Starting /dee2/code/volunteer_pipeline.sh SRR7230799 current disk space = 3055646507008 free memory = 1579348212 SRR7230799 SRAfilesize ba31e5ce37f6c484640b72032c989af3 SRR7230799.sra SRR7230799.sra file validated SRR7230799 is paired end SRR7230799 is conventional basespace SRR7230799 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230799_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.47675 34.0 34.0 34.0 33.0 34.0 2 33.52175 34.0 34.0 34.0 33.0 34.0 3 33.53125 34.0 34.0 34.0 33.0 34.0 4 33.41325 34.0 34.0 34.0 33.0 34.0 5 33.4415 34.0 34.0 34.0 33.0 34.0 6 37.24275 38.0 38.0 38.0 36.0 38.0 7 37.547 38.0 38.0 38.0 37.0 38.0 8 37.60475 38.0 38.0 38.0 38.0 38.0 9 37.641 38.0 38.0 38.0 38.0 38.0 10-14 37.65185 38.0 38.0 38.0 38.0 38.0 15-19 37.355450000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.58795 38.0 38.0 38.0 38.0 38.0 25-29 37.59685 38.0 38.0 38.0 38.0 38.0 30-34 37.583999999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.247550000000004 38.0 38.0 38.0 37.2 38.0 40-44 36.90675 38.0 38.0 38.0 36.0 38.0 45-49 37.0159 38.0 38.0 38.0 36.0 38.0 50-54 36.77155 38.0 37.8 38.0 34.8 38.0 55-59 37.297250000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.3083 38.0 38.0 38.0 37.0 38.0 65-69 37.2324 38.0 38.0 38.0 37.0 38.0 70-74 33.1424 38.0 32.6 38.0 15.8 38.0 75-79 33.433949999999996 38.0 36.6 38.0 16.8 38.0 80-84 35.4388 38.0 38.0 38.0 30.2 38.0 85-89 36.296749999999996 38.0 38.0 38.0 34.0 38.0 90-94 36.56345 38.0 38.0 38.0 34.6 38.0 95-99 36.64465 38.0 38.0 38.0 34.6 38.0 100-104 35.82765 38.0 37.0 38.0 31.0 38.0 105-109 36.2729 38.0 37.6 38.0 33.8 38.0 110-114 35.75670000000001 38.0 36.8 38.0 31.2 38.0 115-119 36.116949999999996 38.0 37.6 38.0 33.6 38.0 120-124 35.34335 38.0 36.2 38.0 29.2 38.0 125-129 35.2007 38.0 35.8 38.0 28.6 38.0 130-134 34.95035 38.0 35.4 38.0 26.0 38.0 135-139 35.056349999999995 38.0 35.4 38.0 29.0 38.0 140-144 34.41585 38.0 35.0 38.0 26.0 38.0 145-149 33.669 38.0 34.0 38.0 21.8 38.0 150-151 30.06275 35.5 28.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 2.0 15 2.0 16 3.0 17 1.0 18 1.0 19 4.0 20 4.0 21 3.0 22 8.0 23 10.0 24 14.0 25 17.0 26 18.0 27 22.0 28 30.0 29 35.0 30 46.0 31 68.0 32 94.0 33 160.0 34 194.0 35 412.0 36 773.0 37 2075.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.0 14.549999999999999 10.625 38.824999999999996 2 19.325 21.925 36.25 22.5 3 18.85 26.674999999999997 26.825 27.650000000000002 4 22.650000000000002 33.225 22.475 21.65 5 20.549999999999997 36.275 25.174999999999997 18.0 6 17.417417417417415 34.95995995995996 27.52752752752753 20.095095095095093 7 13.675 21.15 45.800000000000004 19.375 8 17.775 21.5 31.05 29.675 9 17.1 23.125 33.800000000000004 25.974999999999998 10-14 20.02 28.265 26.995 24.72 15-19 20.119999999999997 27.875 28.345 23.66 20-24 19.975 28.89 27.63 23.505000000000003 25-29 19.325 28.63 28.299999999999997 23.745 30-34 19.86 28.315 27.99 23.835 35-39 19.986975905425037 29.103842107899613 27.240394730250966 23.668787256424384 40-44 20.288471203135995 28.671223238516436 27.078098301336816 23.962207257010753 45-49 20.440220110055026 28.809404702351177 27.35367683841921 23.39669834917459 50-54 20.365 28.27 27.765 23.599999999999998 55-59 20.730182545636406 28.18704676169042 27.306826706676667 23.775943985996502 60-64 20.105 28.46 27.685 23.75 65-69 20.220055013753438 28.207051762940733 27.596899224806204 23.975993998499625 70-74 19.948519948519948 28.157349896480333 27.698505959375524 24.195624195624195 75-79 20.837673373170333 28.370155145003018 27.202456005701443 23.58971547612521 80-84 20.19704433497537 28.31215970961887 27.311381903033443 24.179414052372312 85-89 20.383935337206367 28.911341247789846 27.350340995200806 23.35438241980298 90-94 20.618092713907085 29.124368655298294 26.689003350502578 23.568535280292043 95-99 20.894178835767153 28.705741148229645 27.1004200840168 23.299659931986398 100-104 20.937797127558426 27.87369263874293 27.793624580893763 23.394885652804884 105-109 20.89380442398158 28.02021819637674 27.569812831548397 23.516164548093286 110-114 20.97153434388914 28.285557056381013 26.829756366001302 23.913152233728553 115-119 21.737608162857 28.790076526784375 26.42424848697044 23.048066823388186 120-124 20.669999999999998 27.694999999999997 27.355 24.279999999999998 125-129 21.27127127127127 27.942942942942945 27.25225225225225 23.533533533533532 130-134 21.164737132260814 27.12374079085852 26.963363905177168 24.7481581717035 135-139 21.161058052902646 28.371418570928547 26.366318315915795 24.10120506025301 140-144 21.295323830957738 27.89697424356089 26.446611652913226 24.36109027256814 145-149 21.11027756939235 27.886971742935735 26.911727931983 24.091022755688922 150-151 21.352669083635455 27.790973871733964 26.665833229153645 24.190523815476936 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 2.0 21 3.0 22 3.0 23 2.5 24 2.0 25 4.5 26 7.0 27 9.0 28 18.0 29 23.0 30 28.5 31 37.0 32 43.5 33 57.5 34 65.0 35 70.0 36 88.5 37 122.5 38 152.5 39 171.5 40 215.0 41 233.5 42 226.0 43 251.5 44 269.5 45 261.0 46 232.5 47 219.5 48 213.0 49 187.0 50 165.0 51 134.0 52 107.5 53 83.0 54 61.0 55 52.0 56 38.5 57 31.0 58 31.5 59 22.5 60 15.0 61 13.0 62 7.5 63 4.5 64 2.0 65 1.0 66 2.0 67 3.0 68 3.0 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.185 40-44 0.51 45-49 0.05 50-54 0.0 55-59 0.025 60-64 0.0 65-69 0.025 70-74 10.645 75-79 8.795 80-84 3.5749999999999997 85-89 1.0250000000000001 90-94 0.015 95-99 0.02 100-104 0.08499999999999999 105-109 0.09 110-114 0.055 115-119 0.034999999999999996 120-124 0.0 125-129 0.1 130-134 0.23500000000000001 135-139 0.005 140-144 0.025 145-149 0.025 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32007051120625 98.6 2 0.6295643414756988 1.25 3 0.0503651473180559 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 1.1749999999999998 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.7625 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.675 0.0 0.0 0.0 0.0 118-119 3.0125 0.0 0.0 0.0 0.0 120-121 3.4124999999999996 0.0 0.0 0.0 0.0 122-123 3.825 0.0 0.0 0.0 0.0 124-125 4.1625 0.0 0.0 0.0 0.0 126-127 4.525 0.0 0.0 0.0 0.0 128-129 5.0875 0.0 0.0 0.0 0.0 130-131 5.425 0.0 0.0 0.0 0.0 132-133 5.9125 0.0 0.0 0.0 0.0 134-135 6.3125 0.0 0.0 0.0 0.0 136-137 6.925000000000001 0.0 0.0 0.0 0.0 138-139 7.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGGAT 10 0.0072791097 141.95 6 >>END_MODULE SRR7230799 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230799_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94875 34.0 33.0 34.0 32.0 34.0 2 33.0935 34.0 33.0 34.0 32.0 34.0 3 33.14675 34.0 33.0 34.0 33.0 34.0 4 33.04925 34.0 33.0 34.0 33.0 34.0 5 33.114 34.0 33.0 34.0 33.0 34.0 6 37.23975 38.0 38.0 38.0 37.0 38.0 7 37.31275 38.0 38.0 38.0 37.0 38.0 8 37.29275 38.0 38.0 38.0 37.0 38.0 9 37.23125 38.0 38.0 38.0 37.0 38.0 10-14 37.20775 38.0 38.0 38.0 37.2 38.0 15-19 37.263549999999995 38.0 38.0 38.0 37.8 38.0 20-24 37.1783 38.0 38.0 38.0 37.4 38.0 25-29 37.1745 38.0 38.0 38.0 37.0 38.0 30-34 37.08335 38.0 38.0 38.0 37.2 38.0 35-39 36.977199999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.043299999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.05425 38.0 38.0 38.0 37.0 38.0 50-54 37.0653 38.0 38.0 38.0 37.2 38.0 55-59 36.78665 38.0 38.0 38.0 36.8 38.0 60-64 36.95615 38.0 38.0 38.0 36.8 38.0 65-69 36.816100000000006 38.0 38.0 38.0 36.6 38.0 70-74 36.53175 38.0 38.0 38.0 35.2 38.0 75-79 36.820550000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.838699999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.836149999999996 38.0 38.0 38.0 36.2 38.0 90-94 36.72580000000001 38.0 38.0 38.0 36.0 38.0 95-99 36.65655 38.0 38.0 38.0 35.8 38.0 100-104 36.47645 38.0 38.0 38.0 35.0 38.0 105-109 36.3388 38.0 38.0 38.0 34.2 38.0 110-114 36.351350000000004 38.0 38.0 38.0 34.2 38.0 115-119 36.2667 38.0 38.0 38.0 34.0 38.0 120-124 35.986900000000006 38.0 38.0 38.0 33.6 38.0 125-129 35.7155 38.0 37.8 38.0 32.2 38.0 130-134 35.70575 38.0 37.8 38.0 33.0 38.0 135-139 35.00825 38.0 36.2 38.0 28.8 38.0 140-144 34.635200000000005 38.0 36.0 38.0 28.0 38.0 145-149 33.6591 38.0 35.0 38.0 21.6 38.0 150-151 28.0365 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 7.0 5 2.0 6 1.0 7 1.0 8 3.0 9 0.0 10 2.0 11 3.0 12 2.0 13 2.0 14 4.0 15 1.0 16 4.0 17 7.0 18 3.0 19 4.0 20 6.0 21 7.0 22 8.0 23 9.0 24 13.0 25 13.0 26 19.0 27 18.0 28 19.0 29 25.0 30 40.0 31 45.0 32 56.0 33 60.0 34 121.0 35 206.0 36 540.0 37 2743.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.58137205808713 16.700050075112667 14.997496244366552 30.721081622433648 2 25.081351689612013 25.056320400500624 32.715894868585735 17.146433041301627 3 21.575 27.200000000000003 31.35 19.875 4 24.4 34.55 21.825 19.225 5 23.075000000000003 36.85 22.15 17.925 6 19.725 36.75 24.825 18.7 7 18.45 17.299999999999997 42.675000000000004 21.575 8 20.625 23.225 28.975 27.175 9 22.175 24.125 29.4 24.3 10-14 22.71181354406322 27.948384515354608 26.567970391117335 22.77183154946484 15-19 22.86185855756727 28.08342502750825 28.02840852255677 21.02630789236771 20-24 23.470561752788754 27.7574908708919 27.782502125956682 20.989445250362664 25-29 23.879327596557935 27.62657594556734 27.576545927556534 20.91755053031819 30-34 22.723634180508302 27.456473884330602 28.77226335801481 21.047628577146288 35-39 22.73546191572415 28.23040736662997 28.25542988689821 20.778700830747674 40-44 23.62035322959924 28.078250863060987 27.597938660129085 20.70345724721069 45-49 22.79963953139081 27.8712326023831 27.881245619305094 21.447882246920997 50-54 23.148194520959585 27.68568137426754 27.92607802874743 21.240046076025443 55-59 23.448588253057526 27.73667522270874 27.91786199607429 20.896874528159444 60-64 23.25196731993384 27.141496666833742 28.158989524334622 21.4475464888978 65-69 23.499547602292147 27.53594048456821 27.219262089072082 21.745249824067557 70-74 23.291941078879898 27.21331255341612 27.826655271228194 21.668091096475795 75-79 23.54795137325529 27.675221371754468 27.575166341487815 21.201660913502426 80-84 23.694497343890948 27.47819985967726 28.009421669840634 20.81788112659116 85-89 23.627995397468606 26.88978938416129 27.6652158687278 21.816999349642302 90-94 23.512932112661964 27.320026014307867 27.6652158687278 21.501826004302366 95-99 23.447896342988646 28.170493771574368 27.420081044574516 20.961528840862474 100-104 23.549709941988397 27.345469093818764 28.060612122424484 21.044208841768352 105-109 24.114822964592918 27.600520104020802 27.38047609521904 20.90418083616723 110-114 23.18397997496871 28.105131414267838 28.000000000000004 20.710888610763455 115-119 24.363272454340756 27.225419064298222 27.790843132349263 20.62046534901176 120-124 24.36487297459492 27.775555111022204 27.185437087417487 20.674134826965393 125-129 24.59491898379676 27.655531106221243 27.20544108821764 20.544108821764354 130-134 24.432329698909673 27.938381514454335 27.308192457737324 20.32109632889867 135-139 24.51629072681704 28.12531328320802 27.167919799498748 20.19047619047619 140-144 25.445089017803564 27.545509101820365 26.9503900780156 20.059011802360473 145-149 25.35507101420284 28.09061812362473 26.505301060212044 20.04900980196039 150-151 26.575 26.737499999999997 27.525 19.162499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 2.0 22 1.5 23 1.5 24 3.5 25 3.5 26 4.0 27 8.5 28 9.0 29 10.5 30 18.0 31 20.0 32 27.5 33 37.5 34 47.5 35 59.5 36 72.0 37 104.5 38 119.0 39 145.5 40 194.0 41 207.0 42 231.5 43 262.5 44 270.5 45 278.5 46 254.5 47 240.5 48 236.0 49 209.5 50 167.0 51 134.0 52 125.5 53 106.5 54 90.5 55 70.0 56 53.0 57 42.0 58 34.0 59 31.5 60 22.0 61 12.5 62 10.5 63 7.0 64 3.0 65 1.0 66 1.0 67 2.0 68 2.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.03 15-19 0.03 20-24 0.045 25-29 0.06 30-34 0.06 35-39 0.09 40-44 0.065 45-49 0.13 50-54 0.165 55-59 0.655 60-64 0.245 65-69 0.53 70-74 0.545 75-79 0.055 80-84 0.22999999999999998 85-89 0.055 90-94 0.055 95-99 0.055 100-104 0.02 105-109 0.02 110-114 0.125 115-119 0.075 120-124 0.02 125-129 0.02 130-134 0.03 135-139 0.25 140-144 0.02 145-149 0.02 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16666666666667 98.175 2 0.7070707070707071 1.4000000000000001 3 0.07575757575757576 0.22499999999999998 4 0.050505050505050504 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.7875000000000001 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.8125 0.0 0.0 0.0 0.0 112-113 2.1625 0.0 0.0 0.0 0.0 114-115 2.4749999999999996 0.0 0.0 0.0 0.0 116-117 2.7750000000000004 0.0 0.0 0.0 0.0 118-119 3.0999999999999996 0.0 0.0 0.0 0.0 120-121 3.4875 0.0 0.0 0.0 0.0 122-123 3.9000000000000004 0.0 0.0 0.0 0.0 124-125 4.2375 0.0 0.0 0.0 0.0 126-127 4.6 0.0 0.0 0.0 0.0 128-129 5.1375 0.0 0.0 0.0 0.0 130-131 5.475 0.0 0.0 0.0 0.0 132-133 5.9625 0.0 0.0 0.0 0.0 134-135 6.3625 0.0 0.0 0.0 0.0 136-137 6.975 0.0 0.0 0.0 0.0 138-139 7.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCCCTT 10 0.006875036 144.6875 7 AGGCCCT 10 0.006875036 144.6875 6 >>END_MODULE Read 642458 spots for SRR7230799.sra Written 642458 spots for SRR7230799.sra Read 642458 spots for SRR7230799.sra Written 642458 spots for SRR7230799.sra Read 642458 spots for SRR7230799.sra Written 642458 spots for SRR7230799.sra Read 642458 spots for SRR7230799.sra Written 642458 spots for SRR7230799.sra Read 642458 spots for SRR7230799.sra Written 642458 spots for SRR7230799.sra Read 642466 spots for SRR7230799.sra Written 642466 spots for SRR7230799.sra Read 642458 spots for SRR7230799.sra Written 642458 spots for SRR7230799.sra Read 642458 spots for SRR7230799.sra Written 642458 spots for SRR7230799.sra Read 642458 spots for SRR7230799.sra Written 642458 spots for SRR7230799.sra Read 642458 spots for SRR7230799.sra Written 642458 spots for SRR7230799.sra Read 642458 spots for SRR7230799.sra Written 642458 spots for SRR7230799.sra Read 642458 spots for SRR7230799.sra Written 642458 spots for SRR7230799.sra Read 642458 spots for SRR7230799.sra Written 642458 spots for SRR7230799.sra Read 642458 spots for SRR7230799.sra Written 642458 spots for SRR7230799.sra Read 642458 spots for SRR7230799.sra Written 642458 spots for SRR7230799.sra Read 642458 spots for SRR7230799.sra Written 642458 spots for SRR7230799.sra Read 642458 spots for SRR7230799.sra Written 642458 spots for SRR7230799.sra Read 642458 spots for SRR7230799.sra Written 642458 spots for SRR7230799.sra Read 642458 spots for SRR7230799.sra Written 642458 spots for SRR7230799.sra Read 642458 spots for SRR7230799.sra Written 642458 spots for SRR7230799.sra SRR ids: ['SRR7230799.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0g4e5n2k SRR7230799.sra spots: 12849168 blocks: [[1, 642458], [642459, 1284916], [1284917, 1927374], [1927375, 2569832], [2569833, 3212290], [3212291, 3854748], [3854749, 4497206], [4497207, 5139664], [5139665, 5782122], [5782123, 6424580], [6424581, 7067038], [7067039, 7709496], [7709497, 8351954], [8351955, 8994412], [8994413, 9636870], [9636871, 10279328], [10279329, 10921786], [10921787, 11564244], [11564245, 12206702], [12206703, 12849168]] SRR7230799 file size 4332461 SRR7230799 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230799 SRR7230799_1.fastq SRR7230799_2.fastq Input file: SRR7230799_1.fastq Paired file: SRR7230799_2.fastq trimmed: SRR7230799-trimmed-pair1.fastq, SRR7230799-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:56:19 2025 >> started Tue Feb 11 08:56:34 2025 >> done (14.748s) 12849168 read pairs processed; of these: 13929 ( 0.11%) short read pairs filtered out after trimming by size control 10632 ( 0.08%) empty read pairs filtered out after trimming by size control 12824607 (99.81%) read pairs available; of these: 5648363 (44.04%) trimmed read pairs available after processing 7176244 (55.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 2 0.00% 21 4 0.00% 22 2 0.00% 23 0 0.00% 24 3 0.00% 25 7 0.00% 26 3 0.00% 27 3 0.00% 28 5 0.00% 29 6 0.00% 30 4 0.00% 31 6 0.00% 32 16 0.00% 33 8 0.00% 34 8 0.00% 35 9 0.00% 36 5 0.00% 37 14 0.00% 38 11 0.00% 39 15 0.00% 40 17 0.00% 41 28 0.00% 42 30 0.00% 43 31 0.00% 44 20 0.00% 45 30 0.00% 46 30 0.00% 47 48 0.00% 48 45 0.00% 49 49 0.00% 50 48 0.00% 51 56 0.00% 52 74 0.00% 53 108 0.00% 54 91 0.00% 55 93 0.00% 56 160 0.00% 57 153 0.00% 58 202 0.00% 59 204 0.00% 60 202 0.00% 61 222 0.00% 62 233 0.00% 63 298 0.00% 64 309 0.00% 65 309 0.00% 66 428 0.00% 67 521 0.00% 68 602 0.00% 69 947 0.01% 70 825 0.01% 71 700 0.01% 72 841 0.01% 73 994 0.01% 74 996 0.01% 75 1148 0.01% 76 1226 0.01% 77 1356 0.01% 78 1584 0.01% 79 1766 0.01% 80 2185 0.02% 81 2666 0.02% 82 2488 0.02% 83 2822 0.02% 84 4153 0.03% 85 4222 0.03% 86 4517 0.04% 87 4771 0.04% 88 5281 0.04% 89 5568 0.04% 90 6022 0.05% 91 6566 0.05% 92 7156 0.06% 93 7721 0.06% 94 8186 0.06% 95 8761 0.07% 96 9323 0.07% 97 9742 0.08% 98 10422 0.08% 99 10905 0.09% 100 11871 0.09% 101 12375 0.10% 102 13286 0.10% 103 13959 0.11% 104 14702 0.11% 105 15717 0.12% 106 16441 0.13% 107 17391 0.14% 108 18168 0.14% 109 18996 0.15% 110 19902 0.16% 111 21375 0.17% 112 21825 0.17% 113 22920 0.18% 114 24199 0.19% 115 25137 0.20% 116 26023 0.20% 117 26877 0.21% 118 28683 0.22% 119 29313 0.23% 120 30366 0.24% 121 31810 0.25% 122 32878 0.26% 123 34474 0.27% 124 35726 0.28% 125 36819 0.29% 126 37794 0.29% 127 39333 0.31% 128 41021 0.32% 129 42741 0.33% 130 43988 0.34% 131 45628 0.36% 132 46517 0.36% 133 49568 0.39% 134 51418 0.40% 135 53178 0.41% 136 55700 0.43% 137 58274 0.45% 138 60623 0.47% 139 64310 0.50% 140 67050 0.52% 141 71145 0.55% 142 77228 0.60% 143 83441 0.65% 144 94049 0.73% 145 106824 0.83% 146 126852 0.99% 147 161315 1.26% 148 233298 1.82% 149 448825 3.50% 150 2746368 21.41% 151 7176244 55.96% 12824607 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.67 fanout-score-rank=7 prefix-density=0.65 prefix-fanout=3.0 sequence=CCATTGCTTGCAATGGAAGTAATGTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=399.65 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=18 prefix-density=0.60 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=20 fanout-score=53.48 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.5 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACT SRR7230799 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:57:18 Started mapping on | Feb 11 08:57:19 Finished on | Feb 11 08:58:45 Mapping speed, Million of reads per hour | 536.84 Number of input reads | 12824607 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11939276 Uniquely mapped reads % | 93.10% Average mapped length | 293.33 Number of splices: Total | 11494540 Number of splices: Annotated (sjdb) | 11246859 Number of splices: GT/AG | 11268641 Number of splices: GC/AG | 187530 Number of splices: AT/AC | 6824 Number of splices: Non-canonical | 31545 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 334792 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 162283 % of reads mapped to too many loci | 1.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.82% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 565168 565168 565168 N_multimapping 334792 334792 334792 N_noFeature 504301 11713884 609412 N_ambiguous 194621 887 73703 UnstrandedReadsAssigned:11240354 PositiveStrandReadsAssigned:224505 NegativeStrandReadsAssigned:11256161 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7230799 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230799-trimmed-pair1.fastq SRR7230799-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,824,607 reads, 11,357,300 reads pseudoaligned [quant] estimated average fragment length: 231.418 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 980 rounds 52401 SRR7230799.ke.tsv 34699 SRR7230799.se.tsv 87100 total ==> SRR7230799.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.58 326 14.7885 Potri.005G024800.1.v4.1 1035 804.582 149 15.0172 Potri.004G059700.1.v4.1 961 730.62 9 0.998904 Potri.007G009000.2.v4.1 1416 1185.58 0 0 Potri.003G141000.2.v4.1 2943 2712.58 853.468 25.5139 Potri.016G087400.1.v4.1 270 85.6816 515 487.407 Potri.015G069301.1.v4.1 564 338.635 0 0 Potri.010G195200.1.v4.1 1773 1542.58 16 0.841094 Potri.012G127500.1.v4.1 977 746.598 188 20.4194 ==> SRR7230799.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 623 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 213 Potri.001G212900.v4.1 75 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7230799 completed mapping pipeline successfully