Starting /dee2/code/volunteer_pipeline.sh SRR7230804 current disk space = 3055794827264 free memory = 1466159912 SRR7230804 SRAfilesize 4ba0b31f5007b83d85dbfb003d95672b SRR7230804.sra SRR7230804.sra file validated SRR7230804 is paired end SRR7230804 is conventional basespace SRR7230804 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230804_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79425 33.0 33.0 34.0 32.0 34.0 2 33.1315 34.0 33.0 34.0 32.0 34.0 3 33.264 34.0 33.0 34.0 33.0 34.0 4 33.299 34.0 33.0 34.0 33.0 34.0 5 31.984 34.0 33.0 34.0 28.0 34.0 6 36.49875 38.0 37.0 38.0 33.0 38.0 7 37.254 38.0 38.0 38.0 36.0 38.0 8 37.486 38.0 38.0 38.0 37.0 38.0 9 37.513 38.0 38.0 38.0 38.0 38.0 10-14 37.530699999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.4906 38.0 38.0 38.0 37.8 38.0 20-24 36.918549999999996 38.0 38.0 38.0 35.6 38.0 25-29 37.31515 38.0 38.0 38.0 37.0 38.0 30-34 37.3113 38.0 38.0 38.0 37.0 38.0 35-39 37.0657 38.0 38.0 38.0 36.2 38.0 40-44 36.75245 38.0 38.0 38.0 35.6 38.0 45-49 37.14945 38.0 38.0 38.0 36.4 38.0 50-54 37.20055 38.0 38.0 38.0 36.6 38.0 55-59 37.0904 38.0 38.0 38.0 36.0 38.0 60-64 37.115100000000005 38.0 38.0 38.0 36.2 38.0 65-69 37.0296 38.0 38.0 38.0 36.0 38.0 70-74 30.48755 38.0 19.2 38.0 15.4 38.0 75-79 31.379650000000005 38.0 30.8 38.0 7.4 38.0 80-84 34.8023 38.0 36.6 38.0 27.2 38.0 85-89 36.26455 38.0 38.0 38.0 33.4 38.0 90-94 36.51255 38.0 38.0 38.0 34.0 38.0 95-99 36.38835 38.0 38.0 38.0 34.0 38.0 100-104 36.4634 38.0 38.0 38.0 34.0 38.0 105-109 36.37915 38.0 38.0 38.0 34.0 38.0 110-114 36.25515 38.0 37.8 38.0 33.8 38.0 115-119 36.06045 38.0 37.0 38.0 33.2 38.0 120-124 35.63525 38.0 36.4 38.0 31.0 38.0 125-129 35.249 38.0 36.0 38.0 28.4 38.0 130-134 35.0355 38.0 35.6 38.0 28.0 38.0 135-139 34.99745 38.0 35.2 38.0 28.8 38.0 140-144 34.39945 38.0 34.8 38.0 26.0 38.0 145-149 33.68044999999999 38.0 33.4 38.0 22.8 38.0 150-151 29.614375000000003 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 2.0 13 1.0 14 2.0 15 1.0 16 0.0 17 1.0 18 2.0 19 3.0 20 5.0 21 9.0 22 4.0 23 8.0 24 14.0 25 22.0 26 18.0 27 19.0 28 32.0 29 39.0 30 54.0 31 86.0 32 121.0 33 195.0 34 278.0 35 472.0 36 801.0 37 1810.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.360840210052515 17.179294823705927 8.627156789197299 30.83270817704426 2 21.349999999999998 21.3 34.175 23.175 3 18.35 27.400000000000002 26.400000000000002 27.85 4 21.85 34.475 22.35 21.325 5 19.725 37.85 24.75 17.675 6 18.05 35.8 25.75 20.4 7 14.025000000000002 21.349999999999998 45.2 19.425 8 18.325 21.95 30.875000000000004 28.849999999999998 9 17.5 24.05 31.474999999999998 26.974999999999998 10-14 20.495 28.92 26.279999999999998 24.305 15-19 20.596029801490072 28.48142407120356 27.626381319065953 23.296164808240412 20-24 20.150000000000002 28.735 27.96 23.155 25-29 19.836983698369835 28.68786878687869 27.527752775277527 23.94739473947395 30-34 20.445 29.125 27.105 23.325000000000003 35-39 20.3 28.825 26.840000000000003 24.035 40-44 20.236484793827348 28.41324715667118 27.180720476977804 24.169547572523673 45-49 20.555 28.455000000000002 27.834999999999997 23.155 50-54 20.46511627906977 28.877219304826205 27.776944236059016 22.88072018004501 55-59 20.106111416987837 28.569998498423345 27.578957905801094 23.744932178787728 60-64 20.584555327561183 28.857414543816628 27.305940643611432 23.25208948501076 65-69 20.12112718354272 28.514940687722106 27.513889584063268 23.850042544671908 70-74 20.443692196095025 27.62497733180197 28.259686876624556 23.67164359547845 75-79 19.788493591585723 28.340709236162997 27.507328007356747 24.363469164894532 80-84 20.05959849435383 27.666248431618566 28.21518193224592 24.058971141781683 85-89 20.994113799869197 28.570709865673894 26.915530512652815 23.519645821804094 90-94 20.9 28.305000000000003 26.86 23.935000000000002 95-99 20.685000000000002 28.175 27.155 23.985 100-104 21.025 28.535 26.895000000000003 23.544999999999998 105-109 20.91 27.650000000000002 28.28 23.16 110-114 20.655 28.535 26.995 23.815 115-119 21.709999999999997 28.199999999999996 26.685 23.405 120-124 20.86 28.215 27.375 23.549999999999997 125-129 21.060000000000002 27.855 26.884999999999998 24.2 130-134 20.985 27.894999999999996 27.175 23.945 135-139 21.16 28.084999999999997 26.729999999999997 24.025 140-144 20.935000000000002 28.22 26.915 23.93 145-149 20.315 28.744999999999997 26.465 24.474999999999998 150-151 20.9 28.512500000000003 25.887500000000003 24.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.0 23 1.5 24 3.5 25 3.5 26 3.5 27 7.0 28 11.0 29 21.0 30 30.0 31 36.5 32 48.5 33 64.5 34 77.0 35 92.0 36 103.0 37 114.5 38 147.0 39 166.0 40 190.5 41 231.5 42 246.5 43 247.5 44 269.0 45 271.0 46 242.0 47 235.5 48 210.5 49 173.0 50 169.5 51 142.0 52 105.0 53 84.5 54 65.5 55 52.0 56 38.0 57 28.5 58 19.5 59 14.0 60 11.5 61 9.0 62 5.0 63 1.5 64 0.5 65 0.5 66 1.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.01 30-34 0.0 35-39 0.0 40-44 0.20500000000000002 45-49 0.0 50-54 0.025 55-59 0.105 60-64 0.095 65-69 0.105 70-74 17.285 75-79 13.004999999999999 80-84 4.36 85-89 0.615 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21796165489405 98.32499999999999 2 0.7063572149344097 1.4000000000000001 3 0.050454086781029264 0.15 4 0.0 0.0 5 0.025227043390514632 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.8375 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.2000000000000002 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 2.125 0.0 0.0 0.0 0.0 114-115 2.4625 0.0 0.0 0.0 0.0 116-117 2.7249999999999996 0.0 0.0 0.0 0.0 118-119 3.0625 0.0 0.0 0.0 0.0 120-121 3.425 0.0 0.0 0.0 0.0 122-123 3.6 0.0 0.0 0.0 0.0 124-125 3.9125 0.0 0.0 0.0 0.0 126-127 4.3125 0.0 0.0 0.0 0.0 128-129 4.675000000000001 0.0 0.0 0.0 0.0 130-131 5.050000000000001 0.0 0.0 0.0 0.0 132-133 5.5 0.0 0.0 0.0 0.0 134-135 6.2 0.0 0.0 0.0 0.0 136-137 6.7875 0.0 0.0 0.0 0.0 138-139 7.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7230804 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230804_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.846 33.0 33.0 34.0 32.0 34.0 2 32.9495 34.0 33.0 34.0 32.0 34.0 3 33.0305 34.0 33.0 34.0 32.0 34.0 4 32.98525 34.0 33.0 34.0 33.0 34.0 5 32.609 34.0 33.0 34.0 32.0 34.0 6 36.822 38.0 38.0 38.0 36.0 38.0 7 36.9955 38.0 38.0 38.0 36.0 38.0 8 36.995 38.0 38.0 38.0 37.0 38.0 9 36.9595 38.0 38.0 38.0 36.0 38.0 10-14 36.71079999999999 38.0 38.0 38.0 35.4 38.0 15-19 37.09585 38.0 38.0 38.0 37.0 38.0 20-24 37.023999999999994 38.0 38.0 38.0 36.8 38.0 25-29 36.6913 38.0 38.0 38.0 35.6 38.0 30-34 36.89565 38.0 38.0 38.0 36.6 38.0 35-39 36.690549999999995 38.0 38.0 38.0 35.6 38.0 40-44 36.4195 38.0 38.0 38.0 34.4 38.0 45-49 36.5969 38.0 38.0 38.0 35.2 38.0 50-54 36.761649999999996 38.0 38.0 38.0 35.8 38.0 55-59 36.7159 38.0 38.0 38.0 36.0 38.0 60-64 36.62445 38.0 38.0 38.0 35.4 38.0 65-69 36.3477 38.0 37.8 38.0 33.8 38.0 70-74 36.511700000000005 38.0 38.0 38.0 35.0 38.0 75-79 36.57815 38.0 38.0 38.0 35.2 38.0 80-84 36.48094999999999 38.0 38.0 38.0 34.6 38.0 85-89 36.539550000000006 38.0 38.0 38.0 35.0 38.0 90-94 36.45714999999999 38.0 38.0 38.0 35.0 38.0 95-99 36.2697 38.0 38.0 38.0 34.0 38.0 100-104 35.686099999999996 38.0 37.4 38.0 31.2 38.0 105-109 35.745450000000005 38.0 37.6 38.0 31.8 38.0 110-114 35.8667 38.0 38.0 38.0 33.2 38.0 115-119 35.8728 38.0 38.0 38.0 33.2 38.0 120-124 35.554899999999996 38.0 37.8 38.0 32.2 38.0 125-129 35.199450000000006 38.0 36.8 38.0 30.2 38.0 130-134 35.1045 38.0 36.0 38.0 29.4 38.0 135-139 34.73365 38.0 36.0 38.0 28.0 38.0 140-144 34.13985 38.0 35.4 38.0 24.6 38.0 145-149 33.20065 38.0 33.2 38.0 15.8 38.0 150-151 26.682499999999997 34.5 16.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 7.0 4 3.0 5 3.0 6 3.0 7 1.0 8 1.0 9 3.0 10 1.0 11 1.0 12 4.0 13 6.0 14 7.0 15 5.0 16 7.0 17 3.0 18 8.0 19 7.0 20 8.0 21 8.0 22 5.0 23 10.0 24 12.0 25 18.0 26 16.0 27 28.0 28 34.0 29 34.0 30 52.0 31 62.0 32 85.0 33 100.0 34 142.0 35 230.0 36 534.0 37 2548.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.8 20.375 12.55 25.275 2 25.8 25.3 31.825 17.075000000000003 3 20.125 27.775 32.125 19.975 4 23.9 34.625 21.75 19.725 5 23.275000000000002 37.425000000000004 21.224999999999998 18.075 6 19.975 36.85 23.425 19.75 7 19.3 17.65 41.425 21.625 8 21.95 22.275 27.450000000000003 28.325 9 21.95 23.35 29.425 25.275 10-14 23.665 28.02 26.52 21.795 15-19 23.150000000000002 27.79 27.93 21.13 20-24 22.925 27.625 27.965 21.485000000000003 25-29 23.06 28.09 27.575 21.275 30-34 22.93 28.035 27.944999999999997 21.09 35-39 22.715 27.634999999999998 28.23 21.42 40-44 23.055 27.49 28.410000000000004 21.044999999999998 45-49 23.292329232923294 27.852785278527854 27.992799279927993 20.862086208620862 50-54 23.356020418376538 27.669902912621357 27.364628165348815 21.60944850365329 55-59 23.897132544616 27.69199919791458 27.586725486264285 20.824142771205135 60-64 23.442344234423445 27.217721772177217 28.267826782678267 21.07210721072107 65-69 22.983608200912325 27.790866710110784 27.946262970574963 21.279262118401927 70-74 23.305445618956966 28.10480436851861 27.608837232603577 20.980912779920846 75-79 23.76 27.095000000000002 27.825 21.32 80-84 23.65973194638928 27.065413082616523 27.540508101620325 21.734346869373873 85-89 23.990000000000002 27.389999999999997 28.32 20.3 90-94 23.49 27.315 28.1 21.095 95-99 23.775 27.49 28.060000000000002 20.674999999999997 100-104 24.525 27.200000000000003 27.744999999999997 20.53 105-109 23.69 27.615000000000002 27.900000000000002 20.794999999999998 110-114 23.785 27.58 27.62 21.015 115-119 24.645 27.589999999999996 27.400000000000002 20.365 120-124 24.21 27.77 27.034999999999997 20.985 125-129 24.610000000000003 27.935 27.339999999999996 20.115 130-134 24.965 27.015 27.485 20.535 135-139 24.94 27.765 27.07 20.225 140-144 25.185000000000002 27.67 27.02 20.125 145-149 25.385 28.084999999999997 27.125 19.405 150-151 24.85 27.85 27.712500000000002 19.5875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 1.0 19 1.0 20 0.5 21 1.0 22 1.0 23 2.0 24 1.5 25 0.5 26 3.5 27 7.5 28 10.0 29 12.0 30 15.5 31 18.5 32 25.5 33 35.0 34 44.5 35 62.5 36 80.5 37 98.0 38 119.0 39 154.5 40 195.0 41 215.0 42 233.5 43 249.0 44 262.0 45 266.0 46 253.5 47 244.5 48 235.5 49 220.5 50 188.5 51 148.5 52 119.0 53 94.0 54 77.5 55 67.0 56 55.0 57 46.0 58 38.0 59 31.0 60 19.5 61 11.5 62 11.0 63 7.0 64 3.0 65 1.5 66 1.0 67 1.5 68 1.0 69 0.0 70 1.0 71 1.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.09 55-59 0.26 60-64 0.01 65-69 0.255 70-74 0.19499999999999998 75-79 0.0 80-84 0.02 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96281305337719 97.8 2 0.9359979762205919 1.8499999999999999 3 0.05059448520111307 0.15 4 0.05059448520111307 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0125 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.075 0.0 0.0 0.025 0.0 82-83 0.075 0.0 0.0 0.025 0.0 84-85 0.125 0.0 0.0 0.025 0.0 86-87 0.16249999999999998 0.0 0.0 0.025 0.0 88-89 0.25 0.0 0.0 0.025 0.0 90-91 0.30000000000000004 0.0 0.0 0.025 0.0 92-93 0.42500000000000004 0.0 0.0 0.025 0.0 94-95 0.4875 0.0 0.0 0.025 0.0 96-97 0.6375 0.0 0.0 0.025 0.0 98-99 0.725 0.0 0.0 0.025 0.0 100-101 0.875 0.0 0.0 0.025 0.0 102-103 1.0499999999999998 0.0 0.0 0.025 0.0 104-105 1.225 0.0 0.0 0.025 0.0 106-107 1.2875 0.0 0.0 0.025 0.0 108-109 1.4375 0.0 0.0 0.025 0.0 110-111 1.6625 0.0 0.0 0.025 0.0 112-113 2.1125 0.0 0.0 0.025 0.0 114-115 2.4625 0.0 0.0 0.025 0.0 116-117 2.75 0.0 0.0 0.025 0.0 118-119 3.0999999999999996 0.0 0.0 0.025 0.0 120-121 3.45 0.0 0.0 0.025 0.0 122-123 3.6 0.0 0.0 0.025 0.0 124-125 3.9250000000000003 0.0 0.0 0.025 0.0 126-127 4.325 0.0 0.0 0.025 0.0 128-129 4.699999999999999 0.0 0.0 0.025 0.0 130-131 5.125 0.0 0.0 0.025 0.0 132-133 5.5625 0.0 0.0 0.025 0.0 134-135 6.2 0.0 0.0 0.025 0.0 136-137 6.775 0.0 0.0 0.025 0.0 138-139 7.3125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCTTGA 10 0.006830828 145.0 9 GAAAGTC 10 0.006830828 145.0 7 >>END_MODULE Read 1061880 spots for SRR7230804.sra Written 1061880 spots for SRR7230804.sra Read 1061880 spots for SRR7230804.sra Written 1061880 spots for SRR7230804.sra Read 1061880 spots for SRR7230804.sra Written 1061880 spots for SRR7230804.sra Read 1061880 spots for SRR7230804.sra Written 1061880 spots for SRR7230804.sra Read 1061880 spots for SRR7230804.sra Written 1061880 spots for SRR7230804.sra Read 1061880 spots for SRR7230804.sra Written 1061880 spots for SRR7230804.sra Read 1061880 spots for SRR7230804.sra Written 1061880 spots for SRR7230804.sra Read 1061880 spots for SRR7230804.sra Written 1061880 spots for SRR7230804.sra Read 1061880 spots for SRR7230804.sra Written 1061880 spots for SRR7230804.sra Read 1061880 spots for SRR7230804.sra Written 1061880 spots for SRR7230804.sra Read 1061880 spots for SRR7230804.sra Written 1061880 spots for SRR7230804.sra Read 1061880 spots for SRR7230804.sra Written 1061880 spots for SRR7230804.sra Read 1061880 spots for SRR7230804.sra Written 1061880 spots for SRR7230804.sra Read 1061880 spots for SRR7230804.sra Written 1061880 spots for SRR7230804.sra Read 1061880 spots for SRR7230804.sra Written 1061880 spots for SRR7230804.sra Read 1061899 spots for SRR7230804.sra Written 1061899 spots for SRR7230804.sra Read 1061880 spots for SRR7230804.sra Written 1061880 spots for SRR7230804.sra Read 1061880 spots for SRR7230804.sra Written 1061880 spots for SRR7230804.sra Read 1061880 spots for SRR7230804.sra Written 1061880 spots for SRR7230804.sra Read 1061880 spots for SRR7230804.sra Written 1061880 spots for SRR7230804.sra SRR ids: ['SRR7230804.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4u_l47t2 SRR7230804.sra spots: 21237619 blocks: [[1, 1061880], [1061881, 2123760], [2123761, 3185640], [3185641, 4247520], [4247521, 5309400], [5309401, 6371280], [6371281, 7433160], [7433161, 8495040], [8495041, 9556920], [9556921, 10618800], [10618801, 11680680], [11680681, 12742560], [12742561, 13804440], [13804441, 14866320], [14866321, 15928200], [15928201, 16990080], [16990081, 18051960], [18051961, 19113840], [19113841, 20175720], [20175721, 21237619]] SRR7230804 file size 7175031 SRR7230804 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230804 SRR7230804_1.fastq SRR7230804_2.fastq Input file: SRR7230804_1.fastq Paired file: SRR7230804_2.fastq trimmed: SRR7230804-trimmed-pair1.fastq, SRR7230804-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:19:29 2025 >> started Tue Feb 11 08:19:54 2025 >> done (24.341s) 21237619 read pairs processed; of these: 31256 ( 0.15%) short read pairs filtered out after trimming by size control 26937 ( 0.13%) empty read pairs filtered out after trimming by size control 21179426 (99.73%) read pairs available; of these: 9957216 (47.01%) trimmed read pairs available after processing 11222210 (52.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 5 0.00% 21 4 0.00% 22 7 0.00% 23 6 0.00% 24 8 0.00% 25 6 0.00% 26 14 0.00% 27 7 0.00% 28 10 0.00% 29 9 0.00% 30 9 0.00% 31 9 0.00% 32 12 0.00% 33 14 0.00% 34 14 0.00% 35 15 0.00% 36 12 0.00% 37 18 0.00% 38 24 0.00% 39 23 0.00% 40 26 0.00% 41 24 0.00% 42 33 0.00% 43 33 0.00% 44 47 0.00% 45 49 0.00% 46 53 0.00% 47 55 0.00% 48 74 0.00% 49 89 0.00% 50 92 0.00% 51 92 0.00% 52 108 0.00% 53 118 0.00% 54 145 0.00% 55 144 0.00% 56 209 0.00% 57 180 0.00% 58 223 0.00% 59 246 0.00% 60 294 0.00% 61 356 0.00% 62 381 0.00% 63 408 0.00% 64 491 0.00% 65 568 0.00% 66 581 0.00% 67 697 0.00% 68 849 0.00% 69 1355 0.01% 70 1292 0.01% 71 1231 0.01% 72 1276 0.01% 73 1460 0.01% 74 1552 0.01% 75 1762 0.01% 76 1961 0.01% 77 2132 0.01% 78 2446 0.01% 79 2787 0.01% 80 2969 0.01% 81 3513 0.02% 82 4024 0.02% 83 4623 0.02% 84 6405 0.03% 85 7374 0.03% 86 7838 0.04% 87 8508 0.04% 88 8818 0.04% 89 9311 0.04% 90 10047 0.05% 91 10529 0.05% 92 11379 0.05% 93 12531 0.06% 94 13423 0.06% 95 14082 0.07% 96 14951 0.07% 97 15976 0.08% 98 16224 0.08% 99 17421 0.08% 100 18702 0.09% 101 19631 0.09% 102 20830 0.10% 103 22177 0.10% 104 23438 0.11% 105 24815 0.12% 106 25842 0.12% 107 26755 0.13% 108 28188 0.13% 109 29551 0.14% 110 30856 0.15% 111 32119 0.15% 112 33982 0.16% 113 34982 0.17% 114 37410 0.18% 115 38532 0.18% 116 40461 0.19% 117 41440 0.20% 118 42999 0.20% 119 44378 0.21% 120 46428 0.22% 121 48047 0.23% 122 50198 0.24% 123 52696 0.25% 124 54999 0.26% 125 57266 0.27% 126 59251 0.28% 127 61254 0.29% 128 63070 0.30% 129 65817 0.31% 130 68312 0.32% 131 70465 0.33% 132 74618 0.35% 133 78092 0.37% 134 82125 0.39% 135 86877 0.41% 136 91245 0.43% 137 95792 0.45% 138 101018 0.48% 139 108388 0.51% 140 111974 0.53% 141 123107 0.58% 142 133043 0.63% 143 148741 0.70% 144 171903 0.81% 145 206041 0.97% 146 246584 1.16% 147 326318 1.54% 148 473771 2.24% 149 924453 4.36% 150 4832137 22.82% 151 11222210 52.99% 21179426 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=15 prefix-density=0.55 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=401.38 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=16.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=23 prefix-density=0.59 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.16 sequence-density-rank=21 fanout-score=11.16 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=6.4 sequence=CAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7230804 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:20:40 Started mapping on | Feb 11 08:20:40 Finished on | Feb 11 08:23:03 Mapping speed, Million of reads per hour | 533.19 Number of input reads | 21179426 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 19628472 Uniquely mapped reads % | 92.68% Average mapped length | 293.34 Number of splices: Total | 18994762 Number of splices: Annotated (sjdb) | 18572877 Number of splices: GT/AG | 18612557 Number of splices: GC/AG | 317707 Number of splices: AT/AC | 10539 Number of splices: Non-canonical | 53959 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.38 Insertion rate per base | 0.02% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 541114 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 227977 % of reads mapped to too many loci | 1.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.42% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1039866 1039866 1039866 N_multimapping 541114 541114 541114 N_noFeature 822199 19289432 978622 N_ambiguous 313059 1828 129104 UnstrandedReadsAssigned:18493214 PositiveStrandReadsAssigned:337212 NegativeStrandReadsAssigned:18520746 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7230804 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230804-trimmed-pair1.fastq SRR7230804-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,179,426 reads, 18,648,813 reads pseudoaligned [quant] estimated average fragment length: 238.719 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,265 rounds 52401 SRR7230804.ke.tsv 34699 SRR7230804.se.tsv 87100 total ==> SRR7230804.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.28 716 21.1541 Potri.005G024800.1.v4.1 1035 797.281 130 8.57633 Potri.004G059700.1.v4.1 961 723.324 29 2.1088 Potri.007G009000.2.v4.1 1416 1178.28 0 0 Potri.003G141000.2.v4.1 2943 2705.28 1284.93 24.9825 Potri.016G087400.1.v4.1 270 83.2466 709 447.97 Potri.015G069301.1.v4.1 564 332.332 0 0 Potri.010G195200.1.v4.1 1773 1535.28 32 1.09631 Potri.012G127500.1.v4.1 977 739.319 106 7.54126 ==> SRR7230804.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1164 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 436 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 2 SRR7230804 completed mapping pipeline successfully