Starting /dee2/code/volunteer_pipeline.sh SRR7230800 current disk space = 3055704481792 free memory = 1505558272 SRR7230800 SRAfilesize 7fef9e6e0e24d9c2fa3385da0c57abfa SRR7230800.sra SRR7230800.sra file validated SRR7230800 is paired end SRR7230800 is conventional basespace SRR7230800 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230800_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3695 34.0 33.0 34.0 33.0 34.0 2 33.4225 34.0 33.0 34.0 33.0 34.0 3 33.44725 34.0 33.0 34.0 33.0 34.0 4 33.42125 34.0 34.0 34.0 33.0 34.0 5 33.419 34.0 34.0 34.0 33.0 34.0 6 37.21475 38.0 38.0 38.0 36.0 38.0 7 37.4955 38.0 38.0 38.0 37.0 38.0 8 37.5545 38.0 38.0 38.0 38.0 38.0 9 37.55725 38.0 38.0 38.0 38.0 38.0 10-14 37.5323 38.0 38.0 38.0 38.0 38.0 15-19 37.47025000000001 38.0 38.0 38.0 37.6 38.0 20-24 37.359 38.0 38.0 38.0 37.2 38.0 25-29 37.371050000000004 38.0 38.0 38.0 37.6 38.0 30-34 37.542449999999995 38.0 38.0 38.0 37.8 38.0 35-39 37.3889 38.0 38.0 38.0 37.4 38.0 40-44 36.8726 38.0 38.0 38.0 35.6 38.0 45-49 37.23545 38.0 38.0 38.0 36.6 38.0 50-54 37.334700000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.23885 38.0 38.0 38.0 36.8 38.0 60-64 37.23515 38.0 38.0 38.0 37.0 38.0 65-69 37.23265 38.0 38.0 38.0 37.0 38.0 70-74 29.802999999999997 38.0 19.0 38.0 15.6 38.0 75-79 30.8361 38.0 30.8 38.0 2.0 38.0 80-84 34.200149999999994 38.0 36.6 38.0 22.0 38.0 85-89 36.173 38.0 38.0 38.0 32.6 38.0 90-94 36.43355 38.0 38.0 38.0 34.0 38.0 95-99 36.50079999999999 38.0 38.0 38.0 34.0 38.0 100-104 36.5029 38.0 38.0 38.0 34.2 38.0 105-109 36.542899999999996 38.0 38.0 38.0 34.0 38.0 110-114 34.81215 38.0 35.6 38.0 25.4 38.0 115-119 34.62175 38.0 34.6 38.0 26.2 38.0 120-124 35.4341 38.0 36.2 38.0 29.8 38.0 125-129 34.46825 38.0 34.8 38.0 23.4 38.0 130-134 34.78965000000001 38.0 35.6 38.0 25.6 38.0 135-139 34.06875 38.0 34.0 38.0 23.4 38.0 140-144 34.5748 38.0 34.6 38.0 28.0 38.0 145-149 33.88555 38.0 33.8 38.0 24.2 38.0 150-151 29.871125 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 2.0 14 1.0 15 1.0 16 0.0 17 2.0 18 4.0 19 2.0 20 3.0 21 8.0 22 7.0 23 9.0 24 6.0 25 11.0 26 18.0 27 31.0 28 45.0 29 36.0 30 58.0 31 84.0 32 123.0 33 216.0 34 328.0 35 475.0 36 908.0 37 1618.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.75 15.950000000000001 11.1 39.2 2 20.95 21.625 36.449999999999996 20.974999999999998 3 18.525 27.825 25.924999999999997 27.725 4 21.3 34.575 22.075 22.05 5 21.125 37.05 23.75 18.075 6 16.25 36.525 27.375 19.85 7 12.85 21.099999999999998 46.85 19.2 8 17.875 23.775 31.4 26.950000000000003 9 16.525000000000002 22.0 33.95 27.525 10-14 19.52292843926589 29.099364904735708 27.20908136220433 24.16862529379407 15-19 19.555 28.744999999999997 28.185 23.515 20-24 19.38 28.88 27.779999999999998 23.96 25-29 19.754816112084065 29.507130347760818 27.31548661496122 23.422566925193898 30-34 19.475973798689935 28.936446822341118 27.531376568828442 24.056202810140505 35-39 20.108016202430363 28.594289143371505 27.229084362654397 24.06861029154373 40-44 19.884856070087608 28.8360450563204 27.67959949937422 23.59949937421777 45-49 19.945 28.415000000000003 27.889999999999997 23.75 50-54 20.48 27.815 28.275 23.43 55-59 19.790832666132907 28.888110488390712 27.997397918334666 23.323658927141715 60-64 19.837894631510483 28.94881673087507 27.277730524841147 23.935558112773304 65-69 19.93398679735947 28.785757151430285 27.860572114422883 23.419683936787358 70-74 20.976816074188562 28.531684698608966 27.857805255023184 22.633693972179287 75-79 20.052910052910054 28.95355673133451 27.336860670194003 23.656672545561435 80-84 19.884221148228796 28.9287800732912 27.95687503319348 23.230123745286527 85-89 20.218827207179952 28.26097917612061 27.736600615136386 23.78359300156305 90-94 20.538215286114443 28.666466586634655 27.826130452180877 22.969187675070028 95-99 20.87 28.465 27.96 22.705000000000002 100-104 21.05026256564141 28.207051762940733 27.49687421855464 23.245811452863215 105-109 20.745 28.16 27.91 23.185 110-114 20.76 27.894999999999996 28.110000000000003 23.235 115-119 20.446022301115054 28.66143307165358 27.05635281764088 23.836191809590478 120-124 20.315394242803507 28.44055068836045 27.914893617021274 23.329161451814766 125-129 20.75 28.015 27.505000000000003 23.73 130-134 21.09 28.275 27.405 23.23 135-139 20.385 28.810000000000002 26.745 24.060000000000002 140-144 21.4 28.675 26.16 23.765 145-149 21.534306861372272 28.11562312462493 26.750350070014 23.5997199439888 150-151 21.025 29.4875 26.4125 23.075000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 1.5 21 2.5 22 3.0 23 4.0 24 4.0 25 6.0 26 11.5 27 16.0 28 22.5 29 25.5 30 31.5 31 37.0 32 43.0 33 65.5 34 80.5 35 108.0 36 135.5 37 147.0 38 166.5 39 185.5 40 216.5 41 241.0 42 240.5 43 241.5 44 253.0 45 242.0 46 226.0 47 229.0 48 199.0 49 163.0 50 141.5 51 110.5 52 91.5 53 76.5 54 54.0 55 43.5 56 34.5 57 23.5 58 21.5 59 18.0 60 12.0 61 7.0 62 4.5 63 3.0 64 2.0 65 2.0 66 1.5 67 0.0 68 0.5 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.0 20-24 0.0 25-29 0.075 30-34 0.005 35-39 0.015 40-44 0.125 45-49 0.0 50-54 0.0 55-59 0.08 60-64 0.065 65-69 0.02 70-74 19.125 75-79 14.95 80-84 5.8549999999999995 85-89 0.835 90-94 0.04 95-99 0.0 100-104 0.025 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.125 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.02 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5534591194968553 1.0999999999999999 3 0.0 0.0 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.7250000000000001 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.1124999999999998 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.6625 0.0 0.0 0.0 0.0 116-117 1.8125 0.0 0.0 0.0 0.0 118-119 2.075 0.0 0.0 0.0 0.0 120-121 2.25 0.0 0.0 0.0 0.0 122-123 2.6125 0.0 0.0 0.0 0.0 124-125 2.8875 0.0 0.0 0.0 0.0 126-127 3.175 0.0 0.0 0.0 0.0 128-129 3.6500000000000004 0.0 0.0 0.0 0.0 130-131 4.0375 0.0 0.0 0.0 0.0 132-133 4.5125 0.0 0.0 0.0 0.0 134-135 5.05 0.0 0.0 0.0 0.0 136-137 5.574999999999999 0.0 0.0 0.0 0.0 138-139 6.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTGAA 10 0.007498043 140.55 8 TCAATTC 10 0.007498043 140.55 2 ACATATT 10 0.007498043 140.55 5 CACCTGG 10 0.007498043 140.55 3 AACATAT 10 0.007498043 140.55 4 >>END_MODULE SRR7230800 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230800_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8735 33.0 33.0 34.0 32.0 34.0 2 33.05075 34.0 33.0 34.0 32.0 34.0 3 33.078 34.0 33.0 34.0 33.0 34.0 4 33.0105 34.0 33.0 34.0 33.0 34.0 5 33.013 34.0 33.0 34.0 32.0 34.0 6 36.87425 38.0 38.0 38.0 36.0 38.0 7 37.001 38.0 38.0 38.0 36.0 38.0 8 36.85825 38.0 38.0 38.0 36.0 38.0 9 36.85925 38.0 38.0 38.0 36.0 38.0 10-14 36.90195 38.0 38.0 38.0 36.0 38.0 15-19 37.07245 38.0 38.0 38.0 36.8 38.0 20-24 37.0075 38.0 38.0 38.0 36.8 38.0 25-29 36.95405 38.0 38.0 38.0 36.6 38.0 30-34 36.878249999999994 38.0 38.0 38.0 36.2 38.0 35-39 36.53349999999999 38.0 38.0 38.0 35.2 38.0 40-44 36.356100000000005 38.0 38.0 38.0 34.2 38.0 45-49 36.85955 38.0 38.0 38.0 36.0 38.0 50-54 36.83935 38.0 38.0 38.0 36.0 38.0 55-59 36.26800000000001 38.0 38.0 38.0 33.8 38.0 60-64 36.6774 38.0 38.0 38.0 35.2 38.0 65-69 36.3022 38.0 38.0 38.0 35.2 38.0 70-74 36.2679 38.0 38.0 38.0 34.2 38.0 75-79 36.59245 38.0 38.0 38.0 35.4 38.0 80-84 36.5242 38.0 38.0 38.0 34.8 38.0 85-89 36.4652 38.0 38.0 38.0 34.6 38.0 90-94 36.376999999999995 38.0 38.0 38.0 34.2 38.0 95-99 35.79805 38.0 37.2 38.0 31.2 38.0 100-104 35.86265 38.0 37.8 38.0 32.0 38.0 105-109 35.27475 38.0 36.4 38.0 28.6 38.0 110-114 35.734300000000005 38.0 37.0 38.0 32.2 38.0 115-119 35.803450000000005 38.0 37.2 38.0 33.0 38.0 120-124 35.4932 38.0 36.8 38.0 30.4 38.0 125-129 35.13175 38.0 36.0 38.0 28.2 38.0 130-134 35.0661 38.0 36.0 38.0 29.4 38.0 135-139 34.7238 38.0 35.8 38.0 27.4 38.0 140-144 34.1828 38.0 34.8 38.0 25.0 38.0 145-149 33.22535 38.0 33.4 38.0 16.0 38.0 150-151 27.18025 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 4.0 4 6.0 5 1.0 6 1.0 7 2.0 8 2.0 9 2.0 10 0.0 11 2.0 12 1.0 13 3.0 14 2.0 15 5.0 16 6.0 17 5.0 18 5.0 19 11.0 20 10.0 21 1.0 22 9.0 23 15.0 24 18.0 25 16.0 26 26.0 27 33.0 28 31.0 29 52.0 30 58.0 31 57.0 32 77.0 33 97.0 34 167.0 35 247.0 36 570.0 37 2455.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.65 17.65 14.674999999999999 30.025000000000002 2 24.725 24.0 34.599999999999994 16.675 3 19.825 26.55 31.55 22.075 4 25.025 35.65 22.075 17.25 5 22.525000000000002 37.05 23.35 17.075000000000003 6 19.225 35.9 26.474999999999998 18.4 7 18.65 16.950000000000003 41.875 22.525000000000002 8 21.925 21.525 30.099999999999998 26.450000000000003 9 22.425 23.3 30.275000000000002 24.0 10-14 22.814999999999998 28.720000000000002 26.66 21.805 15-19 22.11 28.185 28.499999999999996 21.205 20-24 22.64 27.41 28.549999999999997 21.4 25-29 22.61 28.199999999999996 28.27 20.919999999999998 30-34 22.634999999999998 27.905 28.494999999999997 20.965 35-39 22.485118303236458 28.077634935721075 27.84753138912511 21.58971537191736 40-44 23.088463269490422 27.86417962694404 28.27924188628294 20.768115217282592 45-49 22.893434015102265 27.664149622443368 28.424263639545934 21.018152722908436 50-54 22.73 27.955000000000002 27.93 21.385 55-59 22.89089994972348 28.169934640522875 28.01407742584213 20.925087983911514 60-64 23.154630926185238 27.905581116223242 28.535707141428286 20.404080816163233 65-69 23.020891294450905 27.892154383125096 27.704992665284028 21.381961657139968 70-74 23.22239031770045 27.377710539586488 28.139183055975792 21.260716086737265 75-79 23.535 28.21 27.634999999999998 20.62 80-84 23.171585792896447 27.71385692846423 27.888944472236116 21.225612806403202 85-89 22.53 28.185 28.015 21.27 90-94 23.24 28.32 27.785 20.655 95-99 22.759999999999998 28.03 28.13 21.08 100-104 23.56 28.43 27.915 20.095 105-109 23.895 27.47 28.360000000000003 20.275000000000002 110-114 23.565 27.72 28.37 20.345 115-119 24.095 27.605 27.605 20.695 120-124 23.86 27.575 28.125 20.44 125-129 23.465 27.839999999999996 28.155 20.54 130-134 24.490000000000002 27.655 28.035 19.82 135-139 24.4736710506576 28.444266639996002 27.659148872330853 19.422913437015552 140-144 25.123793327664686 27.924773670784774 27.279547841744613 19.67188515980593 145-149 25.369999999999997 27.779999999999998 27.534999999999997 19.314999999999998 150-151 25.1 26.8125 27.5125 20.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 1.0 20 1.0 21 2.0 22 4.0 23 3.5 24 1.5 25 4.5 26 5.0 27 5.5 28 12.5 29 15.0 30 21.0 31 26.0 32 27.5 33 38.0 34 57.5 35 69.0 36 80.5 37 100.5 38 123.5 39 172.5 40 209.0 41 235.5 42 268.5 43 267.5 44 256.5 45 268.0 46 250.0 47 222.0 48 215.0 49 206.5 50 179.5 51 132.0 52 105.5 53 98.0 54 81.5 55 63.0 56 51.5 57 36.0 58 23.0 59 15.0 60 12.0 61 10.0 62 6.5 63 2.5 64 2.5 65 2.0 66 0.5 67 1.5 68 1.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.045 40-44 0.015 45-49 0.015 50-54 0.0 55-59 0.5499999999999999 60-64 0.02 65-69 1.155 70-74 0.8500000000000001 75-79 0.0 80-84 0.05 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.015 140-144 0.034999999999999996 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47089947089947 98.7 2 0.3779289493575208 0.75 3 0.10078105316200556 0.3 4 0.0 0.0 5 0.05039052658100278 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.7250000000000001 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.5125000000000002 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 1.925 0.0 0.0 0.0 0.0 118-119 2.2 0.0 0.0 0.0 0.0 120-121 2.375 0.0 0.0 0.0 0.0 122-123 2.7625 0.0 0.0 0.0 0.0 124-125 3.05 0.0 0.0 0.0 0.0 126-127 3.3625 0.0 0.0 0.0 0.0 128-129 3.825 0.0 0.0 0.0 0.0 130-131 4.262499999999999 0.0 0.0 0.0 0.0 132-133 4.7375 0.0 0.0 0.0 0.0 134-135 5.300000000000001 0.0 0.0 0.0 0.0 136-137 5.85 0.0 0.0 0.0 0.0 138-139 6.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACAAGC 10 0.006867937 144.7375 2 AAAGACT 10 0.006867937 144.7375 2 >>END_MODULE Read 1051150 spots for SRR7230800.sra Written 1051150 spots for SRR7230800.sra Read 1051150 spots for SRR7230800.sra Written 1051150 spots for SRR7230800.sra Read 1051150 spots for SRR7230800.sra Written 1051150 spots for SRR7230800.sra Read 1051150 spots for SRR7230800.sra Written 1051150 spots for SRR7230800.sra Read 1051150 spots for SRR7230800.sra Written 1051150 spots for SRR7230800.sra Read 1051150 spots for SRR7230800.sra Written 1051150 spots for SRR7230800.sra Read 1051150 spots for SRR7230800.sra Written 1051150 spots for SRR7230800.sra Read 1051150 spots for SRR7230800.sra Written 1051150 spots for SRR7230800.sra Read 1051150 spots for SRR7230800.sra Written 1051150 spots for SRR7230800.sra Read 1051150 spots for SRR7230800.sra Written 1051150 spots for SRR7230800.sra Read 1051150 spots for SRR7230800.sra Written 1051150 spots for SRR7230800.sra Read 1051150 spots for SRR7230800.sra Written 1051150 spots for SRR7230800.sra Read 1051150 spots for SRR7230800.sra Written 1051150 spots for SRR7230800.sra Read 1051166 spots for SRR7230800.sra Written 1051166 spots for SRR7230800.sra Read 1051150 spots for SRR7230800.sra Written 1051150 spots for SRR7230800.sra Read 1051150 spots for SRR7230800.sra Written 1051150 spots for SRR7230800.sra Read 1051150 spots for SRR7230800.sra Written 1051150 spots for SRR7230800.sra Read 1051150 spots for SRR7230800.sra Written 1051150 spots for SRR7230800.sra Read 1051150 spots for SRR7230800.sra Written 1051150 spots for SRR7230800.sra Read 1051150 spots for SRR7230800.sra Written 1051150 spots for SRR7230800.sra SRR ids: ['SRR7230800.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4d6g1nte SRR7230800.sra spots: 21023016 blocks: [[1, 1051150], [1051151, 2102300], [2102301, 3153450], [3153451, 4204600], [4204601, 5255750], [5255751, 6306900], [6306901, 7358050], [7358051, 8409200], [8409201, 9460350], [9460351, 10511500], [10511501, 11562650], [11562651, 12613800], [12613801, 13664950], [13664951, 14716100], [14716101, 15767250], [15767251, 16818400], [16818401, 17869550], [17869551, 18920700], [18920701, 19971850], [19971851, 21023016]] SRR7230800 file size 7102309 SRR7230800 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230800 SRR7230800_1.fastq SRR7230800_2.fastq Input file: SRR7230800_1.fastq Paired file: SRR7230800_2.fastq trimmed: SRR7230800-trimmed-pair1.fastq, SRR7230800-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:37:45 2025 >> started Tue Feb 11 08:38:12 2025 >> done (26.926s) 21023016 read pairs processed; of these: 25135 ( 0.12%) short read pairs filtered out after trimming by size control 22946 ( 0.11%) empty read pairs filtered out after trimming by size control 20974935 (99.77%) read pairs available; of these: 9448484 (45.05%) trimmed read pairs available after processing 11526451 (54.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 1 0.00% 20 8 0.00% 21 4 0.00% 22 2 0.00% 23 6 0.00% 24 5 0.00% 25 8 0.00% 26 8 0.00% 27 11 0.00% 28 18 0.00% 29 8 0.00% 30 13 0.00% 31 11 0.00% 32 10 0.00% 33 13 0.00% 34 13 0.00% 35 21 0.00% 36 21 0.00% 37 18 0.00% 38 23 0.00% 39 28 0.00% 40 27 0.00% 41 27 0.00% 42 38 0.00% 43 39 0.00% 44 48 0.00% 45 40 0.00% 46 49 0.00% 47 50 0.00% 48 64 0.00% 49 70 0.00% 50 82 0.00% 51 82 0.00% 52 101 0.00% 53 95 0.00% 54 104 0.00% 55 121 0.00% 56 136 0.00% 57 144 0.00% 58 160 0.00% 59 200 0.00% 60 202 0.00% 61 285 0.00% 62 255 0.00% 63 313 0.00% 64 325 0.00% 65 375 0.00% 66 377 0.00% 67 500 0.00% 68 611 0.00% 69 1154 0.01% 70 1079 0.01% 71 761 0.00% 72 802 0.00% 73 883 0.00% 74 1076 0.01% 75 1169 0.01% 76 1261 0.01% 77 1473 0.01% 78 1651 0.01% 79 1769 0.01% 80 1989 0.01% 81 2261 0.01% 82 3155 0.02% 83 2888 0.01% 84 4389 0.02% 85 5076 0.02% 86 5616 0.03% 87 5792 0.03% 88 6276 0.03% 89 6509 0.03% 90 6974 0.03% 91 7617 0.04% 92 8297 0.04% 93 8960 0.04% 94 9683 0.05% 95 10224 0.05% 96 11267 0.05% 97 12069 0.06% 98 12961 0.06% 99 14113 0.07% 100 14673 0.07% 101 16002 0.08% 102 17041 0.08% 103 18302 0.09% 104 19268 0.09% 105 20597 0.10% 106 22211 0.11% 107 23298 0.11% 108 24720 0.12% 109 26709 0.13% 110 27956 0.13% 111 29860 0.14% 112 31361 0.15% 113 32678 0.16% 114 34619 0.17% 115 36296 0.17% 116 38194 0.18% 117 40011 0.19% 118 42239 0.20% 119 43892 0.21% 120 46390 0.22% 121 48127 0.23% 122 50306 0.24% 123 52638 0.25% 124 54535 0.26% 125 56724 0.27% 126 59419 0.28% 127 61831 0.29% 128 64447 0.31% 129 67713 0.32% 130 70672 0.34% 131 72957 0.35% 132 76973 0.37% 133 81529 0.39% 134 84734 0.40% 135 89103 0.42% 136 93531 0.45% 137 99304 0.47% 138 103269 0.49% 139 109869 0.52% 140 116519 0.56% 141 126166 0.60% 142 137837 0.66% 143 150555 0.72% 144 170290 0.81% 145 195845 0.93% 146 235968 1.12% 147 305671 1.46% 148 438390 2.09% 149 817492 3.90% 150 4585383 21.86% 151 11526451 54.95% 20974935 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=19 prefix-density=0.38 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.14 sequence-density-rank=20 fanout-score=13.51 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=2.5 sequence=TGCTTGCTTCTTCTAATCCACTGGAGAACTTTATTTA criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=25 prefix-density=0.44 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=46.46 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.5 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT SRR7230800 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:39:03 Started mapping on | Feb 11 08:39:03 Finished on | Feb 11 08:42:19 Mapping speed, Million of reads per hour | 385.25 Number of input reads | 20974935 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 19433939 Uniquely mapped reads % | 92.65% Average mapped length | 293.80 Number of splices: Total | 18915828 Number of splices: Annotated (sjdb) | 18457200 Number of splices: GT/AG | 18548837 Number of splices: GC/AG | 286265 Number of splices: AT/AC | 11262 Number of splices: Non-canonical | 69464 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 607315 % of reads mapped to multiple loci | 2.90% Number of reads mapped to too many loci | 102608 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.83% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 958987 958987 958987 N_multimapping 607315 607315 607315 N_noFeature 755283 19105455 900673 N_ambiguous 353879 1520 169848 UnstrandedReadsAssigned:18324777 PositiveStrandReadsAssigned:326964 NegativeStrandReadsAssigned:18363418 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7230800 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230800-trimmed-pair1.fastq SRR7230800-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,974,935 reads, 18,352,507 reads pseudoaligned [quant] estimated average fragment length: 237.799 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,220 rounds 52401 SRR7230800.ke.tsv 34699 SRR7230800.se.tsv 87100 total ==> SRR7230800.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.2 1416 39.4354 Potri.005G024800.1.v4.1 1035 798.201 384 23.8646 Potri.004G059700.1.v4.1 961 724.295 2 0.136978 Potri.007G009000.2.v4.1 1416 1179.2 0 0 Potri.003G141000.2.v4.1 2943 2706.2 1706.21 31.2757 Potri.016G087400.1.v4.1 270 83.0529 1264 754.967 Potri.015G069301.1.v4.1 564 334.033 0 0 Potri.010G195200.1.v4.1 1773 1536.2 591.928 19.1142 Potri.012G127500.1.v4.1 977 740.249 165 11.0571 ==> SRR7230800.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 413 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 365 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 42 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 23 SRR7230800 completed mapping pipeline successfully