Starting /dee2/code/volunteer_pipeline.sh SRR7230802 current disk space = 3055778086912 free memory = 1519497692 SRR7230802 SRAfilesize 9d48b93486d547b168b96bc5da67cd83 SRR7230802.sra SRR7230802.sra file validated SRR7230802 is paired end SRR7230802 is conventional basespace SRR7230802 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230802_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.38375 34.0 33.0 34.0 33.0 34.0 2 33.42275 34.0 33.0 34.0 33.0 34.0 3 33.447 34.0 34.0 34.0 33.0 34.0 4 33.43275 34.0 34.0 34.0 33.0 34.0 5 33.366 34.0 34.0 34.0 33.0 34.0 6 37.28125 38.0 38.0 38.0 36.0 38.0 7 37.5 38.0 38.0 38.0 37.0 38.0 8 37.43 38.0 38.0 38.0 37.0 38.0 9 37.48475 38.0 38.0 38.0 38.0 38.0 10-14 37.49645 38.0 38.0 38.0 38.0 38.0 15-19 37.387 38.0 38.0 38.0 37.4 38.0 20-24 37.569599999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.451350000000005 38.0 38.0 38.0 37.4 38.0 30-34 37.356100000000005 38.0 38.0 38.0 37.2 38.0 35-39 37.31570000000001 38.0 38.0 38.0 37.0 38.0 40-44 36.872400000000006 38.0 38.0 38.0 35.6 38.0 45-49 37.163650000000004 38.0 38.0 38.0 36.6 38.0 50-54 37.24005 38.0 38.0 38.0 37.0 38.0 55-59 37.20345 38.0 38.0 38.0 36.6 38.0 60-64 37.13099999999999 38.0 38.0 38.0 36.0 38.0 65-69 37.1311 38.0 38.0 38.0 36.0 38.0 70-74 32.018100000000004 38.0 26.8 38.0 15.4 38.0 75-79 32.9147 38.0 35.2 38.0 9.6 38.0 80-84 35.34445 38.0 37.6 38.0 29.8 38.0 85-89 36.2675 38.0 38.0 38.0 33.8 38.0 90-94 36.53805 38.0 38.0 38.0 34.2 38.0 95-99 36.648849999999996 38.0 38.0 38.0 34.8 38.0 100-104 36.518150000000006 38.0 38.0 38.0 34.4 38.0 105-109 35.8899 38.0 37.2 38.0 30.2 38.0 110-114 36.08035 38.0 37.0 38.0 33.0 38.0 115-119 35.93055 38.0 37.2 38.0 32.4 38.0 120-124 35.767849999999996 38.0 37.0 38.0 31.4 38.0 125-129 35.10465 38.0 35.6 38.0 27.4 38.0 130-134 35.36365 38.0 36.0 38.0 31.0 38.0 135-139 35.204449999999994 38.0 36.0 38.0 30.2 38.0 140-144 34.89335 38.0 35.6 38.0 28.2 38.0 145-149 34.18475 38.0 34.2 38.0 26.2 38.0 150-151 30.65175 35.5 29.0 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 2.0 15 2.0 16 0.0 17 3.0 18 2.0 19 1.0 20 0.0 21 7.0 22 2.0 23 10.0 24 15.0 25 11.0 26 19.0 27 22.0 28 35.0 29 39.0 30 52.0 31 63.0 32 91.0 33 155.0 34 266.0 35 401.0 36 724.0 37 2074.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.43385846461615 14.95373843460865 12.028007001750437 37.58439609902476 2 21.349999999999998 20.474999999999998 34.425 23.75 3 20.775 25.8 26.025 27.400000000000002 4 22.85 32.475 22.475 22.2 5 21.575 37.125 22.15 19.15 6 17.525 36.425000000000004 25.8 20.25 7 13.450000000000001 23.375 45.35 17.825 8 16.3 24.85 30.775000000000002 28.075 9 17.875 23.925 33.275 24.925 10-14 20.075000000000003 30.470000000000002 26.695 22.759999999999998 15-19 19.6 29.060000000000002 27.85 23.49 20-24 19.845 28.860000000000003 27.794999999999998 23.5 25-29 19.67 29.665000000000003 27.544999999999998 23.119999999999997 30-34 19.66 29.755 27.54 23.044999999999998 35-39 19.52695269526953 29.21792179217922 27.49274927492749 23.762376237623762 40-44 19.996998198919353 29.007404442665603 27.326395837502503 23.669201520912548 45-49 19.900000000000002 28.99 27.625 23.485 50-54 19.625 28.994999999999997 27.77 23.61 55-59 19.895 28.925 27.644999999999996 23.535 60-64 19.942991448717308 29.014352152822926 27.36410461569235 23.678551782767414 65-69 20.330000000000002 29.025000000000002 27.295 23.35 70-74 20.126655152561888 28.69314910765688 27.501439263097293 23.678756476683937 75-79 20.2547065337763 29.14174972314507 27.707641196013288 22.89590254706534 80-84 20.563511830635118 28.372768783727686 28.009547530095475 23.054171855541718 85-89 20.516832382778983 28.864886690556705 27.249785494372382 23.36849543229193 90-94 20.506912442396313 28.250851532758965 27.274093368062513 23.968142656782206 95-99 20.69362426183565 28.050245220698628 27.5397858072265 23.716344710239216 100-104 20.571886423957135 28.729530772697682 27.3523962141319 23.346186589213282 105-109 20.70535267633817 28.634317158579293 27.478739369684842 23.1815907953977 110-114 20.456022801140055 28.351417570878546 27.886394319715986 23.306165308265413 115-119 21.320839805582 28.52633161296788 27.223530590770157 22.929297990679963 120-124 20.301996588742853 28.70472559446172 27.520818701715662 23.472459115079765 125-129 21.029999999999998 28.275 26.555 24.14 130-134 20.53 28.17 27.465 23.835 135-139 20.669999999999998 28.57 26.775 23.985 140-144 20.515 29.095 26.779999999999998 23.61 145-149 20.97993093438767 28.587157799909914 26.710374856113305 23.72253640958911 150-151 20.8125 28.237499999999997 26.487500000000004 24.462500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.5 19 0.5 20 2.0 21 4.0 22 3.0 23 4.0 24 6.0 25 5.5 26 5.0 27 11.0 28 15.5 29 19.5 30 30.5 31 39.5 32 51.5 33 60.5 34 74.5 35 105.0 36 124.5 37 145.0 38 167.0 39 181.5 40 203.0 41 225.0 42 233.5 43 225.0 44 235.0 45 260.5 46 261.0 47 222.0 48 193.0 49 185.5 50 150.5 51 116.0 52 98.5 53 79.5 54 62.0 55 46.5 56 35.5 57 32.0 58 25.5 59 14.5 60 10.0 61 8.0 62 4.5 63 2.5 64 3.5 65 3.5 66 2.0 67 1.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.06 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.015 65-69 0.0 70-74 13.15 75-79 9.700000000000001 80-84 3.64 85-89 0.935 90-94 0.18 95-99 0.09 100-104 0.155 105-109 0.05 110-114 0.005 115-119 0.215 120-124 0.33 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.095 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7124999999999999 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.3875 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.2125 0.0 0.0 0.0 0.0 116-117 2.5375 0.0 0.0 0.0 0.0 118-119 2.8625 0.0 0.0 0.0 0.0 120-121 3.25 0.0 0.0 0.0 0.0 122-123 3.4875 0.0 0.0 0.0 0.0 124-125 3.9000000000000004 0.0 0.0 0.0 0.0 126-127 4.275 0.0 0.0 0.0 0.0 128-129 4.725 0.0 0.0 0.0 0.0 130-131 5.05 0.0 0.0 0.0 0.0 132-133 5.675 0.0 0.0 0.0 0.0 134-135 6.0875 0.0 0.0 0.0 0.0 136-137 6.475 0.0 0.0 0.0 0.0 138-139 7.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGTAGA 10 0.0073233666 141.6625 6 GAAGTAG 10 0.0073233666 141.6625 5 GCAGAAT 10 0.0073233666 141.6625 3 CAAAGGA 10 0.0073233666 141.6625 1 CAGAATA 10 0.0073233666 141.6625 4 >>END_MODULE SRR7230802 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230802_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.60775 33.0 33.0 34.0 32.0 34.0 2 32.98725 34.0 33.0 34.0 32.0 34.0 3 33.05825 34.0 33.0 34.0 32.0 34.0 4 33.08775 34.0 33.0 34.0 32.0 34.0 5 33.0835 34.0 33.0 34.0 33.0 34.0 6 37.22225 38.0 38.0 38.0 37.0 38.0 7 37.20025 38.0 38.0 38.0 37.0 38.0 8 37.155 38.0 38.0 38.0 37.0 38.0 9 37.06575 38.0 38.0 38.0 37.0 38.0 10-14 36.9369 38.0 38.0 38.0 36.0 38.0 15-19 37.17274999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.11495000000001 38.0 38.0 38.0 37.0 38.0 25-29 37.058049999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.0316 38.0 38.0 38.0 37.0 38.0 35-39 36.8177 38.0 38.0 38.0 36.2 38.0 40-44 36.5812 38.0 38.0 38.0 35.0 38.0 45-49 36.7998 38.0 38.0 38.0 36.0 38.0 50-54 36.78855 38.0 38.0 38.0 36.2 38.0 55-59 36.7965 38.0 38.0 38.0 35.8 38.0 60-64 36.89255000000001 38.0 38.0 38.0 36.2 38.0 65-69 36.8249 38.0 38.0 38.0 36.2 38.0 70-74 36.78545 38.0 38.0 38.0 35.8 38.0 75-79 36.71125 38.0 38.0 38.0 36.0 38.0 80-84 36.6577 38.0 38.0 38.0 35.4 38.0 85-89 36.61255 38.0 38.0 38.0 35.4 38.0 90-94 36.5498 38.0 38.0 38.0 35.2 38.0 95-99 36.3618 38.0 38.0 38.0 34.4 38.0 100-104 35.7521 38.0 37.4 38.0 31.8 38.0 105-109 35.94924999999999 38.0 38.0 38.0 33.4 38.0 110-114 36.03725 38.0 38.0 38.0 34.0 38.0 115-119 36.05669999999999 38.0 38.0 38.0 34.0 38.0 120-124 35.63535 38.0 37.6 38.0 32.0 38.0 125-129 35.26375 38.0 36.6 38.0 30.2 38.0 130-134 35.2082 38.0 36.2 38.0 30.2 38.0 135-139 34.8517 38.0 36.0 38.0 27.8 38.0 140-144 34.4095 38.0 35.2 38.0 26.6 38.0 145-149 34.015600000000006 38.0 35.2 38.0 25.4 38.0 150-151 29.330999999999996 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 7.0 5 4.0 6 2.0 7 1.0 8 1.0 9 0.0 10 4.0 11 1.0 12 4.0 13 2.0 14 3.0 15 5.0 16 4.0 17 4.0 18 8.0 19 2.0 20 10.0 21 11.0 22 11.0 23 6.0 24 16.0 25 12.0 26 25.0 27 14.0 28 33.0 29 30.0 30 34.0 31 41.0 32 76.0 33 105.0 34 133.0 35 222.0 36 470.0 37 2695.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.86039453717754 18.942842690945877 15.933232169954476 27.263530601922103 2 25.95 24.75 32.9 16.400000000000002 3 22.525000000000002 28.575 28.675 20.225 4 25.025 35.5 21.375 18.099999999999998 5 24.925 37.375 21.325 16.375 6 19.45 37.0 24.675 18.875 7 18.275 18.15 42.15 21.425 8 21.475 23.400000000000002 28.875 26.25 9 22.725 24.349999999999998 29.625 23.3 10-14 23.505577509879448 27.98759441748787 26.792056425391426 21.714771647241257 15-19 23.815 27.575 27.755000000000003 20.855 20-24 23.23313159605862 28.40494172960536 27.90976841894663 20.452158255389385 25-29 23.111155557777888 27.996399819990998 27.75638781939097 21.13605680284014 30-34 23.308157855249338 27.73970889811434 27.78972640424148 21.162406842394837 35-39 23.23848577286593 27.074061109166376 28.3842576386458 21.3031954793219 40-44 23.45821037363077 27.81973690791777 27.78972640424148 20.932326314209973 45-49 23.424595825616898 27.333700385404676 28.01441513589269 21.22728865308574 50-54 23.18122685880116 27.734414089862902 28.214750325227662 20.869608726108275 55-59 23.382735830162225 28.1393951532145 27.628680152213096 20.849188864410173 60-64 23.28582145536384 27.66191547886972 28.13703425856464 20.9152288072018 65-69 23.36687190268809 27.571707463583124 27.531661410622217 21.529759223106574 70-74 23.198919351610968 28.121873123874323 27.691614968981387 20.98759255553332 75-79 23.45641949364555 27.684379065345745 28.54498148704093 20.314219953967775 80-84 23.453208623018057 27.834742159755915 28.069824438553493 20.642224778672535 85-89 24.104104104104103 28.048048048048045 27.627627627627625 20.22022022022022 90-94 23.676573601521063 27.619333533473434 28.01461022715901 20.689482637846492 95-99 23.55853378006701 27.879181877281596 28.16922538380757 20.393058958843827 100-104 23.968595289293393 27.889183377506626 27.62414362154323 20.518077711656748 105-109 23.968595289293393 27.544131619742963 27.89918487773166 20.588088213231984 110-114 24.285 27.700000000000003 27.925 20.09 115-119 24.13 27.29 28.305000000000003 20.275000000000002 120-124 23.598539780967144 28.064209631444715 28.114217132569884 20.223033455018253 125-129 25.058782330281655 27.38005903246786 27.945369953474408 19.615788683776078 130-134 24.52 27.700000000000003 27.74 20.04 135-139 24.743711556733512 27.374106115917385 27.849177376606495 20.033004950742612 140-144 24.887421194836385 28.02962073451416 27.509256479535676 19.573701591113778 145-149 24.847484748474848 27.762776277627765 27.632763276327633 19.756975697569757 150-151 25.9625 27.537499999999998 26.8 19.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.5 22 0.5 23 1.0 24 1.5 25 1.0 26 3.5 27 7.5 28 9.5 29 12.0 30 17.0 31 24.0 32 36.5 33 51.0 34 54.0 35 64.0 36 85.0 37 90.5 38 113.5 39 150.5 40 183.0 41 207.5 42 238.0 43 269.0 44 271.5 45 272.5 46 261.0 47 248.0 48 234.0 49 208.0 50 181.5 51 150.5 52 114.5 53 92.0 54 87.0 55 75.5 56 49.5 57 28.5 58 25.0 59 22.5 60 14.0 61 11.0 62 12.0 63 7.5 64 4.0 65 2.0 66 1.0 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.045 15-19 0.0 20-24 0.034999999999999996 25-29 0.005 30-34 0.034999999999999996 35-39 0.015 40-44 0.034999999999999996 45-49 0.105 50-54 0.06999999999999999 55-59 0.13999999999999999 60-64 0.025 65-69 0.11499999999999999 70-74 0.06 75-79 0.06999999999999999 80-84 0.034999999999999996 85-89 0.1 90-94 0.06999999999999999 95-99 0.015 100-104 0.015 105-109 0.015 110-114 0.0 115-119 0.0 120-124 0.015 125-129 0.055 130-134 0.0 135-139 0.015 140-144 0.06999999999999999 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.8375 0.0 0.0 0.0 0.0 110-111 1.9249999999999998 0.0 0.0 0.0 0.0 112-113 2.1125 0.0 0.0 0.0 0.0 114-115 2.2875 0.0 0.0 0.0 0.0 116-117 2.5999999999999996 0.0 0.0 0.0 0.0 118-119 2.8875 0.0 0.0 0.0 0.0 120-121 3.2750000000000004 0.0 0.0 0.0 0.0 122-123 3.5875000000000004 0.0 0.0 0.0 0.0 124-125 4.05 0.0 0.0 0.0 0.0 126-127 4.375 0.0 0.0 0.0 0.0 128-129 4.737500000000001 0.0 0.0 0.0 0.0 130-131 5.0 0.0 0.0 0.0 0.0 132-133 5.5625 0.0 0.0 0.0 0.0 134-135 6.0125 0.0 0.0 0.0 0.0 136-137 6.4125 0.0 0.0 0.0 0.0 138-139 6.949999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGGCA 10 0.006843168 144.91249 9 TGATTAT 10 0.006843168 144.91249 3 GTAACAG 10 0.006843168 144.91249 9 GGTAACA 10 0.006843168 144.91249 8 >>END_MODULE Read 694063 spots for SRR7230802.sra Written 694063 spots for SRR7230802.sra Read 694063 spots for SRR7230802.sra Written 694063 spots for SRR7230802.sra Read 694063 spots for SRR7230802.sra Written 694063 spots for SRR7230802.sra Read 694063 spots for SRR7230802.sra Written 694063 spots for SRR7230802.sra Read 694063 spots for SRR7230802.sra Written 694063 spots for SRR7230802.sra Read 694063 spots for SRR7230802.sra Written 694063 spots for SRR7230802.sra Read 694063 spots for SRR7230802.sra Written 694063 spots for SRR7230802.sra Read 694063 spots for SRR7230802.sra Written 694063 spots for SRR7230802.sra Read 694063 spots for SRR7230802.sra Written 694063 spots for SRR7230802.sra Read 694063 spots for SRR7230802.sra Written 694063 spots for SRR7230802.sra Read 694063 spots for SRR7230802.sra Written 694063 spots for SRR7230802.sra Read 694063 spots for SRR7230802.sra Written 694063 spots for SRR7230802.sra Read 694063 spots for SRR7230802.sra Written 694063 spots for SRR7230802.sra Read 694063 spots for SRR7230802.sra Written 694063 spots for SRR7230802.sra Read 694063 spots for SRR7230802.sra Written 694063 spots for SRR7230802.sra Read 694063 spots for SRR7230802.sra Written 694063 spots for SRR7230802.sra Read 694072 spots for SRR7230802.sra Written 694072 spots for SRR7230802.sra Read 694063 spots for SRR7230802.sra Written 694063 spots for SRR7230802.sra Read 694063 spots for SRR7230802.sra Written 694063 spots for SRR7230802.sra Read 694063 spots for SRR7230802.sra Written 694063 spots for SRR7230802.sra SRR ids: ['SRR7230802.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bfca_w8g SRR7230802.sra spots: 13881269 blocks: [[1, 694063], [694064, 1388126], [1388127, 2082189], [2082190, 2776252], [2776253, 3470315], [3470316, 4164378], [4164379, 4858441], [4858442, 5552504], [5552505, 6246567], [6246568, 6940630], [6940631, 7634693], [7634694, 8328756], [8328757, 9022819], [9022820, 9716882], [9716883, 10410945], [10410946, 11105008], [11105009, 11799071], [11799072, 12493134], [12493135, 13187197], [13187198, 13881269]] SRR7230802 file size 4682206 SRR7230802 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230802 SRR7230802_1.fastq SRR7230802_2.fastq Input file: SRR7230802_1.fastq Paired file: SRR7230802_2.fastq trimmed: SRR7230802-trimmed-pair1.fastq, SRR7230802-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:44:38 2025 >> started Tue Feb 11 08:44:52 2025 >> done (14.882s) 13881269 read pairs processed; of these: 15432 ( 0.11%) short read pairs filtered out after trimming by size control 15579 ( 0.11%) empty read pairs filtered out after trimming by size control 13850258 (99.78%) read pairs available; of these: 6479099 (46.78%) trimmed read pairs available after processing 7371159 (53.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 6 0.00% 21 2 0.00% 22 3 0.00% 23 4 0.00% 24 1 0.00% 25 7 0.00% 26 2 0.00% 27 8 0.00% 28 16 0.00% 29 6 0.00% 30 4 0.00% 31 11 0.00% 32 2 0.00% 33 10 0.00% 34 10 0.00% 35 61 0.00% 36 39 0.00% 37 16 0.00% 38 21 0.00% 39 35 0.00% 40 11 0.00% 41 27 0.00% 42 26 0.00% 43 22 0.00% 44 29 0.00% 45 24 0.00% 46 51 0.00% 47 47 0.00% 48 55 0.00% 49 59 0.00% 50 61 0.00% 51 55 0.00% 52 93 0.00% 53 80 0.00% 54 102 0.00% 55 104 0.00% 56 118 0.00% 57 125 0.00% 58 131 0.00% 59 157 0.00% 60 210 0.00% 61 242 0.00% 62 236 0.00% 63 266 0.00% 64 325 0.00% 65 345 0.00% 66 410 0.00% 67 454 0.00% 68 515 0.00% 69 1061 0.01% 70 1139 0.01% 71 819 0.01% 72 877 0.01% 73 910 0.01% 74 1063 0.01% 75 1157 0.01% 76 1372 0.01% 77 1379 0.01% 78 1613 0.01% 79 1748 0.01% 80 2124 0.02% 81 2275 0.02% 82 2780 0.02% 83 3015 0.02% 84 4013 0.03% 85 4892 0.04% 86 5134 0.04% 87 5460 0.04% 88 6100 0.04% 89 6176 0.04% 90 6757 0.05% 91 7340 0.05% 92 7616 0.05% 93 8400 0.06% 94 9049 0.07% 95 9821 0.07% 96 10347 0.07% 97 11135 0.08% 98 11602 0.08% 99 12622 0.09% 100 13397 0.10% 101 13870 0.10% 102 15030 0.11% 103 15960 0.12% 104 16702 0.12% 105 17901 0.13% 106 18872 0.14% 107 19671 0.14% 108 20576 0.15% 109 21637 0.16% 110 22580 0.16% 111 23841 0.17% 112 24437 0.18% 113 25662 0.19% 114 26521 0.19% 115 28099 0.20% 116 29234 0.21% 117 30023 0.22% 118 31312 0.23% 119 32203 0.23% 120 33474 0.24% 121 34590 0.25% 122 35782 0.26% 123 37440 0.27% 124 39199 0.28% 125 40279 0.29% 126 42160 0.30% 127 43417 0.31% 128 44946 0.32% 129 46693 0.34% 130 48066 0.35% 131 49508 0.36% 132 51836 0.37% 133 54303 0.39% 134 56742 0.41% 135 59962 0.43% 136 62543 0.45% 137 66026 0.48% 138 68827 0.50% 139 72660 0.52% 140 75504 0.55% 141 81705 0.59% 142 87358 0.63% 143 97035 0.70% 144 110665 0.80% 145 128376 0.93% 146 160661 1.16% 147 201623 1.46% 148 313173 2.26% 149 584090 4.22% 150 3048484 22.01% 151 7371159 53.22% 13850258 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=19 prefix-density=0.55 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.19 sequence-density-rank=15 fanout-score=19.44 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=8.3 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTCAGCGAATGC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=25 prefix-density=0.44 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=62.43 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=7.9 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAAGTCTGGTCACTCCATGTTTGTCTAATATAGTATTTGCTGTAAATTAAAGTACAGTTAGCTAGCCATGGCCTCCTCAAATCCTTTCTACAGGATCTCATTTGATGGCTAGTAATCTGTAAGTGTCTTGTATTTCCT SRR7230802 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:45:36 Started mapping on | Feb 11 08:45:37 Finished on | Feb 11 08:47:23 Mapping speed, Million of reads per hour | 470.39 Number of input reads | 13850258 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12817518 Uniquely mapped reads % | 92.54% Average mapped length | 292.92 Number of splices: Total | 11178758 Number of splices: Annotated (sjdb) | 10881350 Number of splices: GT/AG | 10947890 Number of splices: GC/AG | 188614 Number of splices: AT/AC | 7619 Number of splices: Non-canonical | 34635 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.03% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 358044 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 42075 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.46% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 692229 692229 692229 N_multimapping 358044 358044 358044 N_noFeature 550706 12592843 640899 N_ambiguous 226840 1230 91520 UnstrandedReadsAssigned:12039972 PositiveStrandReadsAssigned:223445 NegativeStrandReadsAssigned:12085099 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7230802 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230802-trimmed-pair1.fastq SRR7230802-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,850,258 reads, 12,131,377 reads pseudoaligned [quant] estimated average fragment length: 234.055 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52401 SRR7230802.ke.tsv 34699 SRR7230802.se.tsv 87100 total ==> SRR7230802.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.95 390 17.1087 Potri.005G024800.1.v4.1 1035 801.945 94 9.17828 Potri.004G059700.1.v4.1 961 727.985 6 0.645367 Potri.007G009000.2.v4.1 1416 1182.95 2 0.132386 Potri.003G141000.2.v4.1 2943 2709.95 589.318 17.0281 Potri.016G087400.1.v4.1 270 85.236 620 569.569 Potri.015G069301.1.v4.1 564 335.961 0 0 Potri.010G195200.1.v4.1 1773 1539.95 12 0.610174 Potri.012G127500.1.v4.1 977 743.957 471 49.5737 ==> SRR7230802.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 492 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 304 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 47 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7230802 completed mapping pipeline successfully