Starting /dee2/code/volunteer_pipeline.sh SRR7230807 current disk space = 3055428521984 free memory = 1578958160 SRR7230807 SRAfilesize 1a84501aa4e85544ed48bb421257f06f SRR7230807.sra SRR7230807.sra file validated SRR7230807 is paired end SRR7230807 is conventional basespace SRR7230807 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230807_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.50075 34.0 34.0 34.0 33.0 34.0 2 33.547 34.0 34.0 34.0 33.0 34.0 3 33.59925 34.0 34.0 34.0 33.0 34.0 4 33.5825 34.0 34.0 34.0 33.0 34.0 5 33.5565 34.0 34.0 34.0 33.0 34.0 6 37.2805 38.0 38.0 38.0 36.0 38.0 7 37.37275 38.0 38.0 38.0 37.0 38.0 8 37.43075 38.0 38.0 38.0 37.0 38.0 9 37.505 38.0 38.0 38.0 38.0 38.0 10-14 37.462300000000006 38.0 38.0 38.0 37.4 38.0 15-19 37.45455 38.0 38.0 38.0 37.8 38.0 20-24 37.313849999999995 38.0 38.0 38.0 37.4 38.0 25-29 37.1007 38.0 38.0 38.0 36.2 38.0 30-34 37.0588 38.0 38.0 38.0 36.2 38.0 35-39 36.874399999999994 38.0 38.0 38.0 35.6 38.0 40-44 36.6357 38.0 38.0 38.0 35.0 38.0 45-49 36.6331 38.0 37.8 38.0 34.4 38.0 50-54 36.7811 38.0 37.8 38.0 35.2 38.0 55-59 36.973299999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.928549999999994 38.0 38.0 38.0 36.0 38.0 65-69 36.94525 38.0 38.0 38.0 36.0 38.0 70-74 32.534800000000004 38.0 29.6 38.0 15.4 38.0 75-79 33.362700000000004 38.0 36.2 38.0 14.4 38.0 80-84 35.60795 38.0 37.8 38.0 30.6 38.0 85-89 36.54055 38.0 38.0 38.0 34.6 38.0 90-94 36.7406 38.0 38.0 38.0 35.2 38.0 95-99 36.69465 38.0 38.0 38.0 35.0 38.0 100-104 36.54455 38.0 38.0 38.0 34.4 38.0 105-109 36.44825 38.0 38.0 38.0 34.2 38.0 110-114 36.23305 38.0 37.8 38.0 33.4 38.0 115-119 35.34885 38.0 36.6 38.0 29.4 38.0 120-124 35.563250000000004 38.0 36.8 38.0 31.0 38.0 125-129 35.3696 38.0 36.0 38.0 30.2 38.0 130-134 34.7096 38.0 35.2 38.0 25.2 38.0 135-139 35.0092 38.0 35.8 38.0 28.2 38.0 140-144 34.185050000000004 38.0 34.6 38.0 24.4 38.0 145-149 33.69115 38.0 33.0 38.0 23.8 38.0 150-151 30.122374999999998 35.5 28.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 2.0 12 1.0 13 1.0 14 2.0 15 2.0 16 3.0 17 0.0 18 9.0 19 2.0 20 7.0 21 5.0 22 7.0 23 7.0 24 19.0 25 9.0 26 10.0 27 19.0 28 30.0 29 37.0 30 64.0 31 57.0 32 93.0 33 156.0 34 265.0 35 433.0 36 824.0 37 1935.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.3088272068017 19.10477619404851 5.776444111027757 39.80995248812203 2 15.525 17.75 49.325 17.4 3 13.525 24.9 33.125 28.449999999999996 4 19.475 31.85 27.0 21.675 5 19.75 36.55 25.525 18.175 6 16.125 37.05 26.525 20.3 7 12.775 23.5 44.65 19.075 8 15.425 23.05 34.875 26.650000000000002 9 16.3 20.4 37.3 26.0 10-14 19.689999999999998 29.675 27.08 23.555 15-19 18.72593629681484 28.841442072103607 28.926446322316117 23.50617530876544 20-24 19.605 27.99 28.935 23.47 25-29 19.33 29.849999999999998 27.73 23.09 30-34 19.575 29.37 27.865000000000002 23.189999999999998 35-39 19.72465581977472 29.181476846057574 27.88485607008761 23.2090112640801 40-44 19.963902536849492 29.324175273237742 27.71984357765968 22.992078612253085 45-49 19.760868477662715 28.470658862374304 28.620741407774275 23.147731252188702 50-54 19.725 28.29 28.37 23.615 55-59 19.875 28.98 27.91 23.235 60-64 19.485 28.07 28.58 23.865 65-69 19.585 28.915000000000003 28.444999999999997 23.055 70-74 19.872048915812716 28.78333238974127 28.16056162599785 23.18405706844817 75-79 20.079925548803853 29.068812612908523 27.68927574314337 23.16198609514425 80-84 20.08953841403798 29.033088046107135 27.63340709103072 23.243966448824168 85-89 20.239111870196414 29.48209172652836 27.482794996734818 22.796001406540416 90-94 19.49 29.03 28.050000000000004 23.43 95-99 20.03 28.515 28.225 23.23 100-104 21.13 28.439999999999998 27.644999999999996 22.785 105-109 20.715 28.325 27.61 23.35 110-114 20.845 28.74 26.97 23.445 115-119 21.075 28.575 26.96 23.39 120-124 20.605 28.7 27.305 23.39 125-129 20.49 28.465 27.245 23.799999999999997 130-134 20.945 29.275000000000002 26.06 23.72 135-139 21.02 29.075 26.650000000000002 23.255 140-144 20.985 28.82 26.515 23.68 145-149 20.995 28.835 26.32 23.849999999999998 150-151 19.775000000000002 29.4 27.05 23.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.5 13 1.0 14 1.5 15 1.5 16 1.0 17 0.5 18 1.0 19 1.5 20 2.5 21 3.5 22 3.0 23 3.5 24 5.0 25 7.5 26 8.5 27 12.0 28 19.0 29 24.5 30 31.0 31 50.5 32 69.5 33 72.0 34 92.5 35 114.0 36 114.5 37 129.5 38 147.5 39 173.0 40 216.5 41 238.5 42 256.0 43 266.5 44 257.0 45 243.5 46 230.0 47 219.5 48 187.0 49 163.0 50 154.0 51 126.0 52 101.5 53 78.0 54 48.0 55 33.5 56 29.0 57 20.5 58 13.0 59 7.0 60 5.0 61 5.0 62 2.5 63 1.5 64 0.5 65 0.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.125 40-44 0.27 45-49 0.055 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 11.684999999999999 75-79 8.665000000000001 80-84 2.835 85-89 0.46499999999999997 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.5510930350788 96.925 2 1.2963904422979156 2.55 3 0.0762582613116421 0.22499999999999998 4 0.0762582613116421 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 1.0375 0.0 0.0 0.0 0.0 94-95 1.2875 0.0 0.0 0.0 0.0 96-97 1.6 0.0 0.0 0.0 0.0 98-99 1.7875 0.0 0.0 0.0 0.0 100-101 2.0125 0.0 0.0 0.0 0.0 102-103 2.2875 0.0 0.0 0.0 0.0 104-105 2.6625 0.0 0.0 0.0 0.0 106-107 2.8875 0.0 0.0 0.0 0.0 108-109 3.2125 0.0 0.0 0.0 0.0 110-111 3.7125000000000004 0.0 0.0 0.0 0.0 112-113 4.0625 0.0 0.0 0.0 0.0 114-115 4.6 0.0 0.0 0.0 0.0 116-117 5.1125 0.0 0.0 0.0 0.0 118-119 5.75 0.0 0.0 0.0 0.0 120-121 6.4375 0.0 0.0 0.0 0.0 122-123 7.0125 0.0 0.0 0.0 0.0 124-125 7.5625 0.0 0.0 0.0 0.0 126-127 8.2375 0.0 0.0 0.0 0.0 128-129 8.9 0.0 0.0 0.0 0.0 130-131 9.587499999999999 0.0 0.0 0.0 0.0 132-133 10.1 0.0 0.0 0.0 0.0 134-135 10.675 0.0 0.0 0.0 0.0 136-137 11.425 0.0 0.0 0.0 0.0 138-139 12.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7230807 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230807_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.914 34.0 33.0 34.0 32.0 34.0 2 33.218 34.0 33.0 34.0 33.0 34.0 3 33.23125 34.0 33.0 34.0 33.0 34.0 4 33.177 34.0 33.0 34.0 33.0 34.0 5 33.2705 34.0 33.0 34.0 33.0 34.0 6 37.3145 38.0 38.0 38.0 37.0 38.0 7 37.3885 38.0 38.0 38.0 37.0 38.0 8 37.3315 38.0 38.0 38.0 38.0 38.0 9 37.386 38.0 38.0 38.0 38.0 38.0 10-14 37.03294999999999 38.0 38.0 38.0 36.8 38.0 15-19 37.33435 38.0 38.0 38.0 38.0 38.0 20-24 37.33905 38.0 38.0 38.0 38.0 38.0 25-29 37.346849999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.3397 38.0 38.0 38.0 38.0 38.0 35-39 37.12385 38.0 38.0 38.0 37.4 38.0 40-44 37.1755 38.0 38.0 38.0 37.0 38.0 45-49 37.162749999999996 38.0 38.0 38.0 37.2 38.0 50-54 37.2443 38.0 38.0 38.0 37.8 38.0 55-59 36.99675 38.0 38.0 38.0 37.0 38.0 60-64 37.1729 38.0 38.0 38.0 37.2 38.0 65-69 37.09325 38.0 38.0 38.0 37.2 38.0 70-74 36.94545 38.0 38.0 38.0 37.0 38.0 75-79 37.03805 38.0 38.0 38.0 36.8 38.0 80-84 37.0085 38.0 38.0 38.0 37.0 38.0 85-89 37.014300000000006 38.0 38.0 38.0 36.8 38.0 90-94 36.9524 38.0 38.0 38.0 36.4 38.0 95-99 36.825199999999995 38.0 38.0 38.0 35.8 38.0 100-104 36.635549999999995 38.0 38.0 38.0 35.4 38.0 105-109 36.591750000000005 38.0 38.0 38.0 35.0 38.0 110-114 36.481700000000004 38.0 38.0 38.0 35.0 38.0 115-119 36.368649999999995 38.0 38.0 38.0 34.0 38.0 120-124 36.021100000000004 38.0 38.0 38.0 33.6 38.0 125-129 35.9433 38.0 38.0 38.0 34.0 38.0 130-134 35.67909999999999 38.0 37.6 38.0 33.0 38.0 135-139 35.317499999999995 38.0 36.8 38.0 30.6 38.0 140-144 34.70095 38.0 36.0 38.0 28.8 38.0 145-149 33.12385 38.0 33.6 38.0 19.6 38.0 150-151 27.96625 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 7.0 4 2.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 2.0 14 1.0 15 1.0 16 2.0 17 5.0 18 5.0 19 7.0 20 9.0 21 7.0 22 11.0 23 6.0 24 14.0 25 10.0 26 16.0 27 14.0 28 19.0 29 20.0 30 36.0 31 34.0 32 55.0 33 78.0 34 109.0 35 202.0 36 518.0 37 2803.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.53507669097309 25.39602715614785 7.794820216243399 30.274075936635654 2 22.375 23.1 40.849999999999994 13.675 3 16.875 27.925 35.55 19.650000000000002 4 20.775 36.325 24.425 18.475 5 22.575 39.4 21.55 16.475 6 18.375 39.95 23.125 18.55 7 19.025 19.950000000000003 40.75 20.275000000000002 8 16.725 23.400000000000002 31.525 28.349999999999998 9 21.05 22.75 31.1 25.1 10-14 23.005 28.26 27.045 21.69 15-19 22.42 28.345 28.175 21.060000000000002 20-24 22.845 28.055000000000003 28.105000000000004 20.995 25-29 23.335 28.660000000000004 27.700000000000003 20.305 30-34 22.705000000000002 28.115000000000002 28.199999999999996 20.979999999999997 35-39 22.52 27.6 28.744999999999997 21.135 40-44 22.97 28.875 27.810000000000002 20.345 45-49 22.265625 27.879607371794872 28.891225961538463 20.963541666666664 50-54 23.253717890941868 27.655099894847528 28.200891292373942 20.890290921836662 55-59 23.42432757928543 28.19650742673625 27.995784825371338 20.383380168606983 60-64 22.57 28.18 28.185 21.065 65-69 23.00490637829178 27.901271653149095 27.71102433163112 21.382797636928004 70-74 23.168098036261362 28.778062377580234 27.56265380945206 20.491185776706345 75-79 23.29 27.615000000000002 27.860000000000003 21.235 80-84 22.625 27.750000000000004 28.17 21.455 85-89 23.03 27.860000000000003 27.61 21.5 90-94 23.669999999999998 27.689999999999998 28.08 20.560000000000002 95-99 23.25 28.305000000000003 28.21 20.235 100-104 23.195 28.335 28.065 20.405 105-109 23.91 27.66 27.925 20.505000000000003 110-114 23.669999999999998 28.16 28.194999999999997 19.975 115-119 24.135 28.365000000000002 27.415 20.085 120-124 24.474999999999998 28.46 27.76 19.305 125-129 25.205 28.110000000000003 27.250000000000004 19.435 130-134 24.95 27.73 27.82 19.5 135-139 25.419999999999998 28.249999999999996 27.175 19.155 140-144 25.330000000000002 28.255000000000003 26.924999999999997 19.49 145-149 25.525 28.355000000000004 27.425 18.695 150-151 26.137500000000003 27.962500000000002 27.2625 18.637500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 1.0 23 2.5 24 1.5 25 1.0 26 2.0 27 5.5 28 9.0 29 15.0 30 17.5 31 19.5 32 28.5 33 42.5 34 61.0 35 77.0 36 90.5 37 118.5 38 138.5 39 165.5 40 207.5 41 234.5 42 255.0 43 262.5 44 294.0 45 298.5 46 246.5 47 232.5 48 236.0 49 213.0 50 162.0 51 118.5 52 105.0 53 79.5 54 67.0 55 59.5 56 35.0 57 25.5 58 22.0 59 12.0 60 10.0 61 8.5 62 4.0 63 3.0 64 2.0 65 2.0 66 1.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.16 50-54 0.145 55-59 0.36 60-64 0.0 65-69 0.13 70-74 0.445 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.31503701812612 96.275 2 1.4296655603778403 2.8000000000000003 3 0.17870819504723004 0.525 4 0.051059484299208584 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025529742149604292 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 1.0375 0.0 0.0 0.0 0.0 94-95 1.2875 0.0 0.0 0.0 0.0 96-97 1.6375000000000002 0.0 0.0 0.0 0.0 98-99 1.85 0.0 0.0 0.0 0.0 100-101 2.0875 0.0 0.0 0.0 0.0 102-103 2.3625 0.0 0.0 0.0 0.0 104-105 2.7249999999999996 0.0 0.0 0.0 0.0 106-107 2.9375 0.0 0.0 0.0 0.0 108-109 3.2625 0.0 0.0 0.0 0.0 110-111 3.775 0.0 0.0 0.0 0.0 112-113 4.137499999999999 0.0 0.0 0.0 0.0 114-115 4.6875 0.0 0.0 0.0 0.0 116-117 5.225 0.0 0.0 0.0 0.0 118-119 5.8875 0.0 0.0 0.0 0.0 120-121 6.55 0.0 0.0 0.0 0.0 122-123 7.1125 0.0 0.0 0.0 0.0 124-125 7.6625 0.0 0.0 0.0 0.0 126-127 8.337499999999999 0.0 0.0 0.0 0.0 128-129 9.05 0.0 0.0 0.0 0.0 130-131 9.7375 0.0 0.0 0.0 0.0 132-133 10.25 0.0 0.0 0.0 0.0 134-135 10.85 0.0 0.0 0.0 0.0 136-137 11.625 0.0 0.0 0.0 0.0 138-139 12.350000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACATTG 10 0.0068892627 144.5875 3 CAGATCG 10 0.0068892627 144.5875 145 TTGGAGC 10 0.0068892627 144.5875 6 >>END_MODULE Read 737252 spots for SRR7230807.sra Written 737252 spots for SRR7230807.sra Read 737252 spots for SRR7230807.sra Written 737252 spots for SRR7230807.sra Read 737252 spots for SRR7230807.sra Written 737252 spots for SRR7230807.sra Read 737252 spots for SRR7230807.sra Written 737252 spots for SRR7230807.sra Read 737252 spots for SRR7230807.sra Written 737252 spots for SRR7230807.sra Read 737252 spots for SRR7230807.sra Written 737252 spots for SRR7230807.sra Read 737252 spots for SRR7230807.sra Written 737252 spots for SRR7230807.sra Read 737252 spots for SRR7230807.sra Written 737252 spots for SRR7230807.sra Read 737252 spots for SRR7230807.sra Written 737252 spots for SRR7230807.sra Read 737252 spots for SRR7230807.sra Written 737252 spots for SRR7230807.sra Read 737252 spots for SRR7230807.sra Written 737252 spots for SRR7230807.sra Read 737256 spots for SRR7230807.sra Written 737256 spots for SRR7230807.sra Read 737252 spots for SRR7230807.sra Written 737252 spots for SRR7230807.sra Read 737252 spots for SRR7230807.sra Written 737252 spots for SRR7230807.sra Read 737252 spots for SRR7230807.sra Written 737252 spots for SRR7230807.sra Read 737252 spots for SRR7230807.sra Written 737252 spots for SRR7230807.sra Read 737252 spots for SRR7230807.sra Written 737252 spots for SRR7230807.sra Read 737252 spots for SRR7230807.sra Written 737252 spots for SRR7230807.sra Read 737252 spots for SRR7230807.sra Written 737252 spots for SRR7230807.sra Read 737252 spots for SRR7230807.sra Written 737252 spots for SRR7230807.sra SRR ids: ['SRR7230807.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ytlp9sze SRR7230807.sra spots: 14745044 blocks: [[1, 737252], [737253, 1474504], [1474505, 2211756], [2211757, 2949008], [2949009, 3686260], [3686261, 4423512], [4423513, 5160764], [5160765, 5898016], [5898017, 6635268], [6635269, 7372520], [7372521, 8109772], [8109773, 8847024], [8847025, 9584276], [9584277, 10321528], [10321529, 11058780], [11058781, 11796032], [11796033, 12533284], [12533285, 13270536], [13270537, 14007788], [14007789, 14745044]] SRR7230807 file size 4974911 SRR7230807 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230807 SRR7230807_1.fastq SRR7230807_2.fastq Input file: SRR7230807_1.fastq Paired file: SRR7230807_2.fastq trimmed: SRR7230807-trimmed-pair1.fastq, SRR7230807-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:08:54 2025 >> started Tue Feb 11 09:09:10 2025 >> done (15.732s) 14745044 read pairs processed; of these: 14211 ( 0.10%) short read pairs filtered out after trimming by size control 27617 ( 0.19%) empty read pairs filtered out after trimming by size control 14703216 (99.72%) read pairs available; of these: 7162955 (48.72%) trimmed read pairs available after processing 7540261 (51.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 25 0.00% 19 19 0.00% 20 26 0.00% 21 16 0.00% 22 25 0.00% 23 26 0.00% 24 27 0.00% 25 31 0.00% 26 33 0.00% 27 19 0.00% 28 28 0.00% 29 35 0.00% 30 35 0.00% 31 38 0.00% 32 21 0.00% 33 24 0.00% 34 31 0.00% 35 33 0.00% 36 35 0.00% 37 54 0.00% 38 52 0.00% 39 48 0.00% 40 53 0.00% 41 35 0.00% 42 55 0.00% 43 78 0.00% 44 83 0.00% 45 96 0.00% 46 108 0.00% 47 118 0.00% 48 136 0.00% 49 157 0.00% 50 191 0.00% 51 192 0.00% 52 196 0.00% 53 261 0.00% 54 300 0.00% 55 290 0.00% 56 310 0.00% 57 343 0.00% 58 418 0.00% 59 523 0.00% 60 590 0.00% 61 642 0.00% 62 784 0.01% 63 837 0.01% 64 907 0.01% 65 1085 0.01% 66 1155 0.01% 67 1407 0.01% 68 1489 0.01% 69 2455 0.02% 70 2659 0.02% 71 2332 0.02% 72 2583 0.02% 73 2617 0.02% 74 3107 0.02% 75 3342 0.02% 76 3535 0.02% 77 3921 0.03% 78 4503 0.03% 79 4924 0.03% 80 5555 0.04% 81 6075 0.04% 82 7009 0.05% 83 7831 0.05% 84 9321 0.06% 85 10234 0.07% 86 11453 0.08% 87 11901 0.08% 88 12884 0.09% 89 13348 0.09% 90 14655 0.10% 91 15596 0.11% 92 16458 0.11% 93 18207 0.12% 94 18865 0.13% 95 20059 0.14% 96 21016 0.14% 97 21793 0.15% 98 22954 0.16% 99 24041 0.16% 100 25106 0.17% 101 26094 0.18% 102 27592 0.19% 103 28509 0.19% 104 30279 0.21% 105 31245 0.21% 106 32135 0.22% 107 32647 0.22% 108 34166 0.23% 109 34960 0.24% 110 35672 0.24% 111 36985 0.25% 112 38802 0.26% 113 39808 0.27% 114 40564 0.28% 115 41969 0.29% 116 43187 0.29% 117 43542 0.30% 118 44335 0.30% 119 45371 0.31% 120 46580 0.32% 121 47143 0.32% 122 49179 0.33% 123 50585 0.34% 124 51273 0.35% 125 51938 0.35% 126 53484 0.36% 127 54000 0.37% 128 55403 0.38% 129 57131 0.39% 130 57627 0.39% 131 58741 0.40% 132 61476 0.42% 133 62787 0.43% 134 65512 0.45% 135 67404 0.46% 136 69251 0.47% 137 71175 0.48% 138 73148 0.50% 139 77513 0.53% 140 81011 0.55% 141 86565 0.59% 142 91392 0.62% 143 99310 0.68% 144 112976 0.77% 145 127404 0.87% 146 153693 1.05% 147 199080 1.35% 148 282789 1.92% 149 544341 3.70% 150 3151323 21.43% 151 7540261 51.28% 14703216 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=21 prefix-density=0.49 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=36.82 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=7.1 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=15 prefix-density=0.49 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=58.55 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.1 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGTATGCTTTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR7230807 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:09:59 Started mapping on | Feb 11 09:10:00 Finished on | Feb 11 09:11:41 Mapping speed, Million of reads per hour | 524.08 Number of input reads | 14703216 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 13751162 Uniquely mapped reads % | 93.52% Average mapped length | 289.81 Number of splices: Total | 13256996 Number of splices: Annotated (sjdb) | 12941004 Number of splices: GT/AG | 12996257 Number of splices: GC/AG | 213473 Number of splices: AT/AC | 7752 Number of splices: Non-canonical | 39514 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 374272 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 113196 % of reads mapped to too many loci | 0.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.99% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 594560 594560 594560 N_multimapping 374272 374272 374272 N_noFeature 567712 13474920 686176 N_ambiguous 251685 880 93425 UnstrandedReadsAssigned:12931765 PositiveStrandReadsAssigned:275362 NegativeStrandReadsAssigned:12971561 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7230807 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230807-trimmed-pair1.fastq SRR7230807-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,703,216 reads, 13,045,236 reads pseudoaligned [quant] estimated average fragment length: 244.256 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52401 SRR7230807.ke.tsv 34699 SRR7230807.se.tsv 87100 total ==> SRR7230807.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.74 405 16.0028 Potri.005G024800.1.v4.1 1035 791.744 144 12.7543 Potri.004G059700.1.v4.1 961 717.833 22 2.1492 Potri.007G009000.2.v4.1 1416 1172.74 0 0 Potri.003G141000.2.v4.1 2943 2699.74 748.987 19.4549 Potri.016G087400.1.v4.1 270 95.3595 736.169 541.366 Potri.015G069301.1.v4.1 564 332.092 0 0 Potri.010G195200.1.v4.1 1773 1529.74 35 1.60445 Potri.012G127500.1.v4.1 977 733.8 221 21.1199 ==> SRR7230807.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 918 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 281 Potri.001G212900.v4.1 64 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7230807 completed mapping pipeline successfully