Starting /dee2/code/volunteer_pipeline.sh SRR7230806 current disk space = 3055551127552 free memory = 1574535940 SRR7230806 SRAfilesize 2d491957e711af8f4acbca4fda0afac5 SRR7230806.sra SRR7230806.sra file validated SRR7230806 is paired end SRR7230806 is conventional basespace SRR7230806 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230806_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3805 34.0 33.0 34.0 33.0 34.0 2 33.40225 34.0 33.0 34.0 33.0 34.0 3 33.4465 34.0 34.0 34.0 33.0 34.0 4 33.459 34.0 34.0 34.0 33.0 34.0 5 33.438 34.0 34.0 34.0 33.0 34.0 6 37.272 38.0 38.0 38.0 36.0 38.0 7 37.4285 38.0 38.0 38.0 37.0 38.0 8 37.30275 38.0 38.0 38.0 37.0 38.0 9 37.5515 38.0 38.0 38.0 38.0 38.0 10-14 37.5475 38.0 38.0 38.0 38.0 38.0 15-19 37.471900000000005 38.0 38.0 38.0 37.6 38.0 20-24 37.55355 38.0 38.0 38.0 38.0 38.0 25-29 37.44805 38.0 38.0 38.0 37.8 38.0 30-34 37.29205 38.0 38.0 38.0 37.2 38.0 35-39 37.204 38.0 38.0 38.0 36.8 38.0 40-44 36.84055000000001 38.0 38.0 38.0 35.6 38.0 45-49 37.12835 38.0 38.0 38.0 36.6 38.0 50-54 37.20785 38.0 38.0 38.0 36.8 38.0 55-59 37.18525 38.0 38.0 38.0 37.0 38.0 60-64 37.10075 38.0 38.0 38.0 36.0 38.0 65-69 37.069500000000005 38.0 38.0 38.0 36.2 38.0 70-74 31.88715 38.0 26.6 38.0 15.6 38.0 75-79 32.779650000000004 38.0 34.8 38.0 9.4 38.0 80-84 35.153949999999995 38.0 37.4 38.0 29.2 38.0 85-89 36.15955 38.0 38.0 38.0 33.8 38.0 90-94 36.42835 38.0 38.0 38.0 34.0 38.0 95-99 36.49935 38.0 38.0 38.0 34.2 38.0 100-104 36.45665 38.0 38.0 38.0 34.2 38.0 105-109 35.731300000000005 38.0 37.0 38.0 30.0 38.0 110-114 35.92955 38.0 37.0 38.0 32.2 38.0 115-119 35.926100000000005 38.0 37.4 38.0 32.6 38.0 120-124 35.64489999999999 38.0 37.0 38.0 31.4 38.0 125-129 35.0044 38.0 35.6 38.0 27.0 38.0 130-134 35.17865 38.0 36.0 38.0 29.0 38.0 135-139 35.15815 38.0 36.0 38.0 29.8 38.0 140-144 34.90875 38.0 36.0 38.0 28.2 38.0 145-149 34.1219 38.0 34.4 38.0 25.0 38.0 150-151 30.353499999999997 35.5 28.5 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 1.0 9 0.0 10 0.0 11 2.0 12 1.0 13 3.0 14 1.0 15 1.0 16 3.0 17 2.0 18 5.0 19 3.0 20 7.0 21 5.0 22 7.0 23 12.0 24 8.0 25 15.0 26 9.0 27 17.0 28 23.0 29 52.0 30 56.0 31 67.0 32 103.0 33 151.0 34 261.0 35 404.0 36 680.0 37 2099.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.275 15.875 11.125 32.725 2 22.2 19.975 33.95 23.875 3 18.825 27.275 27.675 26.224999999999998 4 21.675 34.025 23.325000000000003 20.974999999999998 5 21.275 35.425000000000004 24.575 18.725 6 17.525 36.85 26.35 19.275000000000002 7 13.425 22.8 45.15 18.625 8 17.299999999999997 22.650000000000002 31.724999999999998 28.325 9 18.675 23.525 31.674999999999997 26.125 10-14 20.05 29.78 26.76 23.41 15-19 19.43 29.56 27.845 23.165 20-24 19.759999999999998 29.535 27.665 23.04 25-29 19.32 29.09 27.839999999999996 23.75 30-34 19.68 28.565 28.494999999999997 23.26 35-39 19.791979197919794 29.232923292329232 27.40774077407741 23.567356735673567 40-44 19.998998798558272 28.884661593912696 27.96355626752102 23.15278334000801 45-49 19.82 29.244999999999997 27.205000000000002 23.73 50-54 19.5 29.110000000000003 28.194999999999997 23.195 55-59 19.865 29.215000000000003 27.85 23.07 60-64 19.831941179412794 29.500325113789827 27.23453208623018 23.4332016205672 65-69 20.435 28.7 27.51 23.355 70-74 20.231847280696698 29.453832400945846 27.15842897514274 23.15589134321472 75-79 19.869978329721622 29.538256376062677 27.304550758459744 23.28721453575596 80-84 20.074871314927467 28.867051422035043 27.338428742265897 23.719648520771592 85-89 20.379913104981306 29.215924017379002 27.23047388097403 23.173688996665657 90-94 20.18031555221638 28.915602304032056 27.4129727022289 23.491109441522664 95-99 20.159111377964575 28.880216151305916 26.82878014610227 24.131892324627238 100-104 20.253354696575204 28.84538353695173 27.09793711195674 23.803324654516324 105-109 20.28710048516981 28.559995998599508 27.62466863402191 23.528234882208775 110-114 20.66309946491974 28.604290643596542 27.074061109166376 23.65854878231735 115-119 20.86381400941978 28.590039082072348 26.650967030764605 23.89517987774326 120-124 20.01204033512266 28.32990518236091 27.582401043495707 24.07565343902072 125-129 20.555 28.595 27.229999999999997 23.62 130-134 20.79 28.599999999999998 26.735 23.875 135-139 20.830000000000002 28.799999999999997 26.375 23.995 140-144 20.25 28.375 26.924999999999997 24.45 145-149 20.653751814586773 28.667968163387897 26.43039495419733 24.247885067828 150-151 21.010505252626313 28.501750875437722 26.338169084542272 24.149574787393696 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.5 20 1.0 21 0.5 22 1.0 23 4.0 24 6.5 25 7.0 26 10.0 27 14.0 28 18.5 29 24.5 30 36.5 31 48.0 32 52.5 33 63.0 34 82.5 35 98.0 36 127.0 37 151.5 38 164.5 39 191.5 40 205.0 41 221.0 42 239.5 43 241.5 44 240.5 45 237.0 46 231.5 47 207.5 48 192.0 49 173.5 50 138.5 51 109.0 52 92.5 53 88.5 54 66.5 55 46.0 56 44.0 57 37.0 58 24.0 59 18.5 60 12.5 61 7.0 62 4.5 63 3.0 64 3.5 65 3.5 66 1.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.12 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.034999999999999996 65-69 0.0 70-74 13.305 75-79 10.015 80-84 3.8350000000000004 85-89 1.03 90-94 0.17500000000000002 95-99 0.06999999999999999 100-104 0.13999999999999999 105-109 0.034999999999999996 110-114 0.015 115-119 0.21 120-124 0.335 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.11499999999999999 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.42767295597484273 0.8500000000000001 3 0.10062893081761005 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.6499999999999999 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.2625000000000002 0.0 0.0 0.0 0.0 106-107 1.425 0.0 0.0 0.0 0.0 108-109 1.875 0.0 0.0 0.0 0.0 110-111 2.25 0.0 0.0 0.0 0.0 112-113 2.4749999999999996 0.0 0.0 0.0 0.0 114-115 2.6625 0.0 0.0 0.0 0.0 116-117 3.0 0.0 0.0 0.0 0.0 118-119 3.4 0.0 0.0 0.0 0.0 120-121 3.8375000000000004 0.0 0.0 0.0 0.0 122-123 4.25 0.0 0.0 0.0 0.0 124-125 4.699999999999999 0.0 0.0 0.0 0.0 126-127 5.074999999999999 0.0 0.0 0.0 0.0 128-129 5.675 0.0 0.0 0.0 0.0 130-131 6.2125 0.0 0.0 0.0 0.0 132-133 7.0625 0.0 0.0 0.0 0.0 134-135 7.7 0.0 0.0 0.0 0.0 136-137 8.3125 0.0 0.0 0.0 0.0 138-139 9.087499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTTGC 10 0.007267623 142.02501 9 >>END_MODULE SRR7230806 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230806_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.57825 33.0 33.0 34.0 32.0 34.0 2 32.95575 34.0 33.0 34.0 32.0 34.0 3 33.03775 34.0 33.0 34.0 32.0 34.0 4 32.97425 34.0 33.0 34.0 32.0 34.0 5 32.99225 34.0 33.0 34.0 32.0 34.0 6 37.15 38.0 38.0 38.0 37.0 38.0 7 37.12525 38.0 38.0 38.0 37.0 38.0 8 37.03475 38.0 38.0 38.0 37.0 38.0 9 36.97775 38.0 38.0 38.0 37.0 38.0 10-14 36.86595 38.0 38.0 38.0 36.2 38.0 15-19 37.0672 38.0 38.0 38.0 37.0 38.0 20-24 37.01185 38.0 38.0 38.0 37.0 38.0 25-29 36.9279 38.0 38.0 38.0 36.6 38.0 30-34 36.96925 38.0 38.0 38.0 37.0 38.0 35-39 36.704499999999996 38.0 38.0 38.0 35.6 38.0 40-44 36.411150000000006 38.0 38.0 38.0 34.6 38.0 45-49 36.6573 38.0 38.0 38.0 35.6 38.0 50-54 36.65259999999999 38.0 38.0 38.0 35.4 38.0 55-59 36.660900000000005 38.0 38.0 38.0 35.6 38.0 60-64 36.78305 38.0 38.0 38.0 36.0 38.0 65-69 36.7176 38.0 38.0 38.0 36.0 38.0 70-74 36.6566 38.0 38.0 38.0 36.0 38.0 75-79 36.6112 38.0 38.0 38.0 36.0 38.0 80-84 36.57075 38.0 38.0 38.0 36.0 38.0 85-89 36.57825 38.0 38.0 38.0 36.0 38.0 90-94 36.46490000000001 38.0 38.0 38.0 35.0 38.0 95-99 36.3146 38.0 38.0 38.0 34.6 38.0 100-104 35.571999999999996 38.0 37.2 38.0 30.4 38.0 105-109 35.89385 38.0 38.0 38.0 33.6 38.0 110-114 35.942499999999995 38.0 38.0 38.0 33.2 38.0 115-119 35.98605 38.0 38.0 38.0 33.6 38.0 120-124 35.65745 38.0 37.4 38.0 31.8 38.0 125-129 35.263850000000005 38.0 36.6 38.0 29.8 38.0 130-134 35.10625 38.0 36.0 38.0 29.0 38.0 135-139 34.7735 38.0 35.8 38.0 27.8 38.0 140-144 34.3377 38.0 35.2 38.0 26.6 38.0 145-149 33.7276 38.0 34.4 38.0 21.6 38.0 150-151 28.913375000000002 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 3.0 4 3.0 5 0.0 6 6.0 7 3.0 8 3.0 9 2.0 10 2.0 11 2.0 12 2.0 13 2.0 14 2.0 15 7.0 16 7.0 17 4.0 18 6.0 19 2.0 20 5.0 21 7.0 22 8.0 23 6.0 24 10.0 25 16.0 26 33.0 27 29.0 28 18.0 29 37.0 30 44.0 31 41.0 32 64.0 33 95.0 34 143.0 35 227.0 36 496.0 37 2652.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.14964610717897 19.792719919110212 13.725985844287159 23.33164812942366 2 27.425 23.799999999999997 31.25 17.525 3 21.325 27.35 31.2 20.125 4 23.95 35.075 22.5 18.475 5 24.075 37.175000000000004 21.175 17.575 6 20.175 38.0 22.875 18.95 7 19.25 17.974999999999998 41.375 21.4 8 19.975 24.85 27.875 27.3 9 22.925 24.75 27.900000000000002 24.425 10-14 24.038028521391045 27.935951963972975 26.304728546409805 21.72129096822617 15-19 23.765 27.944999999999997 27.61 20.68 20-24 23.14851881505204 28.312650120096077 27.301841473178545 21.23698959167334 25-29 23.345505477464858 27.997598919513784 27.76749537291781 20.889400230103547 30-34 23.451105995395856 28.240416374737265 27.704934440996897 20.60354318886998 35-39 23.30281654910201 27.930361698934412 27.39506728700786 21.371754464955725 40-44 23.370190623905536 28.27838094761595 27.677990693951067 20.673437734527443 45-49 23.768522226672005 26.77713255907089 28.649379255106126 20.80496595915098 50-54 23.554732469092546 27.21857950848391 28.239651634215928 20.987036388207617 55-59 23.538839084489407 28.116392046877348 27.815896228777483 20.52887263985576 60-64 23.44289359147531 27.740257141427787 27.880334183801093 20.936515083295813 65-69 23.90607790127165 27.525783518574148 27.385601281666165 21.182537298488036 70-74 24.27835309420181 28.14047726249437 27.25999299614788 20.321176647155937 75-79 23.608329995995195 27.698237885462557 28.033640368442132 20.65979175010012 80-84 23.677758318739052 27.8558919189392 28.011008256192145 20.4553415061296 85-89 24.048668135389544 27.94412177047867 27.47846985780092 20.528740236330865 90-94 23.89845784097737 27.808932505507713 27.95914279991989 20.333466853595034 95-99 23.218126344220476 27.734707147501624 28.569999499824938 20.47716700845296 100-104 23.97219165749725 26.84305291587476 28.73362008602581 20.451135340602182 105-109 23.43054374468511 27.742484117853035 28.077634935721075 20.749337201740783 110-114 23.875 28.265 27.63 20.23 115-119 24.675 27.29 28.16 19.875 120-124 24.183464212474366 27.62466863402191 28.054819186715353 20.137047966788376 125-129 24.776014815556337 27.08844286500826 28.31473046699034 19.82081185244507 130-134 24.474999999999998 28.13 27.575 19.82 135-139 24.998749562346823 27.42459860951333 27.399589856449758 20.17706197169009 140-144 25.315315315315317 27.887887887887885 27.297297297297295 19.4994994994995 145-149 25.111277819454862 28.177044261065266 26.926731682920728 19.78494623655914 150-151 27.231807951987996 27.19429857464366 26.431607901975497 19.142285571392847 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.5 15 1.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.5 21 2.0 22 1.0 23 0.5 24 1.0 25 2.5 26 4.5 27 5.5 28 5.0 29 9.5 30 13.0 31 17.5 32 26.5 33 31.5 34 49.0 35 63.0 36 77.0 37 104.0 38 134.5 39 168.0 40 190.0 41 210.0 42 249.5 43 265.0 44 254.0 45 257.5 46 260.0 47 254.0 48 237.0 49 210.0 50 174.0 51 139.5 52 112.0 53 98.5 54 95.0 55 75.5 56 50.5 57 40.0 58 30.5 59 20.0 60 14.0 61 10.0 62 10.5 63 9.0 64 5.0 65 2.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.075 15-19 0.0 20-24 0.08 25-29 0.045 30-34 0.09 35-39 0.055 40-44 0.065 45-49 0.12 50-54 0.105 55-59 0.165 60-64 0.055 65-69 0.13 70-74 0.055 75-79 0.12 80-84 0.075 85-89 0.13999999999999999 90-94 0.13999999999999999 95-99 0.034999999999999996 100-104 0.03 105-109 0.045 110-114 0.0 115-119 0.0 120-124 0.034999999999999996 125-129 0.105 130-134 0.0 135-139 0.034999999999999996 140-144 0.1 145-149 0.025 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47116595316041 98.75 2 0.4029211785444472 0.8 3 0.07554772097708386 0.22499999999999998 4 0.02518257365902795 0.1 5 0.02518257365902795 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.7749999999999999 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.2 0.0 0.0 0.0 0.0 104-105 1.3875000000000002 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.9500000000000002 0.0 0.0 0.0 0.0 110-111 2.3375 0.0 0.0 0.0 0.0 112-113 2.5875 0.0 0.0 0.0 0.0 114-115 2.7375 0.0 0.0 0.0 0.0 116-117 3.0375 0.0 0.0 0.0 0.0 118-119 3.4375 0.0 0.0 0.0 0.0 120-121 3.9000000000000004 0.0 0.0 0.0 0.0 122-123 4.362500000000001 0.0 0.0 0.0 0.0 124-125 4.824999999999999 0.0 0.0 0.0 0.0 126-127 5.199999999999999 0.0 0.0 0.0 0.0 128-129 5.775 0.0 0.0 0.0 0.0 130-131 6.3375 0.0 0.0 0.0 0.0 132-133 7.1375 0.0 0.0 0.0 0.0 134-135 7.775 0.0 0.0 0.0 0.0 136-137 8.3875 0.0 0.0 0.0 0.0 138-139 9.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACTCC 10 0.006830828 145.0 8 TTGAGCT 10 0.006830828 145.0 3 GAGCAGT 10 0.006830828 145.0 1 CTTGAGC 10 0.006830828 145.0 2 >>END_MODULE Read 726170 spots for SRR7230806.sra Written 726170 spots for SRR7230806.sra Read 726170 spots for SRR7230806.sra Written 726170 spots for SRR7230806.sra Read 726170 spots for SRR7230806.sra Written 726170 spots for SRR7230806.sra Read 726170 spots for SRR7230806.sra Written 726170 spots for SRR7230806.sra Read 726170 spots for SRR7230806.sra Written 726170 spots for SRR7230806.sra Read 726170 spots for SRR7230806.sra Written 726170 spots for SRR7230806.sra Read 726170 spots for SRR7230806.sra Written 726170 spots for SRR7230806.sra Read 726170 spots for SRR7230806.sra Written 726170 spots for SRR7230806.sra Read 726170 spots for SRR7230806.sra Written 726170 spots for SRR7230806.sra Read 726170 spots for SRR7230806.sra Written 726170 spots for SRR7230806.sra Read 726170 spots for SRR7230806.sra Written 726170 spots for SRR7230806.sra Read 726170 spots for SRR7230806.sra Written 726170 spots for SRR7230806.sra Read 726170 spots for SRR7230806.sra Written 726170 spots for SRR7230806.sra Read 726170 spots for SRR7230806.sra Written 726170 spots for SRR7230806.sra Read 726170 spots for SRR7230806.sra Written 726170 spots for SRR7230806.sra Read 726170 spots for SRR7230806.sra Written 726170 spots for SRR7230806.sra Read 726184 spots for SRR7230806.sra Written 726184 spots for SRR7230806.sra Read 726170 spots for SRR7230806.sra Written 726170 spots for SRR7230806.sra Read 726170 spots for SRR7230806.sra Written 726170 spots for SRR7230806.sra Read 726170 spots for SRR7230806.sra Written 726170 spots for SRR7230806.sra SRR ids: ['SRR7230806.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xe9i3o9w SRR7230806.sra spots: 14523414 blocks: [[1, 726170], [726171, 1452340], [1452341, 2178510], [2178511, 2904680], [2904681, 3630850], [3630851, 4357020], [4357021, 5083190], [5083191, 5809360], [5809361, 6535530], [6535531, 7261700], [7261701, 7987870], [7987871, 8714040], [8714041, 9440210], [9440211, 10166380], [10166381, 10892550], [10892551, 11618720], [11618721, 12344890], [12344891, 13071060], [13071061, 13797230], [13797231, 14523414]] SRR7230806 file size 4899808 SRR7230806 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230806 SRR7230806_1.fastq SRR7230806_2.fastq Input file: SRR7230806_1.fastq Paired file: SRR7230806_2.fastq trimmed: SRR7230806-trimmed-pair1.fastq, SRR7230806-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:05:48 2025 >> started Tue Feb 11 09:06:05 2025 >> done (17.070s) 14523414 read pairs processed; of these: 20547 ( 0.14%) short read pairs filtered out after trimming by size control 17806 ( 0.12%) empty read pairs filtered out after trimming by size control 14485061 (99.74%) read pairs available; of these: 6945241 (47.95%) trimmed read pairs available after processing 7539820 (52.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 1 0.00% 20 2 0.00% 21 5 0.00% 22 3 0.00% 23 10 0.00% 24 3 0.00% 25 2 0.00% 26 8 0.00% 27 6 0.00% 28 11 0.00% 29 10 0.00% 30 11 0.00% 31 12 0.00% 32 11 0.00% 33 8 0.00% 34 19 0.00% 35 13 0.00% 36 10 0.00% 37 18 0.00% 38 19 0.00% 39 21 0.00% 40 19 0.00% 41 23 0.00% 42 33 0.00% 43 25 0.00% 44 44 0.00% 45 63 0.00% 46 49 0.00% 47 56 0.00% 48 53 0.00% 49 75 0.00% 50 88 0.00% 51 76 0.00% 52 91 0.00% 53 104 0.00% 54 112 0.00% 55 129 0.00% 56 164 0.00% 57 190 0.00% 58 207 0.00% 59 249 0.00% 60 245 0.00% 61 339 0.00% 62 313 0.00% 63 374 0.00% 64 400 0.00% 65 482 0.00% 66 542 0.00% 67 584 0.00% 68 760 0.01% 69 1211 0.01% 70 1321 0.01% 71 1134 0.01% 72 1251 0.01% 73 1325 0.01% 74 1458 0.01% 75 1637 0.01% 76 1707 0.01% 77 1908 0.01% 78 2230 0.02% 79 2566 0.02% 80 2821 0.02% 81 3165 0.02% 82 3799 0.03% 83 4173 0.03% 84 5436 0.04% 85 6591 0.05% 86 6982 0.05% 87 7523 0.05% 88 7853 0.05% 89 8229 0.06% 90 8808 0.06% 91 9664 0.07% 92 10003 0.07% 93 10920 0.08% 94 11642 0.08% 95 12359 0.09% 96 13256 0.09% 97 13883 0.10% 98 14608 0.10% 99 15537 0.11% 100 16788 0.12% 101 17370 0.12% 102 18449 0.13% 103 19458 0.13% 104 20695 0.14% 105 22264 0.15% 106 23195 0.16% 107 23691 0.16% 108 24862 0.17% 109 26115 0.18% 110 26834 0.19% 111 28260 0.20% 112 29552 0.20% 113 30953 0.21% 114 32490 0.22% 115 33624 0.23% 116 34647 0.24% 117 35521 0.25% 118 36889 0.25% 119 37564 0.26% 120 39154 0.27% 121 40383 0.28% 122 42366 0.29% 123 44245 0.31% 124 45484 0.31% 125 47510 0.33% 126 49244 0.34% 127 49816 0.34% 128 51528 0.36% 129 53368 0.37% 130 55106 0.38% 131 56641 0.39% 132 59136 0.41% 133 62151 0.43% 134 64605 0.45% 135 68674 0.47% 136 70574 0.49% 137 74681 0.52% 138 77838 0.54% 139 81095 0.56% 140 83505 0.58% 141 90793 0.63% 142 96581 0.67% 143 106957 0.74% 144 120852 0.83% 145 138874 0.96% 146 172211 1.19% 147 214202 1.48% 148 328086 2.26% 149 603984 4.17% 150 3115279 21.51% 151 7539820 52.05% 14485061 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=35 prefix-density=0.28 prefix-fanout=2.4 sequence=TACGCTTGTAAGGATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=89.47 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.2 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=35 prefix-density=0.70 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=54.43 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.5 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACA SRR7230806 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:06:57 Started mapping on | Feb 11 09:06:57 Finished on | Feb 11 09:08:58 Mapping speed, Million of reads per hour | 430.96 Number of input reads | 14485061 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 13138094 Uniquely mapped reads % | 90.70% Average mapped length | 291.66 Number of splices: Total | 11630809 Number of splices: Annotated (sjdb) | 11357871 Number of splices: GT/AG | 11412506 Number of splices: GC/AG | 170982 Number of splices: AT/AC | 6818 Number of splices: Non-canonical | 40503 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.40 Insertion rate per base | 0.03% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 416052 % of reads mapped to multiple loci | 2.87% Number of reads mapped to too many loci | 51528 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.94% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 953578 953578 953578 N_multimapping 416052 416052 416052 N_noFeature 406533 12860626 507361 N_ambiguous 276474 1132 99262 UnstrandedReadsAssigned:12455087 PositiveStrandReadsAssigned:276336 NegativeStrandReadsAssigned:12531471 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7230806 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230806-trimmed-pair1.fastq SRR7230806-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,485,061 reads, 12,586,056 reads pseudoaligned [quant] estimated average fragment length: 228.559 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,206 rounds 52401 SRR7230806.ke.tsv 34699 SRR7230806.se.tsv 87100 total ==> SRR7230806.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.44 741 28.386 Potri.005G024800.1.v4.1 1035 807.441 254 21.5759 Potri.004G059700.1.v4.1 961 733.465 9 0.841607 Potri.007G009000.2.v4.1 1416 1188.44 0 0 Potri.003G141000.2.v4.1 2943 2715.44 860 21.7222 Potri.016G087400.1.v4.1 270 88.0505 979 762.601 Potri.015G069301.1.v4.1 564 341.287 0 0 Potri.010G195200.1.v4.1 1773 1545.44 269 11.9384 Potri.012G127500.1.v4.1 977 749.455 79 7.22982 ==> SRR7230806.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1104 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 372 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 11 SRR7230806 completed mapping pipeline successfully