Starting /dee2/code/volunteer_pipeline.sh SRR7230805 current disk space = 3055763910656 free memory = 1429982648 SRR7230805 SRAfilesize 8586005a86d1ac7f5e1dfe23570cde72 SRR7230805.sra SRR7230805.sra file validated SRR7230805 is paired end SRR7230805 is conventional basespace SRR7230805 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230805_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.739 33.0 33.0 34.0 32.0 34.0 2 33.155 34.0 33.0 34.0 32.0 34.0 3 33.3165 34.0 33.0 34.0 33.0 34.0 4 33.3075 34.0 33.0 34.0 33.0 34.0 5 31.759 33.0 32.0 34.0 27.0 34.0 6 36.3755 38.0 36.0 38.0 31.0 38.0 7 37.17725 38.0 38.0 38.0 36.0 38.0 8 37.4625 38.0 38.0 38.0 37.0 38.0 9 37.447 38.0 38.0 38.0 37.0 38.0 10-14 37.45655000000001 38.0 38.0 38.0 37.2 38.0 15-19 37.4435 38.0 38.0 38.0 37.4 38.0 20-24 36.89795 38.0 38.0 38.0 35.6 38.0 25-29 37.2952 38.0 38.0 38.0 37.0 38.0 30-34 37.29520000000001 38.0 38.0 38.0 36.8 38.0 35-39 37.09675 38.0 38.0 38.0 36.4 38.0 40-44 36.732099999999996 38.0 38.0 38.0 35.0 38.0 45-49 37.1269 38.0 38.0 38.0 36.6 38.0 50-54 37.1457 38.0 38.0 38.0 36.6 38.0 55-59 37.0811 38.0 38.0 38.0 36.2 38.0 60-64 37.14525 38.0 38.0 38.0 36.4 38.0 65-69 37.13645 38.0 38.0 38.0 36.2 38.0 70-74 29.755799999999994 37.8 16.4 38.0 15.4 38.0 75-79 30.85085 38.0 30.4 38.0 4.6 38.0 80-84 34.46855000000001 38.0 36.6 38.0 25.0 38.0 85-89 36.0219 38.0 38.0 38.0 31.6 38.0 90-94 36.417649999999995 38.0 38.0 38.0 33.8 38.0 95-99 36.3389 38.0 38.0 38.0 34.0 38.0 100-104 36.480650000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.51525 38.0 38.0 38.0 34.0 38.0 110-114 36.2974 38.0 38.0 38.0 33.8 38.0 115-119 36.021249999999995 38.0 37.0 38.0 33.0 38.0 120-124 35.6167 38.0 36.8 38.0 30.8 38.0 125-129 35.21470000000001 38.0 36.0 38.0 28.4 38.0 130-134 35.1383 38.0 36.0 38.0 28.6 38.0 135-139 35.100199999999994 38.0 36.0 38.0 28.8 38.0 140-144 34.49135 38.0 35.0 38.0 25.8 38.0 145-149 33.80195 38.0 33.4 38.0 23.2 38.0 150-151 29.63725 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 1.0 16 3.0 17 1.0 18 3.0 19 2.0 20 4.0 21 3.0 22 9.0 23 4.0 24 20.0 25 22.0 26 24.0 27 29.0 28 34.0 29 46.0 30 40.0 31 83.0 32 120.0 33 221.0 34 279.0 35 473.0 36 821.0 37 1754.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.475 15.775 8.55 32.2 2 20.674999999999997 21.4 34.175 23.75 3 17.625 27.6 26.575 28.199999999999996 4 22.525000000000002 33.6 22.875 21.0 5 20.375 37.1 24.0 18.525 6 16.875 36.825 26.35 19.950000000000003 7 13.55 22.575 44.074999999999996 19.8 8 16.725 23.125 32.175 27.975 9 18.325 23.275000000000002 31.85 26.55 10-14 19.865 29.415000000000003 26.810000000000002 23.91 15-19 20.145 28.435 27.625 23.794999999999998 20-24 20.025000000000002 28.715000000000003 27.52 23.74 25-29 20.361018050902548 28.931446572328618 27.44637231861593 23.26116305815291 30-34 20.135 28.725 27.955000000000002 23.185 35-39 20.34 28.435 27.345000000000002 23.880000000000003 40-44 19.87888494069366 28.527100745708424 27.451078524598366 24.14293578899955 45-49 20.330000000000002 28.775000000000002 27.034999999999997 23.86 50-54 20.15201520152015 28.237823782378236 28.107810781078108 23.502350235023503 55-59 20.278250425382844 28.560704634170754 27.2695425883295 23.891502352116905 60-64 20.38222933760256 27.98679207524515 28.036822093255953 23.59415649389634 65-69 20.11209528098884 28.279037181604366 27.96376920382325 23.645098333583547 70-74 20.633444898971117 28.480228089748355 27.1166480723937 23.769678938886823 75-79 20.086418311339486 29.177858227256802 27.48452645101016 23.251197010393554 80-84 20.07813737395069 28.33007760941872 27.844358798373896 23.74742621825669 85-89 20.37037037037037 28.67090523766273 27.19749722474518 23.76122716722172 90-94 20.175 28.189999999999998 27.925 23.71 95-99 20.505000000000003 28.345 27.575 23.575 100-104 20.34 29.134999999999998 27.435 23.09 105-109 20.794999999999998 28.410000000000004 26.979999999999997 23.815 110-114 20.72 28.389999999999997 27.3 23.59 115-119 21.12 28.685 27.16 23.035 120-124 21.275 28.225 26.979999999999997 23.52 125-129 20.825 28.585 26.76 23.830000000000002 130-134 20.665 28.46 27.175 23.7 135-139 20.865000000000002 28.389999999999997 27.01 23.735 140-144 21.255 28.335 26.340000000000003 24.07 145-149 20.69 28.525 26.22 24.565 150-151 21.575 27.775 26.85 23.799999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 2.5 24 4.5 25 5.0 26 6.5 27 12.0 28 16.0 29 21.5 30 28.5 31 37.5 32 48.5 33 56.0 34 71.5 35 96.0 36 122.5 37 152.0 38 174.5 39 173.0 40 196.0 41 231.0 42 242.5 43 233.5 44 246.5 45 273.0 46 247.5 47 232.5 48 198.5 49 157.0 50 139.5 51 124.5 52 104.0 53 78.0 54 69.5 55 53.5 56 37.5 57 29.5 58 20.5 59 15.0 60 9.5 61 6.0 62 7.5 63 4.0 64 2.0 65 3.5 66 2.5 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.095 45-49 0.0 50-54 0.01 55-59 0.09 60-64 0.06 65-69 0.08499999999999999 70-74 19.33 75-79 14.37 80-84 5.295 85-89 0.91 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44612286002014 98.75 2 0.4783484390735146 0.95 3 0.025176233635448138 0.075 4 0.025176233635448138 0.1 5 0.025176233635448138 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.2000000000000002 0.0 0.0 0.0 0.0 100-101 1.3875000000000002 0.0 0.0 0.0 0.0 102-103 1.725 0.0 0.0 0.0 0.0 104-105 2.1375 0.0 0.0 0.0 0.0 106-107 2.5374999999999996 0.0 0.0 0.0 0.0 108-109 2.7625 0.0 0.0 0.0 0.0 110-111 3.3 0.0 0.0 0.0 0.0 112-113 3.85 0.0 0.0 0.0 0.0 114-115 4.3375 0.0 0.0 0.0 0.0 116-117 4.7875 0.0 0.0 0.0 0.0 118-119 5.2125 0.0 0.0 0.0 0.0 120-121 5.824999999999999 0.0 0.0 0.0 0.0 122-123 6.35 0.0 0.0 0.0 0.0 124-125 7.050000000000001 0.0 0.0 0.0 0.0 126-127 7.7 0.0 0.0 0.0 0.0 128-129 8.3875 0.0 0.0 0.0 0.0 130-131 9.15 0.0 0.0 0.0 0.0 132-133 10.087499999999999 0.0 0.0 0.0 0.0 134-135 10.95 0.0 0.0 0.0 0.0 136-137 11.837499999999999 0.0 0.0 0.0 0.0 138-139 12.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7230805 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230805_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8235 33.0 33.0 34.0 32.0 34.0 2 32.9065 33.0 33.0 34.0 32.0 34.0 3 32.92925 34.0 33.0 34.0 32.0 34.0 4 32.92825 34.0 33.0 34.0 32.0 34.0 5 32.555 34.0 33.0 34.0 31.0 34.0 6 36.69875 38.0 38.0 38.0 35.0 38.0 7 36.7805 38.0 38.0 38.0 35.0 38.0 8 36.9055 38.0 38.0 38.0 36.0 38.0 9 36.8535 38.0 38.0 38.0 36.0 38.0 10-14 36.64695 38.0 38.0 38.0 34.6 38.0 15-19 37.01950000000001 38.0 38.0 38.0 36.6 38.0 20-24 37.010149999999996 38.0 38.0 38.0 36.6 38.0 25-29 36.65715 38.0 38.0 38.0 35.4 38.0 30-34 36.87385 38.0 38.0 38.0 36.0 38.0 35-39 36.5704 38.0 38.0 38.0 35.0 38.0 40-44 36.268 38.0 38.0 38.0 33.4 38.0 45-49 36.584050000000005 38.0 38.0 38.0 35.0 38.0 50-54 36.7218 38.0 38.0 38.0 35.6 38.0 55-59 36.695100000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.49014999999999 38.0 38.0 38.0 34.6 38.0 65-69 36.24175 38.0 37.8 38.0 33.6 38.0 70-74 36.4767 38.0 38.0 38.0 34.8 38.0 75-79 36.5539 38.0 38.0 38.0 35.0 38.0 80-84 36.49035 38.0 38.0 38.0 34.6 38.0 85-89 36.51545 38.0 38.0 38.0 34.8 38.0 90-94 36.382400000000004 38.0 38.0 38.0 34.2 38.0 95-99 36.1858 38.0 38.0 38.0 33.8 38.0 100-104 35.620549999999994 38.0 37.2 38.0 31.0 38.0 105-109 35.609 38.0 37.2 38.0 30.6 38.0 110-114 35.7911 38.0 37.6 38.0 32.0 38.0 115-119 35.80365 38.0 37.8 38.0 33.0 38.0 120-124 35.498799999999996 38.0 37.2 38.0 31.2 38.0 125-129 34.9518 38.0 36.0 38.0 27.8 38.0 130-134 34.84765 38.0 36.0 38.0 28.0 38.0 135-139 34.3995 38.0 35.6 38.0 25.6 38.0 140-144 33.6299 38.0 33.4 38.0 20.8 38.0 145-149 32.400200000000005 38.0 33.0 38.0 10.8 38.0 150-151 25.264375 33.5 12.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 3.0 5 2.0 6 3.0 7 4.0 8 2.0 9 3.0 10 3.0 11 2.0 12 2.0 13 2.0 14 3.0 15 5.0 16 3.0 17 5.0 18 5.0 19 9.0 20 7.0 21 6.0 22 13.0 23 16.0 24 13.0 25 19.0 26 35.0 27 31.0 28 41.0 29 37.0 30 56.0 31 66.0 32 90.0 33 111.0 34 175.0 35 245.0 36 579.0 37 2397.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.425 19.975 12.625 22.975 2 25.924999999999997 24.75 32.375 16.950000000000003 3 19.85 26.950000000000003 33.324999999999996 19.875 4 23.325000000000003 35.199999999999996 22.775000000000002 18.7 5 23.599999999999998 39.050000000000004 20.9 16.45 6 19.225 37.4 23.125 20.25 7 20.549999999999997 17.825 41.199999999999996 20.424999999999997 8 19.075 23.875 28.499999999999996 28.549999999999997 9 21.325 23.625 28.799999999999997 26.25 10-14 23.5 28.605000000000004 26.515 21.38 15-19 23.56 27.76 27.87 20.810000000000002 20-24 22.605 27.834999999999997 28.32 21.240000000000002 25-29 22.759999999999998 28.065 28.475 20.7 30-34 22.95 28.18 28.025 20.845 35-39 22.825 27.735 28.43 21.01 40-44 23.244999999999997 27.99 27.58 21.185000000000002 45-49 23.32233223322332 27.87778777877788 28.15781578157816 20.642064206420642 50-54 23.70277708281211 27.60570427820866 28.016012009006758 20.675506629972478 55-59 23.022195500776593 27.847086527381133 28.25792875394559 20.87278921789669 60-64 23.380000000000003 28.189999999999998 27.644999999999996 20.785 65-69 22.69311692215209 27.59743512674081 28.1785392245266 21.530908726580503 70-74 23.24719551282051 27.54407051282051 27.854567307692307 21.354166666666664 75-79 22.625 28.08 28.139999999999997 21.154999999999998 80-84 23.649729945989197 27.615523104620927 27.980596119223843 20.754150830166033 85-89 23.474999999999998 28.355000000000004 27.169999999999998 21.0 90-94 23.275000000000002 28.26 27.415 21.05 95-99 23.52 27.955000000000002 27.395000000000003 21.13 100-104 23.335 27.889999999999997 28.27 20.505000000000003 105-109 24.04 27.250000000000004 28.175 20.535 110-114 24.125 28.28 27.61 19.985 115-119 24.215 28.34 27.26 20.185 120-124 24.975 27.68 27.215 20.13 125-129 25.09 27.705000000000002 27.355 19.85 130-134 25.535000000000004 27.685 27.36 19.42 135-139 25.590000000000003 28.125 26.784999999999997 19.5 140-144 26.064999999999998 27.79 26.61 19.535 145-149 26.369999999999997 27.750000000000004 26.775 19.105 150-151 26.437500000000004 28.475 26.0625 19.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.5 21 2.0 22 2.0 23 2.5 24 1.5 25 2.0 26 3.5 27 8.5 28 14.0 29 14.0 30 14.5 31 21.0 32 27.0 33 39.5 34 57.0 35 72.5 36 96.0 37 106.5 38 125.5 39 162.0 40 191.5 41 217.0 42 241.0 43 247.0 44 251.5 45 275.0 46 266.5 47 238.5 48 232.0 49 207.5 50 171.0 51 144.0 52 111.5 53 87.0 54 75.0 55 69.0 56 55.0 57 36.5 58 22.5 59 18.0 60 16.5 61 12.0 62 10.5 63 7.5 64 4.0 65 3.5 66 3.0 67 3.0 68 2.5 69 2.0 70 1.5 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.075 55-59 0.20500000000000002 60-64 0.0 65-69 0.19 70-74 0.16 75-79 0.0 80-84 0.02 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9873417721519 97.75 2 0.8607594936708861 1.7000000000000002 3 0.0759493670886076 0.22499999999999998 4 0.05063291139240507 0.2 5 0.025316455696202535 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1625 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.4375 0.0 0.0 0.0 0.0 102-103 1.775 0.0 0.0 0.0 0.0 104-105 2.1875 0.0 0.0 0.0 0.0 106-107 2.5875000000000004 0.0 0.0 0.0 0.0 108-109 2.8375 0.0 0.0 0.0 0.0 110-111 3.375 0.0 0.0 0.0 0.0 112-113 3.925 0.0 0.0 0.0 0.0 114-115 4.375 0.0 0.0 0.0 0.0 116-117 4.8375 0.0 0.0 0.0 0.0 118-119 5.25 0.0 0.0 0.0 0.0 120-121 5.800000000000001 0.0 0.0 0.0 0.0 122-123 6.300000000000001 0.0 0.0 0.0 0.0 124-125 7.0 0.0 0.0 0.0 0.0 126-127 7.625 0.0 0.0 0.0 0.0 128-129 8.3625 0.0 0.0 0.0 0.0 130-131 9.1375 0.0 0.0 0.0 0.0 132-133 10.0625 0.0 0.0 0.0 0.0 134-135 10.925 0.0 0.0 0.0 0.0 136-137 11.775 0.0 0.0 0.0 0.0 138-139 12.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTAGCT 10 0.006830828 145.0 7 CTGATCA 10 0.006830828 145.0 9 TCAAATA 10 0.006830828 145.0 2 >>END_MODULE Read 1151939 spots for SRR7230805.sra Written 1151939 spots for SRR7230805.sra Read 1151939 spots for SRR7230805.sra Written 1151939 spots for SRR7230805.sra Read 1151939 spots for SRR7230805.sra Written 1151939 spots for SRR7230805.sra Read 1151939 spots for SRR7230805.sra Written 1151939 spots for SRR7230805.sra Read 1151939 spots for SRR7230805.sra Written 1151939 spots for SRR7230805.sra Read 1151939 spots for SRR7230805.sra Written 1151939 spots for SRR7230805.sra Read 1151939 spots for SRR7230805.sra Written 1151939 spots for SRR7230805.sra Read 1151939 spots for SRR7230805.sra Written 1151939 spots for SRR7230805.sra Read 1151939 spots for SRR7230805.sra Written 1151939 spots for SRR7230805.sra Read 1151939 spots for SRR7230805.sra Written 1151939 spots for SRR7230805.sra Read 1151947 spots for SRR7230805.sra Written 1151947 spots for SRR7230805.sra Read 1151939 spots for SRR7230805.sra Written 1151939 spots for SRR7230805.sra Read 1151939 spots for SRR7230805.sra Written 1151939 spots for SRR7230805.sra Read 1151939 spots for SRR7230805.sra Written 1151939 spots for SRR7230805.sra Read 1151939 spots for SRR7230805.sra Written 1151939 spots for SRR7230805.sra Read 1151939 spots for SRR7230805.sra Written 1151939 spots for SRR7230805.sra Read 1151939 spots for SRR7230805.sra Written 1151939 spots for SRR7230805.sra Read 1151939 spots for SRR7230805.sra Written 1151939 spots for SRR7230805.sra Read 1151939 spots for SRR7230805.sra Written 1151939 spots for SRR7230805.sra Read 1151939 spots for SRR7230805.sra Written 1151939 spots for SRR7230805.sra SRR ids: ['SRR7230805.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jhvkaprl SRR7230805.sra spots: 23038788 blocks: [[1, 1151939], [1151940, 2303878], [2303879, 3455817], [3455818, 4607756], [4607757, 5759695], [5759696, 6911634], [6911635, 8063573], [8063574, 9215512], [9215513, 10367451], [10367452, 11519390], [11519391, 12671329], [12671330, 13823268], [13823269, 14975207], [14975208, 16127146], [16127147, 17279085], [17279086, 18431024], [18431025, 19582963], [19582964, 20734902], [20734903, 21886841], [21886842, 23038788]] SRR7230805 file size 7785388 SRR7230805 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230805 SRR7230805_1.fastq SRR7230805_2.fastq Input file: SRR7230805_1.fastq Paired file: SRR7230805_2.fastq trimmed: SRR7230805-trimmed-pair1.fastq, SRR7230805-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:27:09 2025 >> started Tue Feb 11 08:27:34 2025 >> done (24.547s) 23038788 read pairs processed; of these: 31679 ( 0.14%) short read pairs filtered out after trimming by size control 36985 ( 0.16%) empty read pairs filtered out after trimming by size control 22970124 (99.70%) read pairs available; of these: 11448690 (49.84%) trimmed read pairs available after processing 11521434 (50.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 8 0.00% 20 8 0.00% 21 4 0.00% 22 3 0.00% 23 10 0.00% 24 6 0.00% 25 7 0.00% 26 12 0.00% 27 11 0.00% 28 12 0.00% 29 13 0.00% 30 17 0.00% 31 22 0.00% 32 24 0.00% 33 18 0.00% 34 22 0.00% 35 33 0.00% 36 26 0.00% 37 27 0.00% 38 34 0.00% 39 30 0.00% 40 38 0.00% 41 53 0.00% 42 66 0.00% 43 62 0.00% 44 73 0.00% 45 79 0.00% 46 97 0.00% 47 84 0.00% 48 151 0.00% 49 154 0.00% 50 180 0.00% 51 197 0.00% 52 205 0.00% 53 242 0.00% 54 251 0.00% 55 269 0.00% 56 342 0.00% 57 413 0.00% 58 455 0.00% 59 495 0.00% 60 582 0.00% 61 680 0.00% 62 770 0.00% 63 752 0.00% 64 871 0.00% 65 1070 0.00% 66 1103 0.00% 67 1303 0.01% 68 1518 0.01% 69 2106 0.01% 70 2242 0.01% 71 2174 0.01% 72 2417 0.01% 73 2821 0.01% 74 2987 0.01% 75 3491 0.02% 76 3785 0.02% 77 4269 0.02% 78 4800 0.02% 79 5429 0.02% 80 5947 0.03% 81 6814 0.03% 82 7794 0.03% 83 8755 0.04% 84 11002 0.05% 85 12614 0.05% 86 13282 0.06% 87 14471 0.06% 88 15175 0.07% 89 16418 0.07% 90 17748 0.08% 91 19437 0.08% 92 20735 0.09% 93 22772 0.10% 94 24063 0.10% 95 25987 0.11% 96 27212 0.12% 97 28765 0.13% 98 30132 0.13% 99 32094 0.14% 100 33979 0.15% 101 35367 0.15% 102 38041 0.17% 103 40398 0.18% 104 41968 0.18% 105 44670 0.19% 106 46630 0.20% 107 48226 0.21% 108 50451 0.22% 109 52444 0.23% 110 53944 0.23% 111 56665 0.25% 112 59689 0.26% 113 61901 0.27% 114 63981 0.28% 115 66333 0.29% 116 68974 0.30% 117 70030 0.30% 118 72338 0.31% 119 73950 0.32% 120 77255 0.34% 121 79765 0.35% 122 81602 0.36% 123 85495 0.37% 124 87855 0.38% 125 90176 0.39% 126 92847 0.40% 127 94524 0.41% 128 96318 0.42% 129 99515 0.43% 130 102273 0.45% 131 104489 0.45% 132 108900 0.47% 133 113111 0.49% 134 117550 0.51% 135 122972 0.54% 136 126105 0.55% 137 131136 0.57% 138 135396 0.59% 139 142912 0.62% 140 146457 0.64% 141 156532 0.68% 142 167230 0.73% 143 180233 0.78% 144 203282 0.88% 145 235837 1.03% 146 274960 1.20% 147 350212 1.52% 148 487781 2.12% 149 907307 3.95% 150 4758035 20.71% 151 11521434 50.16% 22970124 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=4.68 fanout-score-rank=5 prefix-density=0.52 prefix-fanout=3.5 sequence=CCATTGCTTGCAATGGAAGTAATGTCATT criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=30.33 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.4 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=16 prefix-density=0.40 prefix-fanout=2.2 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.15 sequence-density-rank=21 fanout-score=16.77 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=6.1 sequence=AGCAATGGCAGCA SRR7230805 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:28:23 Started mapping on | Feb 11 08:28:23 Finished on | Feb 11 08:31:09 Mapping speed, Million of reads per hour | 498.15 Number of input reads | 22970124 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 21159925 Uniquely mapped reads % | 92.12% Average mapped length | 289.89 Number of splices: Total | 19767277 Number of splices: Annotated (sjdb) | 19285551 Number of splices: GT/AG | 19383798 Number of splices: GC/AG | 308637 Number of splices: AT/AC | 11878 Number of splices: Non-canonical | 62964 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 602919 % of reads mapped to multiple loci | 2.62% Number of reads mapped to too many loci | 316028 % of reads mapped to too many loci | 1.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.56% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1236363 1236363 1236363 N_multimapping 602919 602919 602919 N_noFeature 977951 20712382 1169056 N_ambiguous 412268 2018 154358 UnstrandedReadsAssigned:19769706 PositiveStrandReadsAssigned:445525 NegativeStrandReadsAssigned:19836511 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7230805 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230805-trimmed-pair1.fastq SRR7230805-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,970,124 reads, 19,953,100 reads pseudoaligned [quant] estimated average fragment length: 224.435 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52401 SRR7230805.ke.tsv 34699 SRR7230805.se.tsv 87100 total ==> SRR7230805.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.57 1023 24.555 Potri.005G024800.1.v4.1 1035 811.565 274 14.5429 Potri.004G059700.1.v4.1 961 737.631 16 0.934339 Potri.007G009000.2.v4.1 1416 1192.57 0 0 Potri.003G141000.2.v4.1 2943 2719.57 985.859 15.6149 Potri.016G087400.1.v4.1 270 93.3522 1012.24 467.071 Potri.015G069301.1.v4.1 564 346.623 0 0 Potri.010G195200.1.v4.1 1773 1549.57 162 4.50328 Potri.012G127500.1.v4.1 977 753.596 253 14.4613 ==> SRR7230805.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 726 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 440 Potri.001G212900.v4.1 36 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 92 SRR7230805 completed mapping pipeline successfully