Starting /dee2/code/volunteer_pipeline.sh SRR7230798 current disk space = 3055641346048 free memory = 1579338068 SRR7230798 SRAfilesize 44ffdfedd24b1b7ec80b425127b549f5 SRR7230798.sra SRR7230798.sra file validated SRR7230798 is paired end SRR7230798 is conventional basespace SRR7230798 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230798_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.75525 34.0 33.0 34.0 32.0 34.0 2 32.9355 34.0 33.0 34.0 32.0 34.0 3 32.93825 34.0 33.0 34.0 32.0 34.0 4 33.05 34.0 33.0 34.0 32.0 34.0 5 33.0775 34.0 33.0 34.0 32.0 34.0 6 36.8825 38.0 37.0 38.0 35.0 38.0 7 37.1725 38.0 38.0 38.0 36.0 38.0 8 37.247 38.0 38.0 38.0 36.0 38.0 9 37.33975 38.0 38.0 38.0 37.0 38.0 10-14 37.322649999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.2789 38.0 38.0 38.0 36.8 38.0 20-24 37.08475 38.0 38.0 38.0 36.4 38.0 25-29 37.0278 38.0 38.0 38.0 36.0 38.0 30-34 36.959199999999996 38.0 38.0 38.0 36.0 38.0 35-39 37.0023 38.0 38.0 38.0 36.0 38.0 40-44 37.0211 38.0 38.0 38.0 36.0 38.0 45-49 36.95505 38.0 38.0 38.0 35.8 38.0 50-54 36.89915 38.0 38.0 38.0 35.4 38.0 55-59 36.76525 38.0 38.0 38.0 35.0 38.0 60-64 36.706050000000005 38.0 38.0 38.0 34.6 38.0 65-69 36.76855 38.0 38.0 38.0 34.8 38.0 70-74 36.24795 38.0 37.4 38.0 32.8 38.0 75-79 36.386250000000004 38.0 37.8 38.0 33.8 38.0 80-84 36.410199999999996 38.0 38.0 38.0 34.0 38.0 85-89 36.322950000000006 38.0 37.8 38.0 33.6 38.0 90-94 36.087050000000005 38.0 37.0 38.0 33.0 38.0 95-99 35.67605 38.0 36.8 38.0 30.4 38.0 100-104 35.3788 38.0 36.6 38.0 29.2 38.0 105-109 34.7825 38.0 35.6 38.0 25.8 38.0 110-114 35.3873 38.0 36.2 38.0 29.2 38.0 115-119 35.0423 38.0 35.6 38.0 27.6 38.0 120-124 35.012649999999994 38.0 35.6 38.0 28.0 38.0 125-129 34.3981 38.0 34.8 38.0 24.6 38.0 130-134 34.02685 38.0 34.4 38.0 22.4 38.0 135-139 33.29795 38.0 33.8 38.0 18.6 38.0 140-144 32.674 38.0 32.4 38.0 15.4 38.0 145-149 31.098200000000002 37.0 31.0 38.0 8.6 38.0 150-151 26.188125 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 0.0 10 0.0 11 0.0 12 2.0 13 1.0 14 2.0 15 0.0 16 1.0 17 3.0 18 6.0 19 7.0 20 5.0 21 4.0 22 5.0 23 13.0 24 10.0 25 30.0 26 33.0 27 37.0 28 58.0 29 67.0 30 76.0 31 89.0 32 109.0 33 156.0 34 238.0 35 376.0 36 806.0 37 1864.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.48054322277357 14.625228519195613 11.073387307390965 33.820840950639855 2 21.6 20.175 34.300000000000004 23.925 3 18.12953238309577 28.28207051762941 27.156789197299325 26.431607901975497 4 22.775000000000002 34.925 22.075 20.225 5 20.625 36.8 23.625 18.95 6 16.775000000000002 35.375 26.875 20.974999999999998 7 14.424999999999999 22.35 45.675 17.549999999999997 8 16.775000000000002 23.95 30.775000000000002 28.499999999999996 9 16.7 23.3 33.125 26.875 10-14 20.04 30.06 26.83 23.07 15-19 20.085 28.76 27.839999999999996 23.315 20-24 19.875 28.725 28.18 23.22 25-29 19.875 29.054999999999996 27.11 23.96 30-34 19.465 29.62 27.67 23.244999999999997 35-39 19.875 29.065 26.955000000000002 24.104999999999997 40-44 19.18 29.035 28.449999999999996 23.335 45-49 20.335 29.299999999999997 27.36 23.005 50-54 19.805 28.660000000000004 28.075 23.46 55-59 19.835 28.915000000000003 28.235 23.015 60-64 20.47 28.549999999999997 27.38 23.599999999999998 65-69 19.950000000000003 28.849999999999998 27.43 23.77 70-74 19.875 28.720000000000002 27.495000000000005 23.91 75-79 20.645 28.57 27.41 23.375 80-84 20.216064819445833 28.523557067120137 27.888366509952984 23.372011603481045 85-89 20.2233685581209 28.91270596484199 27.755797065157513 23.1081284118796 90-94 20.261339741664163 28.21167517773105 27.66095924702113 23.86602583358366 95-99 20.215 28.48 27.295 24.01 100-104 20.368325973504618 28.628061019670813 27.157767964672825 23.845845042151748 105-109 20.34985715001754 28.59004561174878 27.447245752092623 23.612851486141047 110-114 21.36 27.725 27.345000000000002 23.57 115-119 20.560000000000002 28.685 26.91 23.845 120-124 20.66 28.875 26.834999999999997 23.630000000000003 125-129 20.535 28.585 26.784999999999997 24.095 130-134 20.255000000000003 28.67 27.165 23.91 135-139 20.61 28.765 26.265 24.36 140-144 20.635 27.99 26.91 24.465 145-149 20.65603280164008 28.801440072003597 26.511325566278316 24.031201560078003 150-151 20.825 28.0875 27.3 23.7875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.5 13 0.5 14 0.0 15 1.0 16 1.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 0.5 23 1.0 24 3.0 25 4.5 26 6.0 27 7.0 28 14.5 29 20.0 30 27.5 31 41.0 32 46.0 33 53.5 34 70.0 35 93.5 36 108.5 37 124.5 38 154.0 39 166.5 40 188.5 41 218.5 42 213.5 43 220.5 44 236.0 45 251.0 46 261.5 47 251.5 48 229.5 49 189.0 50 149.5 51 125.0 52 120.0 53 99.0 54 72.5 55 61.5 56 47.0 57 36.5 58 26.5 59 16.5 60 10.0 61 7.5 62 5.0 63 2.5 64 2.0 65 1.5 66 1.5 67 1.5 68 2.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.275 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.03 85-89 0.165 90-94 0.13 95-99 0.0 100-104 0.36 105-109 0.245 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21776431995963 98.3 2 0.6560686348725713 1.3 3 0.10093363613424174 0.3 4 0.025233409033560434 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7250000000000001 0.0 0.0 0.0 0.0 98-99 0.9125000000000001 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.325 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 2.05 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.4125 0.0 0.0 0.0 0.0 116-117 2.7249999999999996 0.0 0.0 0.0 0.0 118-119 3.0125 0.0 0.0 0.0 0.0 120-121 3.3499999999999996 0.0 0.0 0.0 0.0 122-123 3.625 0.0 0.0 0.0 0.0 124-125 4.0375 0.0 0.0 0.0 0.0 126-127 4.4625 0.0 0.0 0.0 0.0 128-129 4.9625 0.0 0.0 0.0 0.0 130-131 5.3625 0.0 0.0 0.0 0.0 132-133 5.9 0.0 0.0 0.0 0.0 134-135 6.3875 0.0 0.0 0.0 0.0 136-137 6.775 0.0 0.0 0.0 0.0 138-139 7.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATACCC 10 0.006841402 144.925 7 ATACCCT 10 0.006841402 144.925 8 CAAATGT 10 0.006841402 144.925 3 >>END_MODULE SRR7230798 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230798_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82625 33.0 33.0 34.0 32.0 34.0 2 32.9025 34.0 33.0 34.0 32.0 34.0 3 32.9015 34.0 33.0 34.0 32.0 34.0 4 32.75425 34.0 33.0 34.0 32.0 34.0 5 32.79475 34.0 33.0 34.0 32.0 34.0 6 36.902 38.0 38.0 38.0 36.0 38.0 7 36.82475 38.0 38.0 38.0 36.0 38.0 8 36.78 38.0 38.0 38.0 36.0 38.0 9 36.90275 38.0 38.0 38.0 36.0 38.0 10-14 36.42569999999999 38.0 38.0 38.0 34.0 38.0 15-19 36.65075 38.0 38.0 38.0 35.8 38.0 20-24 36.64925 38.0 38.0 38.0 36.0 38.0 25-29 36.6406 38.0 38.0 38.0 36.0 38.0 30-34 36.42505 38.0 38.0 38.0 34.2 38.0 35-39 36.64445 38.0 38.0 38.0 35.6 38.0 40-44 36.49249999999999 38.0 38.0 38.0 34.8 38.0 45-49 36.44075 38.0 38.0 38.0 34.6 38.0 50-54 36.48465 38.0 38.0 38.0 35.0 38.0 55-59 36.5248 38.0 38.0 38.0 35.2 38.0 60-64 36.5144 38.0 38.0 38.0 35.0 38.0 65-69 36.44285 38.0 38.0 38.0 34.6 38.0 70-74 36.13885 38.0 38.0 38.0 33.4 38.0 75-79 36.2034 38.0 38.0 38.0 34.0 38.0 80-84 36.1673 38.0 38.0 38.0 34.0 38.0 85-89 36.0368 38.0 38.0 38.0 34.0 38.0 90-94 35.7298 38.0 37.8 38.0 32.2 38.0 95-99 35.77395 38.0 37.8 38.0 32.6 38.0 100-104 35.73635 38.0 38.0 38.0 32.6 38.0 105-109 35.2359 38.0 36.8 38.0 29.4 38.0 110-114 35.11665000000001 38.0 36.6 38.0 28.8 38.0 115-119 35.05975 38.0 36.4 38.0 28.4 38.0 120-124 34.8798 38.0 36.2 38.0 27.8 38.0 125-129 34.143600000000006 38.0 35.4 38.0 23.8 38.0 130-134 33.44575 38.0 34.2 38.0 19.8 38.0 135-139 32.8283 38.0 33.4 38.0 15.8 38.0 140-144 32.38875 38.0 32.6 38.0 13.6 38.0 145-149 31.480849999999997 38.0 31.8 38.0 8.6 38.0 150-151 27.631125 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 3.0 4 5.0 5 3.0 6 2.0 7 1.0 8 2.0 9 4.0 10 3.0 11 4.0 12 4.0 13 3.0 14 11.0 15 8.0 16 5.0 17 8.0 18 9.0 19 11.0 20 18.0 21 10.0 22 13.0 23 23.0 24 15.0 25 23.0 26 17.0 27 37.0 28 38.0 29 47.0 30 47.0 31 68.0 32 81.0 33 117.0 34 189.0 35 312.0 36 681.0 37 2166.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.800000000000004 18.925 16.2 25.074999999999996 2 26.625 24.224999999999998 31.424999999999997 17.724999999999998 3 19.975 27.200000000000003 32.175 20.65 4 24.15 35.425000000000004 23.525 16.900000000000002 5 23.674999999999997 37.125 21.825 17.375 6 20.525 36.275 23.275000000000002 19.925 7 18.8 19.55 40.825 20.825 8 20.724999999999998 24.474999999999998 27.800000000000004 27.0 9 21.349999999999998 25.124999999999996 28.749999999999996 24.775 10-14 23.52 28.12 26.58 21.78 15-19 23.265 27.35 28.325 21.060000000000002 20-24 22.96 27.92 28.12 21.0 25-29 23.22 27.83 28.43 20.52 30-34 22.43 27.41 28.925 21.235 35-39 23.119999999999997 27.345000000000002 27.99 21.545 40-44 23.485 28.044999999999998 28.060000000000002 20.41 45-49 23.265 27.400000000000002 28.46 20.875 50-54 22.795 27.584999999999997 28.294999999999998 21.325 55-59 23.685000000000002 27.02 28.035 21.26 60-64 23.71 26.96 28.165000000000003 21.165 65-69 23.79 27.095000000000002 27.765 21.349999999999998 70-74 23.84 27.42 27.534999999999997 21.205 75-79 22.564999999999998 27.534999999999997 28.244999999999997 21.654999999999998 80-84 23.51 27.755000000000003 27.91 20.825 85-89 23.799999999999997 27.1 28.64 20.46 90-94 23.24 27.97 28.015 20.775 95-99 23.595 27.705000000000002 28.29 20.41 100-104 24.279999999999998 27.3 27.694999999999997 20.724999999999998 105-109 23.48 27.88 28.189999999999998 20.45 110-114 24.240000000000002 27.505000000000003 28.04 20.215 115-119 23.865 28.199999999999996 27.48 20.455000000000002 120-124 23.810000000000002 27.865000000000002 27.810000000000002 20.515 125-129 23.990000000000002 28.58 27.485 19.945 130-134 24.709999999999997 27.275 27.54 20.474999999999998 135-139 24.21 27.85 28.12 19.82 140-144 25.009999999999998 27.439999999999998 27.894999999999996 19.655 145-149 25.169999999999998 27.63 27.71 19.49 150-151 25.662499999999998 28.125 27.175 19.037499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.5 16 1.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 3.0 24 3.5 25 3.0 26 3.0 27 5.0 28 8.5 29 15.5 30 21.0 31 23.0 32 32.5 33 37.0 34 47.5 35 68.0 36 76.5 37 100.5 38 123.0 39 135.0 40 175.0 41 213.5 42 234.5 43 254.0 44 269.0 45 277.0 46 262.5 47 258.0 48 246.5 49 203.0 50 173.0 51 153.5 52 126.0 53 97.5 54 82.5 55 71.0 56 58.0 57 44.5 58 29.0 59 19.5 60 12.5 61 7.0 62 7.0 63 5.5 64 3.0 65 1.0 66 0.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1411972720384 98.125 2 0.7072493053801465 1.4000000000000001 3 0.1262945188178833 0.375 4 0.025258903763576663 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.9125000000000001 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.6125 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.2750000000000004 0.0 0.0 0.0 0.0 114-115 2.5 0.0 0.0 0.0 0.0 116-117 2.8 0.0 0.0 0.0 0.0 118-119 3.1375 0.0 0.0 0.0 0.0 120-121 3.4749999999999996 0.0 0.0 0.0 0.0 122-123 3.7 0.0 0.0 0.0 0.0 124-125 4.1 0.0 0.0 0.0 0.0 126-127 4.5125 0.0 0.0 0.0 0.0 128-129 4.975 0.0 0.0 0.0 0.0 130-131 5.375 0.0 0.0 0.0 0.0 132-133 5.9 0.0 0.0 0.0 0.0 134-135 6.375 0.0 0.0 0.0 0.0 136-137 6.775 0.0 0.0 0.0 0.0 138-139 7.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTCCAA 10 0.006830828 145.0 5 >>END_MODULE Read 929852 spots for SRR7230798.sra Written 929852 spots for SRR7230798.sra Read 929852 spots for SRR7230798.sra Written 929852 spots for SRR7230798.sra Read 929852 spots for SRR7230798.sra Written 929852 spots for SRR7230798.sra Read 929852 spots for SRR7230798.sra Written 929852 spots for SRR7230798.sra Read 929852 spots for SRR7230798.sra Written 929852 spots for SRR7230798.sra Read 929852 spots for SRR7230798.sra Written 929852 spots for SRR7230798.sra Read 929852 spots for SRR7230798.sra Written 929852 spots for SRR7230798.sra Read 929852 spots for SRR7230798.sra Written 929852 spots for SRR7230798.sra Read 929852 spots for SRR7230798.sra Written 929852 spots for SRR7230798.sra Read 929852 spots for SRR7230798.sra Written 929852 spots for SRR7230798.sra Read 929852 spots for SRR7230798.sra Written 929852 spots for SRR7230798.sra Read 929852 spots for SRR7230798.sra Written 929852 spots for SRR7230798.sra Read 929852 spots for SRR7230798.sra Written 929852 spots for SRR7230798.sra Read 929852 spots for SRR7230798.sra Written 929852 spots for SRR7230798.sra Read 929869 spots for SRR7230798.sra Written 929869 spots for SRR7230798.sra Read 929852 spots for SRR7230798.sra Written 929852 spots for SRR7230798.sra Read 929852 spots for SRR7230798.sra Written 929852 spots for SRR7230798.sra Read 929852 spots for SRR7230798.sra Written 929852 spots for SRR7230798.sra Read 929852 spots for SRR7230798.sra Written 929852 spots for SRR7230798.sra Read 929852 spots for SRR7230798.sra Written 929852 spots for SRR7230798.sra SRR ids: ['SRR7230798.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6e02l4qn SRR7230798.sra spots: 18597057 blocks: [[1, 929852], [929853, 1859704], [1859705, 2789556], [2789557, 3719408], [3719409, 4649260], [4649261, 5579112], [5579113, 6508964], [6508965, 7438816], [7438817, 8368668], [8368669, 9298520], [9298521, 10228372], [10228373, 11158224], [11158225, 12088076], [12088077, 13017928], [13017929, 13947780], [13947781, 14877632], [14877633, 15807484], [15807485, 16737336], [16737337, 17667188], [17667189, 18597057]] SRR7230798 file size 6280232 SRR7230798 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230798 SRR7230798_1.fastq SRR7230798_2.fastq Input file: SRR7230798_1.fastq Paired file: SRR7230798_2.fastq trimmed: SRR7230798-trimmed-pair1.fastq, SRR7230798-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:59:37 2025 >> started Tue Feb 11 08:59:56 2025 >> done (19.016s) 18597057 read pairs processed; of these: 26221 ( 0.14%) short read pairs filtered out after trimming by size control 20378 ( 0.11%) empty read pairs filtered out after trimming by size control 18550458 (99.75%) read pairs available; of these: 10306587 (55.56%) trimmed read pairs available after processing 8243871 (44.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 6 0.00% 21 4 0.00% 22 12 0.00% 23 9 0.00% 24 12 0.00% 25 12 0.00% 26 17 0.00% 27 10 0.00% 28 15 0.00% 29 24 0.00% 30 16 0.00% 31 29 0.00% 32 15 0.00% 33 13 0.00% 34 22 0.00% 35 18 0.00% 36 32 0.00% 37 26 0.00% 38 24 0.00% 39 26 0.00% 40 32 0.00% 41 48 0.00% 42 44 0.00% 43 32 0.00% 44 42 0.00% 45 52 0.00% 46 56 0.00% 47 95 0.00% 48 80 0.00% 49 95 0.00% 50 114 0.00% 51 138 0.00% 52 134 0.00% 53 142 0.00% 54 206 0.00% 55 181 0.00% 56 198 0.00% 57 224 0.00% 58 246 0.00% 59 265 0.00% 60 370 0.00% 61 408 0.00% 62 462 0.00% 63 466 0.00% 64 531 0.00% 65 578 0.00% 66 661 0.00% 67 773 0.00% 68 911 0.00% 69 1491 0.01% 70 1729 0.01% 71 1386 0.01% 72 1444 0.01% 73 1532 0.01% 74 1743 0.01% 75 1888 0.01% 76 2155 0.01% 77 2364 0.01% 78 2566 0.01% 79 2975 0.02% 80 3339 0.02% 81 3724 0.02% 82 4217 0.02% 83 4858 0.03% 84 6408 0.03% 85 7332 0.04% 86 7987 0.04% 87 8556 0.05% 88 9447 0.05% 89 9749 0.05% 90 10461 0.06% 91 10979 0.06% 92 11567 0.06% 93 12652 0.07% 94 13499 0.07% 95 14217 0.08% 96 14850 0.08% 97 15644 0.08% 98 16437 0.09% 99 17457 0.09% 100 18654 0.10% 101 19500 0.11% 102 20972 0.11% 103 22429 0.12% 104 23270 0.13% 105 25033 0.13% 106 25842 0.14% 107 26853 0.14% 108 28038 0.15% 109 29562 0.16% 110 31044 0.17% 111 32324 0.17% 112 33963 0.18% 113 35698 0.19% 114 37895 0.20% 115 39276 0.21% 116 40500 0.22% 117 42542 0.23% 118 43745 0.24% 119 45594 0.25% 120 47390 0.26% 121 49395 0.27% 122 51404 0.28% 123 54189 0.29% 124 56751 0.31% 125 58709 0.32% 126 61611 0.33% 127 63610 0.34% 128 66047 0.36% 129 70123 0.38% 130 73087 0.39% 131 76064 0.41% 132 79898 0.43% 133 84497 0.46% 134 89687 0.48% 135 94837 0.51% 136 99460 0.54% 137 105906 0.57% 138 112708 0.61% 139 121506 0.66% 140 129400 0.70% 141 143325 0.77% 142 157383 0.85% 143 178190 0.96% 144 204777 1.10% 145 241202 1.30% 146 299870 1.62% 147 397645 2.14% 148 588590 3.17% 149 1110067 5.98% 150 4483939 24.17% 151 8243871 44.44% 18550458 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=19 prefix-density=0.57 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=66.37 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.9 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=18 prefix-density=0.53 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=74.81 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.1 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7230798 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:00:40 Started mapping on | Feb 11 09:00:40 Finished on | Feb 11 09:02:34 Mapping speed, Million of reads per hour | 585.80 Number of input reads | 18550458 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 17261399 Uniquely mapped reads % | 93.05% Average mapped length | 291.86 Number of splices: Total | 16052364 Number of splices: Annotated (sjdb) | 15689159 Number of splices: GT/AG | 15724477 Number of splices: GC/AG | 273130 Number of splices: AT/AC | 9747 Number of splices: Non-canonical | 45010 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 1.99 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 505702 % of reads mapped to multiple loci | 2.73% Number of reads mapped to too many loci | 84764 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.66% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 813544 813544 813544 N_multimapping 505702 505702 505702 N_noFeature 679622 16903709 820440 N_ambiguous 331899 1370 114120 UnstrandedReadsAssigned:16249878 PositiveStrandReadsAssigned:356320 NegativeStrandReadsAssigned:16326839 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7230798 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230798-trimmed-pair1.fastq SRR7230798-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,550,458 reads, 16,385,316 reads pseudoaligned [quant] estimated average fragment length: 239.839 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52401 SRR7230798.ke.tsv 34699 SRR7230798.se.tsv 87100 total ==> SRR7230798.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.16 660 19.589 Potri.005G024800.1.v4.1 1035 796.161 108 7.16319 Potri.004G059700.1.v4.1 961 722.191 43 3.14412 Potri.007G009000.2.v4.1 1416 1177.16 0 0 Potri.003G141000.2.v4.1 2943 2704.16 957 18.688 Potri.016G087400.1.v4.1 270 84.7692 1082 674.02 Potri.015G069301.1.v4.1 564 330.982 0 0 Potri.010G195200.1.v4.1 1773 1534.16 27 0.929344 Potri.012G127500.1.v4.1 977 738.181 113 8.08349 ==> SRR7230798.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1393 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 404 Potri.001G212900.v4.1 28 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR7230798 completed mapping pipeline successfully