Starting /dee2/code/volunteer_pipeline.sh SRR7230803 current disk space = 3055688192000 free memory = 1486152248 SRR7230803 SRAfilesize ce609a146e15e2f1f5294579e57ca9d8 SRR7230803.sra SRR7230803.sra file validated SRR7230803 is paired end SRR7230803 is conventional basespace SRR7230803 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230803_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.356 34.0 33.0 34.0 33.0 34.0 2 33.34975 34.0 33.0 34.0 33.0 34.0 3 33.45875 34.0 33.0 34.0 33.0 34.0 4 33.391 34.0 34.0 34.0 33.0 34.0 5 33.444 34.0 34.0 34.0 33.0 34.0 6 37.1785 38.0 38.0 38.0 36.0 38.0 7 37.491 38.0 38.0 38.0 37.0 38.0 8 37.553 38.0 38.0 38.0 38.0 38.0 9 37.51675 38.0 38.0 38.0 38.0 38.0 10-14 37.567750000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.48355 38.0 38.0 38.0 37.6 38.0 20-24 37.29645 38.0 38.0 38.0 36.8 38.0 25-29 37.37415 38.0 38.0 38.0 37.6 38.0 30-34 37.493900000000004 38.0 38.0 38.0 37.8 38.0 35-39 37.344849999999994 38.0 38.0 38.0 37.2 38.0 40-44 36.765249999999995 38.0 38.0 38.0 35.0 38.0 45-49 37.06945 38.0 38.0 38.0 36.0 38.0 50-54 37.268 38.0 38.0 38.0 37.0 38.0 55-59 37.16974999999999 38.0 38.0 38.0 36.2 38.0 60-64 37.1743 38.0 38.0 38.0 36.4 38.0 65-69 37.13435 38.0 38.0 38.0 36.0 38.0 70-74 31.304750000000002 38.0 24.4 38.0 15.4 38.0 75-79 32.29025 38.0 33.8 38.0 7.2 38.0 80-84 34.7793 38.0 37.0 38.0 27.4 38.0 85-89 36.15715 38.0 37.8 38.0 33.0 38.0 90-94 36.28015 38.0 38.0 38.0 33.8 38.0 95-99 36.33489999999999 38.0 38.0 38.0 34.0 38.0 100-104 36.289550000000006 38.0 37.8 38.0 33.8 38.0 105-109 36.3189 38.0 38.0 38.0 34.0 38.0 110-114 34.792950000000005 38.0 35.4 38.0 25.4 38.0 115-119 34.2901 37.8 34.0 38.0 24.2 38.0 120-124 34.949400000000004 38.0 35.4 38.0 27.6 38.0 125-129 34.351299999999995 38.0 34.6 38.0 23.2 38.0 130-134 34.35865 38.0 35.0 38.0 24.4 38.0 135-139 33.654 37.8 34.0 38.0 21.6 38.0 140-144 34.13055 38.0 34.2 38.0 24.6 38.0 145-149 33.22675 38.0 33.8 38.0 17.0 38.0 150-151 28.961875 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 3.0 11 0.0 12 0.0 13 1.0 14 4.0 15 1.0 16 1.0 17 3.0 18 1.0 19 2.0 20 7.0 21 13.0 22 12.0 23 12.0 24 14.0 25 17.0 26 15.0 27 23.0 28 28.0 29 47.0 30 71.0 31 62.0 32 125.0 33 201.0 34 349.0 35 453.0 36 874.0 37 1661.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.475 15.4 9.0 39.125 2 21.25 21.125 36.6 21.025 3 17.9 26.625 27.675 27.800000000000004 4 21.425 34.075 22.650000000000002 21.85 5 21.55 35.875 24.125 18.45 6 17.75 35.375 26.25 20.625 7 13.05 21.3 45.800000000000004 19.85 8 17.224999999999998 22.425 31.525 28.825 9 16.975 22.55 33.775 26.700000000000003 10-14 19.744999999999997 29.654999999999998 26.47 24.13 15-19 20.375 28.79 27.284999999999997 23.549999999999997 20-24 19.89 28.415000000000003 27.82 23.875 25-29 19.448751938372265 29.37822019908959 27.467360312140464 23.70566755039768 30-34 19.33 28.999999999999996 27.944999999999997 23.724999999999998 35-39 19.97299594939241 29.19437915687353 27.59913987098065 23.233485022753413 40-44 19.89072133941551 29.029024011228632 27.780841144919542 23.299413504436313 45-49 20.01 28.305000000000003 27.400000000000002 24.285 50-54 20.14 28.345 27.955000000000002 23.56 55-59 20.19509754877439 28.494247123561784 27.453726863431715 23.856928464232116 60-64 20.31210923823338 28.564997749212225 27.92977542139749 23.193117591156906 65-69 20.327032703270326 28.452845284528454 27.752775277527753 23.467346734673466 70-74 20.223266745005873 28.842538190364277 27.56756756756757 23.36662749706228 75-79 20.2978364709188 28.856420342792923 27.22112953076707 23.624613655521216 80-84 20.13292861628637 28.794222315260626 27.87837554950806 23.194473518944942 85-89 20.402212166918048 28.230266465560582 27.541478129713425 23.82604323780794 90-94 20.188075230092036 28.201280512204878 28.04621848739496 23.564425770308123 95-99 20.435 28.249999999999996 27.595 23.72 100-104 20.544108821764354 28.640728145629126 27.830566113222645 22.984596919383876 105-109 20.535 28.810000000000002 27.24 23.415 110-114 20.580000000000002 28.349999999999998 28.095 22.975 115-119 20.516025801290063 28.39641982099105 27.60638031901595 23.481174058702937 120-124 21.234110699629667 28.095285757181465 27.06435792212992 23.606245621058953 125-129 20.87 28.105000000000004 27.105 23.919999999999998 130-134 20.765 28.705000000000002 27.04 23.49 135-139 20.745 28.59 26.790000000000003 23.875 140-144 20.825 28.044999999999998 27.224999999999998 23.905 145-149 21.172410343620268 28.38993647776722 26.929425298854596 23.508227879757914 150-151 20.8625 28.499999999999996 26.400000000000002 24.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.5 19 2.0 20 1.0 21 0.5 22 1.0 23 3.5 24 6.0 25 6.0 26 8.5 27 10.5 28 10.0 29 20.0 30 34.5 31 41.0 32 48.0 33 60.5 34 69.0 35 87.0 36 109.5 37 129.0 38 153.0 39 184.0 40 213.0 41 240.0 42 244.0 43 244.5 44 258.5 45 248.0 46 239.0 47 222.0 48 215.0 49 199.0 50 156.5 51 116.5 52 91.0 53 77.5 54 61.5 55 47.0 56 35.0 57 28.0 58 21.5 59 20.0 60 12.5 61 5.0 62 4.0 63 3.0 64 1.5 65 1.5 66 2.5 67 1.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.045 30-34 0.0 35-39 0.015 40-44 0.255 45-49 0.0 50-54 0.0 55-59 0.05 60-64 0.034999999999999996 65-69 0.01 70-74 14.899999999999999 75-79 11.025 80-84 4.46 85-89 0.5499999999999999 90-94 0.04 95-99 0.0 100-104 0.02 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.09 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.034999999999999996 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.2125 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.9 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.3125 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.7125 0.0 0.0 0.0 0.0 118-119 1.9249999999999998 0.0 0.0 0.0 0.0 120-121 2.25 0.0 0.0 0.0 0.0 122-123 2.5375 0.0 0.0 0.0 0.0 124-125 2.8 0.0 0.0 0.0 0.0 126-127 3.1 0.0 0.0 0.0 0.0 128-129 3.575 0.0 0.0 0.0 0.0 130-131 4.15 0.0 0.0 0.0 0.0 132-133 4.775 0.0 0.0 0.0 0.0 134-135 5.375 0.0 0.0 0.0 0.0 136-137 5.875 0.0 0.0 0.0 0.0 138-139 6.387499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAAGC 10 0.007334971 141.5875 7 TATGCCA 10 0.007334971 141.5875 7 >>END_MODULE SRR7230803 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230803_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90875 33.0 33.0 34.0 32.0 34.0 2 33.0535 34.0 33.0 34.0 32.0 34.0 3 33.06275 34.0 33.0 34.0 32.0 34.0 4 33.01025 34.0 33.0 34.0 32.0 34.0 5 33.005 34.0 33.0 34.0 32.0 34.0 6 37.0115 38.0 38.0 38.0 36.0 38.0 7 37.05575 38.0 38.0 38.0 37.0 38.0 8 36.88525 38.0 38.0 38.0 36.0 38.0 9 36.94325 38.0 38.0 38.0 37.0 38.0 10-14 36.97410000000001 38.0 38.0 38.0 36.6 38.0 15-19 37.0226 38.0 38.0 38.0 37.0 38.0 20-24 37.038650000000004 38.0 38.0 38.0 36.8 38.0 25-29 36.973150000000004 38.0 38.0 38.0 37.0 38.0 30-34 36.9362 38.0 38.0 38.0 36.6 38.0 35-39 36.6548 38.0 38.0 38.0 35.8 38.0 40-44 36.4687 38.0 38.0 38.0 34.8 38.0 45-49 36.7829 38.0 38.0 38.0 36.0 38.0 50-54 36.80255 38.0 38.0 38.0 36.0 38.0 55-59 36.30865 38.0 38.0 38.0 34.4 38.0 60-64 36.673100000000005 38.0 38.0 38.0 35.4 38.0 65-69 36.3466 38.0 38.0 38.0 35.0 38.0 70-74 36.34159999999999 38.0 38.0 38.0 34.6 38.0 75-79 36.587050000000005 38.0 38.0 38.0 35.0 38.0 80-84 36.5073 38.0 38.0 38.0 35.0 38.0 85-89 36.456450000000004 38.0 38.0 38.0 34.8 38.0 90-94 36.34325 38.0 38.0 38.0 34.2 38.0 95-99 35.70805 38.0 37.4 38.0 31.2 38.0 100-104 35.8752 38.0 38.0 38.0 32.4 38.0 105-109 35.3563 38.0 37.0 38.0 28.8 38.0 110-114 35.66325 38.0 37.2 38.0 31.4 38.0 115-119 35.74065 38.0 37.4 38.0 32.2 38.0 120-124 35.56215 38.0 37.2 38.0 31.4 38.0 125-129 35.266650000000006 38.0 36.2 38.0 29.8 38.0 130-134 35.0715 38.0 36.2 38.0 28.4 38.0 135-139 34.6629 38.0 36.0 38.0 26.6 38.0 140-144 34.2147 38.0 35.0 38.0 24.4 38.0 145-149 33.244499999999995 38.0 33.0 38.0 18.4 38.0 150-151 27.343125 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 8.0 4 4.0 5 3.0 6 2.0 7 2.0 8 1.0 9 1.0 10 3.0 11 2.0 12 4.0 13 2.0 14 2.0 15 3.0 16 5.0 17 4.0 18 5.0 19 4.0 20 3.0 21 14.0 22 12.0 23 7.0 24 11.0 25 21.0 26 16.0 27 33.0 28 37.0 29 46.0 30 45.0 31 69.0 32 73.0 33 100.0 34 159.0 35 234.0 36 556.0 37 2502.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.15 19.650000000000002 12.625 29.575000000000003 2 23.7 26.200000000000003 35.099999999999994 15.0 3 20.65 26.700000000000003 31.324999999999996 21.325 4 23.375 35.425000000000004 23.0 18.2 5 23.125 37.55 22.575 16.75 6 20.525 37.05 23.9 18.525 7 19.025 17.95 42.725 20.3 8 21.2 22.275 29.375 27.150000000000002 9 21.2 24.125 30.025000000000002 24.65 10-14 23.595 28.83 26.26 21.315 15-19 23.044999999999998 27.744999999999997 27.98 21.23 20-24 22.925 28.12 27.950000000000003 21.005 25-29 22.39 28.060000000000002 28.355000000000004 21.195 30-34 22.745 28.285 28.095 20.875 35-39 22.763414512176826 28.26924038605791 27.874181127169074 21.09316397459619 40-44 22.686134306715335 28.056402820141006 27.67138356917846 21.586079303965196 45-49 22.517251725172517 28.152815281528156 27.797779777977798 21.532153215321532 50-54 23.34 27.87 27.615000000000002 21.175 55-59 23.784381756926635 27.656257856891436 27.359581636244783 21.199778749937146 60-64 22.95614780739037 28.096404820241013 27.811390569528477 21.13605680284014 65-69 22.79515640766902 27.96165489404642 28.032290615539857 21.210898082744702 70-74 23.636912853043345 27.86588128681468 27.322156773901224 21.175049086240747 75-79 23.325000000000003 27.275 28.26 21.14 80-84 23.25697709312794 27.62328698609583 28.063419025707713 21.05631689506852 85-89 23.115 27.265 28.470000000000002 21.15 90-94 23.27 27.975 28.285 20.47 95-99 23.544999999999998 28.125 27.55 20.78 100-104 22.85 28.389999999999997 27.57 21.19 105-109 23.805 28.134999999999998 27.800000000000004 20.26 110-114 23.86 27.77 28.050000000000004 20.32 115-119 23.919999999999998 28.24 27.49 20.349999999999998 120-124 23.794999999999998 27.93 27.884999999999998 20.39 125-129 24.09 27.935 27.935 20.04 130-134 24.19 27.865000000000002 27.744999999999997 20.200000000000003 135-139 24.54122706135307 27.681384069203457 27.58137906895345 20.196009800490025 140-144 25.353803070460568 27.46912036805521 27.344101615242288 19.832974946241936 145-149 25.245 27.744999999999997 27.22 19.79 150-151 25.1875 28.599999999999998 27.037499999999998 19.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 1.5 20 1.5 21 0.5 22 1.0 23 2.0 24 2.5 25 2.0 26 4.5 27 8.5 28 9.5 29 16.0 30 21.5 31 27.5 32 33.0 33 36.0 34 45.5 35 64.0 36 88.5 37 100.5 38 122.5 39 153.5 40 186.0 41 225.5 42 248.0 43 262.0 44 259.0 45 274.5 46 286.0 47 255.5 48 231.5 49 194.0 50 151.0 51 135.0 52 125.0 53 96.0 54 68.0 55 61.0 56 55.0 57 37.0 58 24.5 59 20.5 60 19.0 61 14.5 62 8.5 63 4.0 64 1.0 65 2.5 66 1.5 67 1.0 68 2.0 69 1.0 70 1.5 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.015 40-44 0.005 45-49 0.01 50-54 0.0 55-59 0.565 60-64 0.005 65-69 0.8999999999999999 70-74 0.685 75-79 0.0 80-84 0.03 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.015 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.2125 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.9 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.825 0.0 0.0 0.0 0.0 118-119 2.05 0.0 0.0 0.0 0.0 120-121 2.35 0.0 0.0 0.0 0.0 122-123 2.65 0.0 0.0 0.0 0.0 124-125 2.95 0.0 0.0 0.0 0.0 126-127 3.25 0.0 0.0 0.0 0.0 128-129 3.725 0.0 0.0 0.0 0.0 130-131 4.300000000000001 0.0 0.0 0.0 0.0 132-133 4.925 0.0 0.0 0.0 0.0 134-135 5.525 0.0 0.0 0.0 0.0 136-137 6.075 0.0 0.0 0.0 0.0 138-139 6.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGACTT 10 0.006882143 144.6375 1 >>END_MODULE Read 856629 spots for SRR7230803.sra Written 856629 spots for SRR7230803.sra Read 856629 spots for SRR7230803.sra Written 856629 spots for SRR7230803.sra Read 856629 spots for SRR7230803.sra Written 856629 spots for SRR7230803.sra Read 856629 spots for SRR7230803.sra Written 856629 spots for SRR7230803.sra Read 856629 spots for SRR7230803.sra Written 856629 spots for SRR7230803.sra Read 856629 spots for SRR7230803.sra Written 856629 spots for SRR7230803.sra Read 856629 spots for SRR7230803.sra Written 856629 spots for SRR7230803.sra Read 856629 spots for SRR7230803.sra Written 856629 spots for SRR7230803.sra Read 856629 spots for SRR7230803.sra Written 856629 spots for SRR7230803.sra Read 856629 spots for SRR7230803.sra Written 856629 spots for SRR7230803.sra Read 856629 spots for SRR7230803.sra Written 856629 spots for SRR7230803.sra Read 856629 spots for SRR7230803.sra Written 856629 spots for SRR7230803.sra Read 856629 spots for SRR7230803.sra Written 856629 spots for SRR7230803.sra Read 856629 spots for SRR7230803.sra Written 856629 spots for SRR7230803.sra Read 856629 spots for SRR7230803.sra Written 856629 spots for SRR7230803.sra Read 856629 spots for SRR7230803.sra Written 856629 spots for SRR7230803.sra Read 856629 spots for SRR7230803.sra Written 856629 spots for SRR7230803.sra Read 856636 spots for SRR7230803.sra Written 856636 spots for SRR7230803.sra Read 856629 spots for SRR7230803.sra Written 856629 spots for SRR7230803.sra Read 856629 spots for SRR7230803.sra Written 856629 spots for SRR7230803.sra SRR ids: ['SRR7230803.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3l6mjmsq SRR7230803.sra spots: 17132587 blocks: [[1, 856629], [856630, 1713258], [1713259, 2569887], [2569888, 3426516], [3426517, 4283145], [4283146, 5139774], [5139775, 5996403], [5996404, 6853032], [6853033, 7709661], [7709662, 8566290], [8566291, 9422919], [9422920, 10279548], [10279549, 11136177], [11136178, 11992806], [11992807, 12849435], [12849436, 13706064], [13706065, 14562693], [14562694, 15419322], [15419323, 16275951], [16275952, 17132587]] SRR7230803 file size 5783971 SRR7230803 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230803 SRR7230803_1.fastq SRR7230803_2.fastq Input file: SRR7230803_1.fastq Paired file: SRR7230803_2.fastq trimmed: SRR7230803-trimmed-pair1.fastq, SRR7230803-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:38:34 2025 >> started Tue Feb 11 08:38:52 2025 >> done (17.280s) 17132587 read pairs processed; of these: 28624 ( 0.17%) short read pairs filtered out after trimming by size control 37104 ( 0.22%) empty read pairs filtered out after trimming by size control 17066859 (99.62%) read pairs available; of these: 7882822 (46.19%) trimmed read pairs available after processing 9184037 (53.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 10 0.00% 21 5 0.00% 22 5 0.00% 23 4 0.00% 24 10 0.00% 25 1 0.00% 26 6 0.00% 27 5 0.00% 28 8 0.00% 29 9 0.00% 30 9 0.00% 31 9 0.00% 32 11 0.00% 33 18 0.00% 34 8 0.00% 35 15 0.00% 36 16 0.00% 37 10 0.00% 38 13 0.00% 39 27 0.00% 40 19 0.00% 41 23 0.00% 42 30 0.00% 43 28 0.00% 44 37 0.00% 45 31 0.00% 46 45 0.00% 47 61 0.00% 48 45 0.00% 49 50 0.00% 50 55 0.00% 51 81 0.00% 52 86 0.00% 53 100 0.00% 54 117 0.00% 55 124 0.00% 56 110 0.00% 57 167 0.00% 58 143 0.00% 59 177 0.00% 60 243 0.00% 61 278 0.00% 62 253 0.00% 63 306 0.00% 64 347 0.00% 65 435 0.00% 66 487 0.00% 67 479 0.00% 68 545 0.00% 69 802 0.00% 70 861 0.01% 71 774 0.00% 72 875 0.01% 73 928 0.01% 74 1050 0.01% 75 1168 0.01% 76 1348 0.01% 77 1491 0.01% 78 1608 0.01% 79 1747 0.01% 80 2003 0.01% 81 2399 0.01% 82 3261 0.02% 83 2951 0.02% 84 4390 0.03% 85 5251 0.03% 86 5448 0.03% 87 5909 0.03% 88 6043 0.04% 89 6518 0.04% 90 6969 0.04% 91 7478 0.04% 92 7875 0.05% 93 8723 0.05% 94 9192 0.05% 95 9906 0.06% 96 10337 0.06% 97 11050 0.06% 98 11612 0.07% 99 12112 0.07% 100 13061 0.08% 101 13632 0.08% 102 14647 0.09% 103 15553 0.09% 104 16602 0.10% 105 17835 0.10% 106 18498 0.11% 107 19602 0.11% 108 20113 0.12% 109 21391 0.13% 110 22564 0.13% 111 23718 0.14% 112 24995 0.15% 113 26405 0.15% 114 27575 0.16% 115 28403 0.17% 116 30119 0.18% 117 31154 0.18% 118 32191 0.19% 119 33380 0.20% 120 35137 0.21% 121 36588 0.21% 122 38017 0.22% 123 39986 0.23% 124 42158 0.25% 125 43805 0.26% 126 45549 0.27% 127 47461 0.28% 128 49251 0.29% 129 51020 0.30% 130 53508 0.31% 131 55834 0.33% 132 58705 0.34% 133 62348 0.37% 134 65572 0.38% 135 68528 0.40% 136 72055 0.42% 137 76740 0.45% 138 80489 0.47% 139 85815 0.50% 140 91028 0.53% 141 98911 0.58% 142 108098 0.63% 143 120488 0.71% 144 137324 0.80% 145 160553 0.94% 146 195632 1.15% 147 258353 1.51% 148 376760 2.21% 149 719984 4.22% 150 3898497 22.84% 151 9184037 53.81% 17066859 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=14 prefix-density=0.47 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=473.98 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=17.1 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=20 prefix-density=0.52 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=12.25 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.8 sequence=CAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7230803 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:39:38 Started mapping on | Feb 11 08:39:38 Finished on | Feb 11 08:41:48 Mapping speed, Million of reads per hour | 472.62 Number of input reads | 17066859 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 15810525 Uniquely mapped reads % | 92.64% Average mapped length | 293.98 Number of splices: Total | 15163562 Number of splices: Annotated (sjdb) | 14835580 Number of splices: GT/AG | 14866081 Number of splices: GC/AG | 248710 Number of splices: AT/AC | 8679 Number of splices: Non-canonical | 40092 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 428464 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 197768 % of reads mapped to too many loci | 1.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.42% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 852338 852338 852338 N_multimapping 428464 428464 428464 N_noFeature 685027 15546672 795167 N_ambiguous 254079 1223 99562 UnstrandedReadsAssigned:14871419 PositiveStrandReadsAssigned:262630 NegativeStrandReadsAssigned:14915796 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7230803 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230803-trimmed-pair1.fastq SRR7230803-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,066,859 reads, 15,066,902 reads pseudoaligned [quant] estimated average fragment length: 239.034 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52401 SRR7230803.ke.tsv 34699 SRR7230803.se.tsv 87100 total ==> SRR7230803.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.97 684 24.1153 Potri.005G024800.1.v4.1 1035 796.966 113 8.89787 Potri.004G059700.1.v4.1 961 723.024 15 1.30193 Potri.007G009000.2.v4.1 1416 1177.97 0 0 Potri.003G141000.2.v4.1 2943 2704.97 971 22.5271 Potri.016G087400.1.v4.1 270 81.7888 852 653.722 Potri.015G069301.1.v4.1 564 332.077 0 0 Potri.010G195200.1.v4.1 1773 1534.97 88 3.59775 Potri.012G127500.1.v4.1 977 738.998 90 7.6427 ==> SRR7230803.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1262 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 249 Potri.001G212900.v4.1 21 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 21 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 1 SRR7230803 completed mapping pipeline successfully