0 118-119 4.3125 0.0 0.0 0.0 0.0 120-121 4.725 0.0 0.0 0.0 0.0 122-123 5.2 0.0 0.0 0.0 0.0 124-125 5.8 0.0 0.0 0.0 0.0 126-127 6.2875 0.0 0.0 0.0 0.0 128-129 6.7875 0.0 0.0 0.0 0.0 130-131 7.3125 0.0 0.0 0.0 0.0 132-133 8.025 0.0 0.0 0.0 0.0 134-135 8.825 0.0 0.0 0.0 0.0 136-137 9.399999999999999 0.0 0.0 0.0 0.0 138-139 10.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTTT 10 0.007167199 142.6875 1 AGTCTTC 10 0.007167199 142.6875 4 >>END_MODULE SRR7230797 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230797_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00225 34.0 33.0 34.0 32.0 34.0 2 33.1645 34.0 33.0 34.0 33.0 34.0 3 33.15475 34.0 33.0 34.0 33.0 34.0 4 33.09125 34.0 33.0 34.0 33.0 34.0 5 33.07575 34.0 33.0 34.0 33.0 34.0 6 37.07475 38.0 38.0 38.0 38.0 38.0 7 37.1005 38.0 38.0 38.0 38.0 38.0 8 37.1355 38.0 38.0 38.0 38.0 38.0 9 37.15575 38.0 38.0 38.0 38.0 38.0 10-14 36.834799999999994 38.0 38.0 38.0 36.6 38.0 15-19 37.11985 38.0 38.0 38.0 37.6 38.0 20-24 37.1269 38.0 38.0 38.0 38.0 38.0 25-29 37.103899999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.084250000000004 38.0 38.0 38.0 37.8 38.0 35-39 36.87305 38.0 38.0 38.0 37.0 38.0 40-44 36.99085 38.0 38.0 38.0 37.0 38.0 45-49 36.96995 38.0 38.0 38.0 37.2 38.0 50-54 36.96515 38.0 38.0 38.0 37.0 38.0 55-59 36.760149999999996 38.0 38.0 38.0 36.8 38.0 60-64 36.951100000000004 38.0 38.0 38.0 37.0 38.0 65-69 36.88215 38.0 38.0 38.0 37.2 38.0 70-74 36.6886 38.0 38.0 38.0 37.0 38.0 75-79 36.71035 38.0 38.0 38.0 36.4 38.0 80-84 36.733050000000006 38.0 38.0 38.0 37.0 38.0 85-89 36.7055 38.0 38.0 38.0 36.8 38.0 90-94 36.626799999999996 38.0 38.0 38.0 36.2 38.0 95-99 36.5133 38.0 38.0 38.0 35.8 38.0 100-104 36.370250000000006 38.0 38.0 38.0 35.2 38.0 105-109 36.3759 38.0 38.0 38.0 35.0 38.0 110-114 36.21985 38.0 38.0 38.0 34.6 38.0 115-119 36.1223 38.0 38.0 38.0 34.4 38.0 120-124 35.80275 38.0 38.0 38.0 33.6 38.0 125-129 35.727199999999996 38.0 38.0 38.0 33.4 38.0 130-134 35.4905 38.0 38.0 38.0 32.6 38.0 135-139 35.219950000000004 38.0 37.6 38.0 31.0 38.0 140-144 34.5711 38.0 36.0 38.0 28.8 38.0 145-149 33.25985 38.0 34.4 38.0 18.8 38.0 150-151 28.389375 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 10.0 4 2.0 5 1.0 6 2.0 7 5.0 8 0.0 9 2.0 10 4.0 11 4.0 12 2.0 13 4.0 14 2.0 15 7.0 16 8.0 17 12.0 18 5.0 19 6.0 20 3.0 21 7.0 22 5.0 23 7.0 24 11.0 25 12.0 26 18.0 27 11.0 28 21.0 29 28.0 30 29.0 31 28.0 32 48.0 33 81.0 34 90.0 35 171.0 36 420.0 37 2922.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.23074993729621 17.005267118133936 16.3280662151994 26.435916729370458 2 27.0 23.125 30.0 19.875 3 24.224999999999998 27.275 28.875 19.625 4 26.224999999999998 34.175 21.625 17.974999999999998 5 27.175 35.5 20.1 17.224999999999998 6 21.15 35.975 23.375 19.5 7 20.974999999999998 18.35 40.150000000000006 20.525 8 23.275000000000002 22.475 26.950000000000003 27.3 9 24.3 24.25 25.900000000000002 25.55 10-14 25.615 27.915 24.959999999999997 21.51 15-19 25.509999999999998 27.145000000000003 26.974999999999998 20.369999999999997 20-24 25.25 27.705000000000002 26.69 20.355 25-29 24.785 27.894999999999996 26.575 20.745 30-34 24.645 27.685 27.045 20.625 35-39 25.080000000000002 27.305 27.08 20.535 40-44 25.21 27.11 27.060000000000002 20.62 45-49 24.832281966556526 27.245419044758183 27.525783518574148 20.396515470111147 50-54 24.991240802842984 27.21857950848391 27.593973672355975 20.196206016317134 55-59 24.674413945101183 26.637948306952513 28.10058104588259 20.587056702063713 60-64 24.490000000000002 27.755000000000003 27.185 20.57 65-69 25.350350350350347 27.13213213213213 27.227227227227228 20.29029029029029 70-74 25.35726821441107 27.292784435641575 27.623727623727625 19.726219726219725 75-79 24.875 27.284999999999997 27.400000000000002 20.44 80-84 25.369999999999997 27.750000000000004 26.87 20.01 85-89 25.035 27.150000000000002 27.665 20.150000000000002 90-94 24.625 27.32 27.555000000000003 20.5 95-99 24.990000000000002 26.995 27.91 20.105 100-104 25.595000000000002 26.965 27.74 19.7 105-109 24.815 27.08 28.155 19.950000000000003 110-114 24.875 28.065 27.01 20.05 115-119 24.985 27.97 27.21 19.835 120-124 25.314999999999998 27.450000000000003 27.725 19.509999999999998 125-129 25.424999999999997 26.945000000000004 28.265 19.365 130-134 25.705 28.03 27.18 19.085 135-139 25.71 27.54 27.045 19.705000000000002 140-144 25.569999999999997 27.800000000000004 27.205000000000002 19.425 145-149 26.284999999999997 28.08 26.915 18.72 150-151 26.3 28.050000000000004 26.9125 18.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.0 23 0.5 24 1.0 25 1.5 26 4.0 27 5.0 28 4.0 29 6.5 30 13.0 31 17.5 32 22.0 33 30.5 34 44.5 35 65.0 36 84.0 37 108.0 38 124.0 39 137.5 40 161.5 41 181.0 42 193.5 43 212.5 44 229.5 45 221.5 46 228.5 47 232.0 48 224.0 49 209.5 50 190.5 51 164.0 52 135.0 53 147.0 54 149.0 55 123.5 56 85.5 57 57.0 58 43.0 59 31.5 60 25.0 61 22.0 62 24.0 63 16.0 64 7.0 65 4.0 66 2.0 67 1.0 68 1.0 69 2.5 70 1.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.13 50-54 0.105 55-59 0.18 60-64 0.0 65-69 0.1 70-74 0.28500000000000003 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.875 #Duplication Level Percentage of deduplicated Percentage of total 1 96.61016949152543 92.625 2 2.9726205997392436 5.7 3 0.28683181225554105 0.8250000000000001 4 0.05215123859191656 0.2 5 0.0 0.0 6 0.0 0.0 7 0.02607561929595828 0.17500000000000002 8 0.0 0.0 9 0.02607561929595828 0.22499999999999998 >10 0.02607561929595828 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 10 0.25 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 9 0.22499999999999998 Illumina Single End PCR Primer 1 (100% over 50bp) GCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.8999999999999999 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.1875 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.5750000000000002 0.0 0.0 0.0 0.0 106-107 1.8375 0.0 0.0 0.0 0.0 108-109 2.1 0.0 0.0 0.0 0.0 110-111 2.4125 0.0 0.0 0.0 0.0 112-113 2.8625 0.0 0.0 0.0 0.0 114-115 3.375 0.0 0.0 0.0 0.0 116-117 3.85 0.0 0.0 0.0 0.0 118-119 4.3125 0.0 0.0 0.0 0.0 120-121 4.7375 0.0 0.0 0.0 0.0 122-123 5.2875 0.0 0.0 0.0 0.0 124-125 5.9375 0.0 0.0 0.0 0.0 126-127 6.475 0.0 0.0 0.0 0.0 128-129 6.9875 0.0 0.0 0.0 0.0 130-131 7.5375 0.0 0.0 0.0 0.0 132-133 8.25 0.0 0.0 0.0 0.0 134-135 9.0625 0.0 0.0 0.0 0.0 136-137 9.6375 0.0 0.0 0.0 0.0 138-139 10.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 604148 spots for SRR7230797.sra Written 604148 spots for SRR7230797.sra Read 604148 spots for SRR7230797.sra Written 604148 spots for SRR7230797.sra Read 604148 spots for SRR7230797.sra Written 604148 spots for SRR7230797.sra Read 604148 spots for SRR7230797.sra Written 604148 spots for SRR7230797.sra Read 604148 spots for SRR7230797.sra Written 604148 spots for SRR7230797.sra Read 604148 spots for SRR7230797.sra Written 604148 spots for SRR7230797.sra Read 604148 spots for SRR7230797.sra Written 604148 spots for SRR7230797.sra Read 604148 spots for SRR7230797.sra Written 604148 spots for SRR7230797.sra Read 604148 spots for SRR7230797.sra Written 604148 spots for SRR7230797.sra Read 604148 spots for SRR7230797.sra Written 604148 spots for SRR7230797.sra Read 604148 spots for SRR7230797.sra Written 604148 spots for SRR7230797.sra Read 604148 spots for SRR7230797.sra Written 604148 spots for SRR7230797.sra Read 604148 spots for SRR7230797.sra Written 604148 spots for SRR7230797.sra Read 604148 spots for SRR7230797.sra Written 604148 spots for SRR7230797.sra Read 604148 spots for SRR7230797.sra Written 604148 spots for SRR7230797.sra Read 604148 spots for SRR7230797.sra Written 604148 spots for SRR7230797.sra Read 604148 spots for SRR7230797.sra Written 604148 spots for SRR7230797.sra Read 604148 spots for SRR7230797.sra Written 604148 spots for SRR7230797.sra Read 604148 spots for SRR7230797.sra Written 604148 spots for SRR7230797.sra Read 604159 spots for SRR7230797.sra Written 604159 spots for SRR7230797.sra SRR ids: ['SRR7230797.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_udn85zlt SRR7230797.sra spots: 12082971 blocks: [[1, 604148], [604149, 1208296], [1208297, 1812444], [1812445, 2416592], [2416593, 3020740], [3020741, 3624888], [3624889, 4229036], [4229037, 4833184], [4833185, 5437332], [5437333, 6041480], [6041481, 6645628], [6645629, 7249776], [7249777, 7853924], [7853925, 8458072], [8458073, 9062220], [9062221, 9666368], [9666369, 10270516], [10270517, 10874664], [10874665, 11478812], [11478813, 12082971]] SRR7230797 file size 4072822 SRR7230797 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230797 SRR7230797_1.fastq SRR7230797_2.fastq Input file: SRR7230797_1.fastq Paired file: SRR7230797_2.fastq trimmed: SRR7230797-trimmed-pair1.fastq, SRR7230797-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:35:58 2025 >> started Tue Feb 11 07:36:10 2025 >> done (12.740s) 12082971 read pairs processed; of these: 25223 ( 0.21%) short read pairs filtered out after trimming by size control 55654 ( 0.46%) empty read pairs filtered out after trimming by size control 12002094 (99.33%) read pairs available; of these: 5688094 (47.39%) trimmed read pairs available after processing 6314000 (52.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 6 0.00% 21 8 0.00% 22 11 0.00% 23 10 0.00% 24 12 0.00% 25 11 0.00% 26 8 0.00% 27 9 0.00% 28 13 0.00% 29 15 0.00% 30 16 0.00% 31 25 0.00% 32 23 0.00% 33 16 0.00% 34 28 0.00% 35 24 0.00% 36 38 0.00% 37 36 0.00% 38 34 0.00% 39 39 0.00% 40 47 0.00% 41 43 0.00% 42 61 0.00% 43 42 0.00% 44 72 0.00% 45 80 0.00% 46 105 0.00% 47 105 0.00% 48 116 0.00% 49 141 0.00% 50 164 0.00% 51 188 0.00% 52 188 0.00% 53 169 0.00% 54 159 0.00% 55 206 0.00% 56 239 0.00% 57 253 0.00% 58 368 0.00% 59 313 0.00% 60 331 0.00% 61 433 0.00% 62 405 0.00% 63 515 0.00% 64 528 0.00% 65 721 0.01% 66 1238 0.01% 67 2801 0.02% 68 5175 0.04% 69 9604 0.08% 70 12034 0.10% 71 5579 0.05% 72 2689 0.02% 73 1973 0.02% 74 1857 0.02% 75 1748 0.01% 76 1940 0.02% 77 1992 0.02% 78 2133 0.02% 79 2494 0.02% 80 2676 0.02% 81 2769 0.02% 82 3153 0.03% 83 3655 0.03% 84 5267 0.04% 85 6031 0.05% 86 6892 0.06% 87 7102 0.06% 88 7725 0.06% 89 8043 0.07% 90 8246 0.07% 91 8952 0.07% 92 9061 0.08% 93 10318 0.09% 94 10288 0.09% 95 11467 0.10% 96 12003 0.10% 97 12590 0.10% 98 13365 0.11% 99 14426 0.12% 100 14903 0.12% 101 15599 0.13% 102 16757 0.14% 103 18120 0.15% 104 19307 0.16% 105 20922 0.17% 106 21309 0.18% 107 21534 0.18% 108 23191 0.19% 109 25663 0.21% 110 26006 0.22% 111 25690 0.21% 112 27634 0.23% 113 29639 0.25% 114 29660 0.25% 115 31759 0.26% 116 32625 0.27% 117 31862 0.27% 118 33862 0.28% 119 35021 0.29% 120 37379 0.31% 121 37710 0.31% 122 40323 0.34% 123 41785 0.35% 124 42905 0.36% 125 43447 0.36% 126 44713 0.37% 127 46293 0.39% 128 47941 0.40% 129 49345 0.41% 130 51150 0.43% 131 52630 0.44% 132 54349 0.45% 133 56657 0.47% 134 59141 0.49% 135 61478 0.51% 136 62777 0.52% 137 66517 0.55% 138 68064 0.57% 139 70079 0.58% 140 72604 0.60% 141 78491 0.65% 142 81025 0.68% 143 87433 0.73% 144 95947 0.80% 145 107261 0.89% 146 124048 1.03% 147 155052 1.29% 148 211685 1.76% 149 396968 3.31% 150 2518170 20.98% 151 6314000 52.61% 12002094 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=30 prefix-density=0.36 prefix-fanout=2.0 sequence=ATACGGATAAAGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=33 fanout-score=63.92 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=11.5 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATT criterion=sequence-density sequence-density=1.16 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=27 prefix-density=1.19 prefix-fanout=2.0 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=52.05 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=2.7 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT SRR7230797 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:37:03 Started mapping on | Feb 11 07:37:04 Finished on | Feb 11 07:40:11 Mapping speed, Million of reads per hour | 231.06 Number of input reads | 12002094 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 9588486 Uniquely mapped reads % | 79.89% Average mapped length | 291.66 Number of splices: Total | 7279042 Number of splices: Annotated (sjdb) | 7109507 Number of splices: GT/AG | 7125167 Number of splices: GC/AG | 123713 Number of splices: AT/AC | 5089 Number of splices: Non-canonical | 25073 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.04% Deletion average length | 2.39 Insertion rate per base | 0.03% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 290186 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 257190 % of reads mapped to too many loci | 2.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.96% % of reads unmapped: other | 0.59% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2145126 2145126 2145126 N_multimapping 290186 290186 290186 N_noFeature 368904 9324373 443292 N_ambiguous 254640 945 64595 UnstrandedReadsAssigned:8964942 PositiveStrandReadsAssigned:263168 NegativeStrandReadsAssigned:9080599 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7230797 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230797-trimmed-pair1.fastq SRR7230797-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,002,094 reads, 9,276,927 reads pseudoaligned [quant] estimated average fragment length: 211.414 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,182 rounds 52401 SRR7230797.ke.tsv 34699 SRR7230797.se.tsv 87100 total ==> SRR7230797.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1807.59 306 13.7082 Potri.005G024800.1.v4.1 1035 824.586 179 17.5782 Potri.004G059700.1.v4.1 961 750.606 1 0.107881 Potri.007G009000.2.v4.1 1416 1205.59 0 0 Potri.003G141000.2.v4.1 2943 2732.59 523 15.4984 Potri.016G087400.1.v4.1 270 88.7302 428 390.598 Potri.015G069301.1.v4.1 564 355.433 0 0 Potri.010G195200.1.v4.1 1773 1562.59 67 3.47207 Potri.012G127500.1.v4.1 977 766.591 210 22.1827 ==> SRR7230797.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 453 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 301 Potri.001G212900.v4.1 49 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 28 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 3 SRR7230797 completed mapping pipeline successfully