Starting /dee2/code/volunteer_pipeline.sh SRR7230801 current disk space = 3055615827968 free memory = 1579285456 SRR7230801 SRAfilesize 95a9d382bf91db462a5cc074fc1476d6 SRR7230801.sra SRR7230801.sra file validated SRR7230801 is paired end SRR7230801 is conventional basespace SRR7230801 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230801_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.69325 34.0 33.0 34.0 32.0 34.0 2 32.90875 34.0 33.0 34.0 31.0 34.0 3 33.05625 34.0 33.0 34.0 32.0 34.0 4 33.09525 34.0 33.0 34.0 32.0 34.0 5 33.14175 34.0 33.0 34.0 32.0 34.0 6 36.83575 38.0 37.0 38.0 35.0 38.0 7 37.2605 38.0 38.0 38.0 37.0 38.0 8 37.324 38.0 38.0 38.0 37.0 38.0 9 37.39425 38.0 38.0 38.0 37.0 38.0 10-14 37.3925 38.0 38.0 38.0 37.0 38.0 15-19 37.3574 38.0 38.0 38.0 37.0 38.0 20-24 37.2125 38.0 38.0 38.0 36.6 38.0 25-29 37.099050000000005 38.0 38.0 38.0 36.2 38.0 30-34 37.10885 38.0 38.0 38.0 36.4 38.0 35-39 37.190650000000005 38.0 38.0 38.0 36.4 38.0 40-44 37.1382 38.0 38.0 38.0 36.0 38.0 45-49 37.126999999999995 38.0 38.0 38.0 36.0 38.0 50-54 37.048500000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.91795 38.0 38.0 38.0 35.6 38.0 60-64 36.84825 38.0 38.0 38.0 35.4 38.0 65-69 36.848600000000005 38.0 38.0 38.0 35.4 38.0 70-74 36.392 38.0 37.6 38.0 33.2 38.0 75-79 36.66185 38.0 38.0 38.0 34.4 38.0 80-84 36.5871 38.0 38.0 38.0 34.0 38.0 85-89 36.42085 38.0 37.8 38.0 33.8 38.0 90-94 36.22384999999999 38.0 37.6 38.0 33.2 38.0 95-99 35.8685 38.0 36.8 38.0 31.4 38.0 100-104 35.554500000000004 38.0 36.8 38.0 30.4 38.0 105-109 35.0556 38.0 35.8 38.0 26.2 38.0 110-114 35.561749999999996 38.0 36.4 38.0 30.2 38.0 115-119 35.243849999999995 38.0 35.6 38.0 28.6 38.0 120-124 35.23735 38.0 35.8 38.0 28.6 38.0 125-129 34.6024 38.0 34.8 38.0 26.4 38.0 130-134 34.135450000000006 38.0 34.6 38.0 23.0 38.0 135-139 33.42415 38.0 33.8 38.0 18.6 38.0 140-144 32.87795 38.0 32.8 38.0 15.4 38.0 145-149 31.316650000000003 37.4 31.2 38.0 8.6 38.0 150-151 26.515875 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 1.0 15 1.0 16 2.0 17 2.0 18 1.0 19 1.0 20 3.0 21 7.0 22 6.0 23 18.0 24 17.0 25 16.0 26 27.0 27 35.0 28 51.0 29 57.0 30 58.0 31 89.0 32 104.0 33 184.0 34 266.0 35 316.0 36 749.0 37 1986.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.91928721174004 15.382599580712789 8.647798742138365 38.05031446540881 2 20.1 21.55 36.449999999999996 21.9 3 18.025 26.724999999999998 27.750000000000004 27.500000000000004 4 22.075 33.550000000000004 23.025000000000002 21.349999999999998 5 21.925 37.8 22.8 17.474999999999998 6 17.1 36.15 25.25 21.5 7 14.025000000000002 24.25 43.025000000000006 18.7 8 18.025 22.95 31.35 27.675 9 18.099999999999998 21.975 33.375 26.55 10-14 19.685 29.349999999999998 27.034999999999997 23.93 15-19 20.02 28.02 28.110000000000003 23.849999999999998 20-24 20.335 28.765 27.55 23.35 25-29 19.55 28.915000000000003 27.744999999999997 23.79 30-34 20.165 28.605000000000004 27.644999999999996 23.585 35-39 20.080000000000002 28.57 27.92 23.43 40-44 19.650000000000002 28.88 27.529999999999998 23.94 45-49 19.939999999999998 29.17 27.38 23.51 50-54 20.135 28.715000000000003 27.57 23.580000000000002 55-59 20.244999999999997 28.915000000000003 27.334999999999997 23.505000000000003 60-64 20.06 28.485 27.725 23.73 65-69 20.0 28.349999999999998 27.810000000000002 23.84 70-74 20.105 28.665000000000003 27.439999999999998 23.79 75-79 20.05 28.33 27.85 23.77 80-84 20.349157120704316 28.10264619078585 27.457355810114553 24.090840878395277 85-89 20.090180360721444 28.486973947895795 27.750501002004007 23.672344689378757 90-94 20.42881474802124 27.94810139264603 27.59743512674081 24.025648732591925 95-99 20.54 28.09 27.61 23.76 100-104 20.547463586137617 28.071320944249123 28.061275740833754 23.319939728779506 105-109 20.155388471177947 28.616541353383457 27.89473684210526 23.333333333333332 110-114 20.71 28.225 27.305 23.76 115-119 20.785 28.985 26.784999999999997 23.445 120-124 21.29 28.32 26.979999999999997 23.41 125-129 21.095 27.91 27.644999999999996 23.35 130-134 21.345 28.17 26.945000000000004 23.54 135-139 21.01 28.655 26.865 23.47 140-144 21.615000000000002 27.93 26.540000000000003 23.915 145-149 21.275318829707427 28.712178044511127 26.456614153538382 23.55588897224306 150-151 22.4625 27.875 26.1625 23.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 1.0 16 1.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 1.5 23 2.5 24 2.5 25 3.0 26 6.5 27 11.0 28 15.0 29 17.5 30 23.5 31 29.5 32 32.0 33 49.0 34 72.0 35 84.0 36 100.0 37 113.0 38 138.0 39 175.5 40 196.0 41 206.0 42 210.5 43 232.5 44 253.0 45 260.5 46 266.5 47 242.0 48 220.5 49 199.5 50 161.0 51 139.5 52 117.5 53 91.5 54 73.5 55 60.5 56 51.5 57 36.0 58 25.5 59 20.5 60 14.5 61 13.0 62 9.0 63 5.5 64 3.5 65 1.5 66 0.5 67 2.0 68 2.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.045 85-89 0.2 90-94 0.19 95-99 0.0 100-104 0.44999999999999996 105-109 0.25 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.025 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26786165109822 98.3 2 0.5806614491290077 1.15 3 0.10098459984852311 0.3 4 0.025246149962130777 0.1 5 0.0 0.0 6 0.025246149962130777 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.4875 0.0 0.0 0.0 0.0 110-111 1.675 0.0 0.0 0.0 0.0 112-113 1.8875000000000002 0.0 0.0 0.0 0.0 114-115 2.1 0.0 0.0 0.0 0.0 116-117 2.4 0.0 0.0 0.0 0.0 118-119 2.675 0.0 0.0 0.0 0.0 120-121 3.0 0.0 0.0 0.0 0.0 122-123 3.2874999999999996 0.0 0.0 0.0 0.0 124-125 3.5125 0.0 0.0 0.0 0.0 126-127 3.9125 0.0 0.0 0.0 0.0 128-129 4.3125 0.0 0.0 0.0 0.0 130-131 4.7875 0.0 0.0 0.0 0.0 132-133 5.45 0.0 0.0 0.0 0.0 134-135 5.9125 0.0 0.0 0.0 0.0 136-137 6.5 0.0 0.0 0.0 0.0 138-139 7.012499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCATTA 10 0.0068378756 144.95 3 >>END_MODULE SRR7230801 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230801_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85725 33.0 33.0 34.0 32.0 34.0 2 32.9485 34.0 33.0 34.0 32.0 34.0 3 33.0105 34.0 33.0 34.0 32.0 34.0 4 32.85325 34.0 33.0 34.0 32.0 34.0 5 32.865 34.0 33.0 34.0 32.0 34.0 6 37.0245 38.0 38.0 38.0 37.0 38.0 7 37.02175 38.0 38.0 38.0 37.0 38.0 8 37.05725 38.0 38.0 38.0 37.0 38.0 9 37.002 38.0 38.0 38.0 37.0 38.0 10-14 36.60385 38.0 38.0 38.0 34.6 38.0 15-19 36.9253 38.0 38.0 38.0 36.2 38.0 20-24 36.9294 38.0 38.0 38.0 36.0 38.0 25-29 36.859 38.0 38.0 38.0 36.0 38.0 30-34 36.507 38.0 38.0 38.0 34.4 38.0 35-39 36.7491 38.0 38.0 38.0 35.8 38.0 40-44 36.651149999999994 38.0 38.0 38.0 35.4 38.0 45-49 36.566599999999994 38.0 38.0 38.0 35.0 38.0 50-54 36.6717 38.0 38.0 38.0 35.4 38.0 55-59 36.73479999999999 38.0 38.0 38.0 35.8 38.0 60-64 36.68945 38.0 38.0 38.0 35.6 38.0 65-69 36.59895 38.0 38.0 38.0 35.2 38.0 70-74 36.286500000000004 38.0 38.0 38.0 33.8 38.0 75-79 36.3983 38.0 38.0 38.0 34.2 38.0 80-84 36.347449999999995 38.0 38.0 38.0 34.2 38.0 85-89 36.232000000000006 38.0 38.0 38.0 34.0 38.0 90-94 36.0146 38.0 37.8 38.0 33.0 38.0 95-99 36.04285 38.0 37.8 38.0 33.6 38.0 100-104 35.97965000000001 38.0 38.0 38.0 33.2 38.0 105-109 35.525999999999996 38.0 36.8 38.0 29.8 38.0 110-114 35.4884 38.0 37.0 38.0 30.4 38.0 115-119 35.41244999999999 38.0 37.0 38.0 30.0 38.0 120-124 35.296200000000006 38.0 36.6 38.0 30.0 38.0 125-129 34.52980000000001 38.0 35.4 38.0 24.6 38.0 130-134 33.64215 38.0 34.2 38.0 20.4 38.0 135-139 33.183299999999996 38.0 33.8 38.0 19.2 38.0 140-144 32.76649999999999 38.0 33.2 38.0 15.4 38.0 145-149 31.733150000000002 38.0 31.8 38.0 8.6 38.0 150-151 27.93625 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 6.0 4 3.0 5 0.0 6 1.0 7 1.0 8 4.0 9 1.0 10 2.0 11 5.0 12 5.0 13 5.0 14 6.0 15 2.0 16 3.0 17 6.0 18 11.0 19 8.0 20 5.0 21 11.0 22 8.0 23 13.0 24 31.0 25 22.0 26 29.0 27 29.0 28 44.0 29 38.0 30 52.0 31 61.0 32 94.0 33 117.0 34 179.0 35 285.0 36 650.0 37 2258.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.25 19.75 12.5 27.500000000000004 2 25.124999999999996 23.974999999999998 35.199999999999996 15.7 3 19.75 28.799999999999997 31.674999999999997 19.775000000000002 4 23.025000000000002 36.225 22.400000000000002 18.35 5 23.425 37.3 21.375 17.9 6 18.6 38.6 23.775 19.025 7 19.0 17.9 42.05 21.05 8 19.5 23.275000000000002 29.2 28.025 9 22.575 23.674999999999997 28.95 24.8 10-14 23.435 28.555000000000003 26.75 21.26 15-19 23.25 27.255000000000003 27.99 21.505 20-24 23.169999999999998 28.51 27.500000000000004 20.82 25-29 23.07 28.38 27.935 20.615 30-34 22.99 27.985 27.750000000000004 21.275 35-39 23.095 28.035 28.01 20.86 40-44 23.5 27.334999999999997 28.27 20.895 45-49 23.32 28.139999999999997 27.845 20.695 50-54 23.21 28.050000000000004 27.755000000000003 20.985 55-59 23.235 27.43 28.38 20.955 60-64 23.695 28.000000000000004 27.500000000000004 20.805 65-69 23.23 27.560000000000002 27.72 21.490000000000002 70-74 23.965 27.175 27.99 20.87 75-79 23.885 28.1 27.315 20.7 80-84 22.965 28.04 27.575 21.42 85-89 23.665 27.925 27.339999999999996 21.07 90-94 23.015 27.72 27.474999999999998 21.790000000000003 95-99 23.365 27.58 28.07 20.985 100-104 23.02 28.194999999999997 27.79 20.995 105-109 23.815 28.249999999999996 27.415 20.52 110-114 23.94 27.99 27.46 20.61 115-119 23.89 27.810000000000002 27.87 20.43 120-124 23.68 27.74 27.505000000000003 21.075 125-129 24.255 28.29 27.310000000000002 20.145 130-134 24.395 27.77 27.365000000000002 20.47 135-139 24.805 27.529999999999998 27.66 20.005 140-144 24.665 27.965 26.810000000000002 20.560000000000002 145-149 25.295 27.88 26.810000000000002 20.015 150-151 25.474999999999998 28.212500000000002 26.775 19.537499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.5 23 3.5 24 3.5 25 3.0 26 2.5 27 5.5 28 9.0 29 12.5 30 16.0 31 16.5 32 25.0 33 40.0 34 53.0 35 68.0 36 83.5 37 112.0 38 136.0 39 149.0 40 177.0 41 211.5 42 234.0 43 247.0 44 255.5 45 268.0 46 270.0 47 261.5 48 237.5 49 199.0 50 179.5 51 150.0 52 123.0 53 104.0 54 81.5 55 69.5 56 55.5 57 33.0 58 23.0 59 25.5 60 18.5 61 9.0 62 5.5 63 5.5 64 4.5 65 2.5 66 1.0 67 0.5 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29328621908127 98.35000000000001 2 0.5300353356890459 1.05 3 0.12619888944977284 0.375 4 0.025239777889954566 0.1 5 0.025239777889954566 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.2875 0.0 0.0 0.0 0.0 108-109 1.5125 0.0 0.0 0.0 0.0 110-111 1.7 0.0 0.0 0.0 0.0 112-113 1.9125 0.0 0.0 0.0 0.0 114-115 2.125 0.0 0.0 0.0 0.0 116-117 2.425 0.0 0.0 0.0 0.0 118-119 2.7625 0.0 0.0 0.0 0.0 120-121 3.125 0.0 0.0 0.0 0.0 122-123 3.4124999999999996 0.0 0.0 0.0 0.0 124-125 3.6500000000000004 0.0 0.0 0.0 0.0 126-127 4.0375 0.0 0.0 0.0 0.0 128-129 4.475 0.0 0.0 0.0 0.0 130-131 4.9625 0.0 0.0 0.0 0.0 132-133 5.6125 0.0 0.0 0.0 0.0 134-135 6.15 0.0 0.0 0.0 0.0 136-137 6.725 0.0 0.0 0.0 0.0 138-139 7.237500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACCCC 10 0.006830828 145.0 2 TACAAAA 10 0.006830828 145.0 7 >>END_MODULE Read 856253 spots for SRR7230801.sra Written 856253 spots for SRR7230801.sra Read 856253 spots for SRR7230801.sra Written 856253 spots for SRR7230801.sra Read 856253 spots for SRR7230801.sra Written 856253 spots for SRR7230801.sra Read 856253 spots for SRR7230801.sra Written 856253 spots for SRR7230801.sra Read 856253 spots for SRR7230801.sra Written 856253 spots for SRR7230801.sra Read 856253 spots for SRR7230801.sra Written 856253 spots for SRR7230801.sra Read 856253 spots for SRR7230801.sra Written 856253 spots for SRR7230801.sra Read 856253 spots for SRR7230801.sra Written 856253 spots for SRR7230801.sra Read 856253 spots for SRR7230801.sra Written 856253 spots for SRR7230801.sra Read 856253 spots for SRR7230801.sra Written 856253 spots for SRR7230801.sra Read 856257 spots for SRR7230801.sra Written 856257 spots for SRR7230801.sra Read 856253 spots for SRR7230801.sra Written 856253 spots for SRR7230801.sra Read 856253 spots for SRR7230801.sra Written 856253 spots for SRR7230801.sra Read 856253 spots for SRR7230801.sra Written 856253 spots for SRR7230801.sra Read 856253 spots for SRR7230801.sra Written 856253 spots for SRR7230801.sra Read 856253 spots for SRR7230801.sra Written 856253 spots for SRR7230801.sra Read 856253 spots for SRR7230801.sra Written 856253 spots for SRR7230801.sra Read 856253 spots for SRR7230801.sra Written 856253 spots for SRR7230801.sra Read 856253 spots for SRR7230801.sra Written 856253 spots for SRR7230801.sra Read 856253 spots for SRR7230801.sra Written 856253 spots for SRR7230801.sra SRR ids: ['SRR7230801.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8xyi7pvj SRR7230801.sra spots: 17125064 blocks: [[1, 856253], [856254, 1712506], [1712507, 2568759], [2568760, 3425012], [3425013, 4281265], [4281266, 5137518], [5137519, 5993771], [5993772, 6850024], [6850025, 7706277], [7706278, 8562530], [8562531, 9418783], [9418784, 10275036], [10275037, 11131289], [11131290, 11987542], [11987543, 12843795], [12843796, 13700048], [13700049, 14556301], [14556302, 15412554], [15412555, 16268807], [16268808, 17125064]] SRR7230801 file size 5781421 SRR7230801 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230801 SRR7230801_1.fastq SRR7230801_2.fastq Input file: SRR7230801_1.fastq Paired file: SRR7230801_2.fastq trimmed: SRR7230801-trimmed-pair1.fastq, SRR7230801-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:58:33 2025 >> started Tue Feb 11 08:59:00 2025 >> done (26.576s) 17125064 read pairs processed; of these: 19052 ( 0.11%) short read pairs filtered out after trimming by size control 15793 ( 0.09%) empty read pairs filtered out after trimming by size control 17090219 (99.80%) read pairs available; of these: 9513961 (55.67%) trimmed read pairs available after processing 7576258 (44.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 4 0.00% 21 0 0.00% 22 10 0.00% 23 2 0.00% 24 7 0.00% 25 6 0.00% 26 7 0.00% 27 21 0.00% 28 12 0.00% 29 11 0.00% 30 17 0.00% 31 15 0.00% 32 12 0.00% 33 15 0.00% 34 17 0.00% 35 22 0.00% 36 19 0.00% 37 22 0.00% 38 27 0.00% 39 16 0.00% 40 22 0.00% 41 31 0.00% 42 25 0.00% 43 25 0.00% 44 49 0.00% 45 38 0.00% 46 54 0.00% 47 58 0.00% 48 83 0.00% 49 92 0.00% 50 96 0.00% 51 110 0.00% 52 131 0.00% 53 139 0.00% 54 147 0.00% 55 150 0.00% 56 173 0.00% 57 186 0.00% 58 219 0.00% 59 267 0.00% 60 326 0.00% 61 348 0.00% 62 398 0.00% 63 426 0.00% 64 493 0.00% 65 512 0.00% 66 585 0.00% 67 647 0.00% 68 752 0.00% 69 985 0.01% 70 1185 0.01% 71 1178 0.01% 72 1200 0.01% 73 1495 0.01% 74 1669 0.01% 75 1770 0.01% 76 1969 0.01% 77 2144 0.01% 78 2469 0.01% 79 2789 0.02% 80 3128 0.02% 81 3521 0.02% 82 3963 0.02% 83 4375 0.03% 84 5679 0.03% 85 6569 0.04% 86 7076 0.04% 87 7591 0.04% 88 8066 0.05% 89 8721 0.05% 90 9372 0.05% 91 10158 0.06% 92 10688 0.06% 93 11637 0.07% 94 12447 0.07% 95 13232 0.08% 96 13949 0.08% 97 14828 0.09% 98 15805 0.09% 99 16413 0.10% 100 17661 0.10% 101 18285 0.11% 102 19333 0.11% 103 20818 0.12% 104 21919 0.13% 105 23262 0.14% 106 24400 0.14% 107 25488 0.15% 108 26668 0.16% 109 27842 0.16% 110 29290 0.17% 111 30696 0.18% 112 32282 0.19% 113 33553 0.20% 114 35115 0.21% 115 36594 0.21% 116 37858 0.22% 117 39515 0.23% 118 41363 0.24% 119 42642 0.25% 120 44234 0.26% 121 46177 0.27% 122 48254 0.28% 123 50443 0.30% 124 52376 0.31% 125 54068 0.32% 126 56627 0.33% 127 59044 0.35% 128 61876 0.36% 129 64935 0.38% 130 67655 0.40% 131 70395 0.41% 132 74127 0.43% 133 78468 0.46% 134 81724 0.48% 135 87340 0.51% 136 91411 0.53% 137 98092 0.57% 138 103902 0.61% 139 111480 0.65% 140 120839 0.71% 141 130881 0.77% 142 145646 0.85% 143 162903 0.95% 144 189208 1.11% 145 221196 1.29% 146 275335 1.61% 147 363692 2.13% 148 537202 3.14% 149 1021051 5.97% 150 4145874 24.26% 151 7576258 44.33% 17090219 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=13 prefix-density=0.53 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=38.28 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=11.7 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=19 prefix-density=0.56 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=95.28 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.2 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCA SRR7230801 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:59:46 Started mapping on | Feb 11 08:59:46 Finished on | Feb 11 09:01:54 Mapping speed, Million of reads per hour | 480.66 Number of input reads | 17090219 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 15712112 Uniquely mapped reads % | 91.94% Average mapped length | 291.71 Number of splices: Total | 14486538 Number of splices: Annotated (sjdb) | 14144257 Number of splices: GT/AG | 14201391 Number of splices: GC/AG | 231341 Number of splices: AT/AC | 9126 Number of splices: Non-canonical | 44680 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 532643 % of reads mapped to multiple loci | 3.12% Number of reads mapped to too many loci | 189627 % of reads mapped to too many loci | 1.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.61% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 866917 866917 866917 N_multimapping 532643 532643 532643 N_noFeature 707460 15390491 835765 N_ambiguous 314039 1186 119941 UnstrandedReadsAssigned:14690613 PositiveStrandReadsAssigned:320435 NegativeStrandReadsAssigned:14756406 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7230801 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230801-trimmed-pair1.fastq SRR7230801-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,090,219 reads, 14,913,065 reads pseudoaligned [quant] estimated average fragment length: 235.66 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52401 SRR7230801.ke.tsv 34699 SRR7230801.se.tsv 87100 total ==> SRR7230801.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.34 596 19.2141 Potri.005G024800.1.v4.1 1035 800.34 221 15.8754 Potri.004G059700.1.v4.1 961 726.404 21 1.66207 Potri.007G009000.2.v4.1 1416 1181.34 0 0 Potri.003G141000.2.v4.1 2943 2708.34 699.354 14.8457 Potri.016G087400.1.v4.1 270 84.7479 803 544.747 Potri.015G069301.1.v4.1 564 334.811 0 0 Potri.010G195200.1.v4.1 1773 1538.34 25 0.93432 Potri.012G127500.1.v4.1 977 742.367 113 8.75121 ==> SRR7230801.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1649 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 330 Potri.001G212900.v4.1 294 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 20 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7230801 completed mapping pipeline successfully