Starting /dee2/code/volunteer_pipeline.sh SRR7230808 current disk space = 3055786926080 free memory = 1472192864 SRR7230808 SRAfilesize cddca98a63ea1c686fecb6dabf3cee5e SRR7230808.sra SRR7230808.sra file validated SRR7230808 is paired end SRR7230808 is conventional basespace SRR7230808 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230808_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.49925 34.0 34.0 34.0 33.0 34.0 2 33.53175 34.0 34.0 34.0 33.0 34.0 3 33.62475 34.0 34.0 34.0 33.0 34.0 4 33.57925 34.0 34.0 34.0 33.0 34.0 5 33.51425 34.0 34.0 34.0 33.0 34.0 6 37.2145 38.0 38.0 38.0 36.0 38.0 7 37.35975 38.0 38.0 38.0 37.0 38.0 8 37.396 38.0 38.0 38.0 37.0 38.0 9 37.4565 38.0 38.0 38.0 37.0 38.0 10-14 37.460750000000004 38.0 38.0 38.0 37.6 38.0 15-19 37.457300000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.3044 38.0 38.0 38.0 37.4 38.0 25-29 37.10979999999999 38.0 38.0 38.0 36.2 38.0 30-34 36.984 38.0 38.0 38.0 35.8 38.0 35-39 36.9195 38.0 38.0 38.0 36.0 38.0 40-44 36.6359 38.0 38.0 38.0 35.0 38.0 45-49 36.68390000000001 38.0 37.8 38.0 34.4 38.0 50-54 36.8696 38.0 38.0 38.0 35.2 38.0 55-59 36.94799999999999 38.0 38.0 38.0 35.8 38.0 60-64 36.9102 38.0 38.0 38.0 36.0 38.0 65-69 36.9874 38.0 38.0 38.0 36.0 38.0 70-74 33.334649999999996 38.0 35.4 38.0 15.4 38.0 75-79 34.08365 38.0 37.2 38.0 25.0 38.0 80-84 35.88455 38.0 38.0 38.0 31.8 38.0 85-89 36.634249999999994 38.0 38.0 38.0 35.0 38.0 90-94 36.70885 38.0 38.0 38.0 35.2 38.0 95-99 36.69615 38.0 38.0 38.0 35.2 38.0 100-104 36.538850000000004 38.0 38.0 38.0 34.4 38.0 105-109 36.39885 38.0 38.0 38.0 34.0 38.0 110-114 36.173 38.0 37.8 38.0 33.0 38.0 115-119 35.4011 38.0 36.6 38.0 29.4 38.0 120-124 35.652300000000004 38.0 36.8 38.0 31.2 38.0 125-129 35.19915 38.0 35.8 38.0 29.0 38.0 130-134 34.8106 38.0 35.2 38.0 27.6 38.0 135-139 35.10659999999999 38.0 36.0 38.0 29.2 38.0 140-144 34.3497 38.0 35.4 38.0 25.0 38.0 145-149 33.8993 38.0 33.4 38.0 25.6 38.0 150-151 30.169875 35.5 27.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 1.0 9 3.0 10 2.0 11 2.0 12 1.0 13 3.0 14 0.0 15 1.0 16 1.0 17 3.0 18 4.0 19 3.0 20 6.0 21 5.0 22 7.0 23 5.0 24 13.0 25 19.0 26 15.0 27 20.0 28 30.0 29 43.0 30 38.0 31 56.0 32 81.0 33 154.0 34 230.0 35 374.0 36 786.0 37 2092.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.900000000000006 17.1 8.275 34.725 2 19.35 17.7 40.125 22.825 3 16.875 26.650000000000002 28.375 28.1 4 19.8 32.2 25.1 22.900000000000002 5 20.75 36.6 24.7 17.95 6 16.75 36.825 26.474999999999998 19.950000000000003 7 13.825000000000001 24.575 43.775 17.825 8 15.975 23.849999999999998 32.525 27.650000000000002 9 16.275000000000002 23.3 34.449999999999996 25.974999999999998 10-14 19.744999999999997 29.805 27.35 23.1 15-19 19.235961798089903 29.44647232361618 27.906395319765988 23.411170558527928 20-24 19.439999999999998 29.360000000000003 27.810000000000002 23.39 25-29 19.56 29.445 27.565 23.43 30-34 19.37 29.020000000000003 28.01 23.599999999999998 35-39 19.244640352634743 29.197555600080143 27.915247445401725 23.642556601883392 40-44 19.863426390841536 29.614380397670214 27.54067081743322 22.98152239405503 45-49 19.82288487516886 29.274028118276878 28.053234602491617 22.84985240406264 50-54 19.805 29.255 27.465 23.474999999999998 55-59 19.265 29.455 27.785 23.494999999999997 60-64 19.885 29.360000000000003 27.450000000000003 23.305 65-69 20.04 28.994999999999997 27.794999999999998 23.169999999999998 70-74 19.99889569874662 29.473800452763516 26.867649494782174 23.65965435370769 75-79 19.588680663695428 29.02325081887988 27.83117650217473 23.556892015249957 80-84 19.217409072333467 29.173477727829994 28.116060482223133 23.493052717613406 85-89 20.409494655492548 29.08616450042656 27.234405580368342 23.26993526371255 90-94 20.1 28.565 28.1 23.235 95-99 19.545 28.775000000000002 28.29 23.39 100-104 20.52 28.925 27.405 23.150000000000002 105-109 20.3 29.265 26.889999999999997 23.544999999999998 110-114 20.455000000000002 28.660000000000004 27.605 23.28 115-119 20.41 28.985 27.63 22.975 120-124 20.669999999999998 28.749999999999996 27.605 22.975 125-129 20.79 28.715000000000003 27.57 22.925 130-134 20.330000000000002 29.015 27.334999999999997 23.32 135-139 20.395 28.915000000000003 27.38 23.31 140-144 20.985 28.525 27.325 23.165 145-149 20.560000000000002 28.194999999999997 27.944999999999997 23.3 150-151 19.9125 28.025 27.575 24.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 1.0 7 1.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.5 17 1.5 18 0.5 19 1.0 20 1.5 21 1.5 22 2.0 23 3.5 24 5.0 25 6.5 26 11.5 27 15.0 28 14.5 29 20.0 30 31.0 31 37.0 32 43.5 33 58.0 34 80.0 35 99.0 36 121.0 37 143.0 38 158.5 39 176.0 40 200.5 41 222.0 42 245.0 43 278.0 44 292.0 45 264.5 46 241.5 47 231.0 48 198.5 49 180.5 50 149.0 51 107.5 52 99.0 53 76.0 54 54.0 55 38.5 56 19.5 57 16.5 58 14.5 59 12.0 60 6.5 61 3.5 62 3.5 63 3.0 64 2.0 65 0.5 66 0.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.18 40-44 0.42 45-49 0.065 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 9.445 75-79 6.885 80-84 2.12 85-89 0.365 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.13965341488277 96.275 2 1.783893985728848 3.5000000000000004 3 0.0764525993883792 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7124999999999999 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 0.9625 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.2375 0.0 0.0 0.0 0.0 112-113 1.2999999999999998 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.0999999999999996 0.0 0.0 0.0 0.0 122-123 2.3 0.0 0.0 0.0 0.0 124-125 2.575 0.0 0.0 0.0 0.0 126-127 2.875 0.0 0.0 0.0 0.0 128-129 3.05 0.0 0.0 0.0 0.0 130-131 3.275 0.0 0.0 0.0 0.0 132-133 3.5625 0.0 0.0 0.0 0.0 134-135 3.7875 0.0 0.0 0.0 0.0 136-137 4.1875 0.0 0.0 0.0 0.0 138-139 4.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7230808 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230808_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6915 33.0 33.0 34.0 32.0 34.0 2 32.9295 34.0 33.0 34.0 32.0 34.0 3 32.94675 34.0 33.0 34.0 32.0 34.0 4 32.8905 34.0 33.0 34.0 32.0 34.0 5 32.9515 34.0 33.0 34.0 32.0 34.0 6 37.05275 38.0 38.0 38.0 37.0 38.0 7 36.95075 38.0 38.0 38.0 37.0 38.0 8 36.98525 38.0 38.0 38.0 37.0 38.0 9 36.953 38.0 38.0 38.0 37.0 38.0 10-14 36.6983 38.0 38.0 38.0 35.6 38.0 15-19 37.00705000000001 38.0 38.0 38.0 36.8 38.0 20-24 37.0176 38.0 38.0 38.0 37.0 38.0 25-29 37.0169 38.0 38.0 38.0 37.0 38.0 30-34 36.98115 38.0 38.0 38.0 37.0 38.0 35-39 36.780550000000005 38.0 38.0 38.0 36.2 38.0 40-44 36.76595 38.0 38.0 38.0 36.0 38.0 45-49 36.7669 38.0 38.0 38.0 36.2 38.0 50-54 36.837450000000004 38.0 38.0 38.0 36.8 38.0 55-59 36.625299999999996 38.0 38.0 38.0 35.8 38.0 60-64 36.7378 38.0 38.0 38.0 36.0 38.0 65-69 36.713 38.0 38.0 38.0 36.2 38.0 70-74 36.605599999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.64625 38.0 38.0 38.0 35.8 38.0 80-84 36.64704999999999 38.0 38.0 38.0 35.8 38.0 85-89 36.5821 38.0 38.0 38.0 35.8 38.0 90-94 36.51365 38.0 38.0 38.0 35.0 38.0 95-99 36.4567 38.0 38.0 38.0 35.0 38.0 100-104 36.287400000000005 38.0 38.0 38.0 34.4 38.0 105-109 36.161950000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.11065 38.0 38.0 38.0 34.0 38.0 115-119 35.91875 38.0 38.0 38.0 33.4 38.0 120-124 35.65345 38.0 38.0 38.0 32.2 38.0 125-129 35.42975 38.0 37.2 38.0 31.0 38.0 130-134 35.2435 38.0 37.0 38.0 31.0 38.0 135-139 34.88654999999999 38.0 36.2 38.0 30.0 38.0 140-144 34.25795 38.0 35.8 38.0 25.6 38.0 145-149 33.1556 38.0 34.2 38.0 17.8 38.0 150-151 28.443375000000003 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 5.0 4 2.0 5 1.0 6 0.0 7 3.0 8 2.0 9 2.0 10 0.0 11 1.0 12 0.0 13 3.0 14 4.0 15 2.0 16 6.0 17 7.0 18 8.0 19 7.0 20 9.0 21 11.0 22 11.0 23 7.0 24 16.0 25 17.0 26 18.0 27 31.0 28 29.0 29 27.0 30 39.0 31 41.0 32 68.0 33 72.0 34 125.0 35 191.0 36 469.0 37 2750.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.94604767879548 22.88582183186951 11.744040150564619 26.42409033877039 2 24.425 24.575 35.15 15.85 3 18.099999999999998 28.825 33.25 19.825 4 22.725 35.825 22.825 18.625 5 23.1 38.675 21.625 16.6 6 19.375 37.775 23.849999999999998 19.0 7 18.3 20.65 40.8 20.25 8 19.325 23.95 29.575000000000003 27.150000000000002 9 20.4 23.575 30.625000000000004 25.4 10-14 23.06 28.51 26.86 21.57 15-19 23.11 27.85 27.715 21.325 20-24 22.62 28.155 28.17 21.055 25-29 22.939999999999998 27.935 28.055000000000003 21.07 30-34 22.29 27.97 28.02 21.72 35-39 22.855 28.449999999999996 28.055000000000003 20.64 40-44 22.575 27.96 28.345 21.12 45-49 23.096179842787766 28.223101186601912 28.08791869023181 20.592800280378512 50-54 22.499749724697164 27.815597156872563 28.57142857142857 21.113224547001703 55-59 23.125501202886927 27.841820368885323 28.162590216519646 20.870088211708097 60-64 22.395 28.595 27.98 21.029999999999998 65-69 22.683818008909356 28.284698933880577 27.61399469442915 21.41748836278092 70-74 23.437656735881234 28.388002808706993 27.65071722339252 20.523623232019258 75-79 22.715 28.410000000000004 28.065 20.810000000000002 80-84 22.99 28.24 27.884999999999998 20.885 85-89 23.24 28.335 27.894999999999996 20.53 90-94 23.055 27.72 28.985 20.24 95-99 22.91 28.175 27.87 21.044999999999998 100-104 23.294999999999998 28.275 28.155 20.275000000000002 105-109 23.52 27.615000000000002 28.485 20.380000000000003 110-114 23.285 27.97 28.470000000000002 20.275000000000002 115-119 23.32 28.189999999999998 28.225 20.265 120-124 23.465 28.63 27.639999999999997 20.265 125-129 24.11 28.025 27.235 20.630000000000003 130-134 23.735 27.975 28.125 20.165 135-139 23.945 28.115000000000002 27.750000000000004 20.19 140-144 23.76 28.37 28.144999999999996 19.725 145-149 24.625 28.22 27.534999999999997 19.62 150-151 23.625 28.262500000000003 28.1375 19.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 0.5 23 1.0 24 1.5 25 2.5 26 5.5 27 7.5 28 6.5 29 8.0 30 12.5 31 19.5 32 35.0 33 42.5 34 48.0 35 72.0 36 89.0 37 103.0 38 134.0 39 165.5 40 205.5 41 238.5 42 249.5 43 280.5 44 303.0 45 295.5 46 270.0 47 250.5 48 230.5 49 201.0 50 154.5 51 123.0 52 107.0 53 85.0 54 75.5 55 51.0 56 34.5 57 21.5 58 14.0 59 16.0 60 10.0 61 5.0 62 5.5 63 3.0 64 1.0 65 2.0 66 2.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.135 50-54 0.11 55-59 0.24 60-64 0.0 65-69 0.105 70-74 0.31 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 97.95762062803166 95.92500000000001 2 1.9913198876691345 3.9 3 0.025529742149604292 0.075 4 0.025529742149604292 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0125 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0125 0.0 0.025 0.0 0.0 64-65 0.05 0.0 0.025 0.0 0.0 66-67 0.05 0.0 0.025 0.0 0.0 68-69 0.05 0.0 0.025 0.0 0.0 70-71 0.05 0.0 0.025 0.0 0.0 72-73 0.05 0.0 0.025 0.0 0.0 74-75 0.05 0.0 0.025 0.0 0.0 76-77 0.05 0.0 0.025 0.0 0.0 78-79 0.075 0.0 0.025 0.0 0.0 80-81 0.075 0.0 0.025 0.0 0.0 82-83 0.075 0.0 0.025 0.0 0.0 84-85 0.1125 0.0 0.025 0.0 0.0 86-87 0.225 0.0 0.025 0.0 0.0 88-89 0.35 0.0 0.025 0.0 0.0 90-91 0.4375 0.0 0.025 0.0 0.0 92-93 0.55 0.0 0.025 0.0 0.0 94-95 0.675 0.0 0.025 0.0 0.0 96-97 0.7625 0.0 0.025 0.0 0.0 98-99 0.7875000000000001 0.0 0.025 0.0 0.0 100-101 0.8625 0.0 0.025 0.0 0.0 102-103 0.975 0.0 0.025 0.0 0.0 104-105 1.05 0.0 0.025 0.0 0.0 106-107 1.1625 0.0 0.025 0.0 0.0 108-109 1.25 0.0 0.025 0.0 0.0 110-111 1.3375 0.0 0.025 0.0 0.0 112-113 1.4 0.0 0.025 0.0 0.0 114-115 1.55 0.0 0.025 0.0 0.0 116-117 1.775 0.0 0.025 0.0 0.0 118-119 2.025 0.0 0.025 0.0 0.0 120-121 2.125 0.0 0.025 0.0 0.0 122-123 2.3125 0.0 0.025 0.0 0.0 124-125 2.5625 0.0 0.025 0.0 0.0 126-127 2.8 0.0 0.025 0.0 0.0 128-129 2.9625 0.0 0.025 0.0 0.0 130-131 3.175 0.0 0.025 0.0 0.0 132-133 3.4875 0.0 0.025 0.0 0.0 134-135 3.7125 0.0 0.025 0.0 0.0 136-137 4.112500000000001 0.0 0.025 0.0 0.0 138-139 4.4625 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 592044 spots for SRR7230808.sra Written 592044 spots for SRR7230808.sra Read 592044 spots for SRR7230808.sra Written 592044 spots for SRR7230808.sra Read 592044 spots for SRR7230808.sra Written 592044 spots for SRR7230808.sra Read 592044 spots for SRR7230808.sra Written 592044 spots for SRR7230808.sra Read 592044 spots for SRR7230808.sra Written 592044 spots for SRR7230808.sra Read 592044 spots for SRR7230808.sra Written 592044 spots for SRR7230808.sra Read 592044 spots for SRR7230808.sra Written 592044 spots for SRR7230808.sra Read 592044 spots for SRR7230808.sra Written 592044 spots for SRR7230808.sra Read 592044 spots for SRR7230808.sra Written 592044 spots for SRR7230808.sra Read 592044 spots for SRR7230808.sra Written 592044 spots for SRR7230808.sra Read 592044 spots for SRR7230808.sra Written 592044 spots for SRR7230808.sra Read 592044 spots for SRR7230808.sra Written 592044 spots for SRR7230808.sra Read 592044 spots for SRR7230808.sra Written 592044 spots for SRR7230808.sra Read 592044 spots for SRR7230808.sra Written 592044 spots for SRR7230808.sra Read 592056 spots for SRR7230808.sra Written 592056 spots for SRR7230808.sra Read 592044 spots for SRR7230808.sra Written 592044 spots for SRR7230808.sra Read 592044 spots for SRR7230808.sra Written 592044 spots for SRR7230808.sra Read 592044 spots for SRR7230808.sra Written 592044 spots for SRR7230808.sra Read 592044 spots for SRR7230808.sra Written 592044 spots for SRR7230808.sra Read 592044 spots for SRR7230808.sra Written 592044 spots for SRR7230808.sra SRR ids: ['SRR7230808.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_504m4tkx SRR7230808.sra spots: 11840892 blocks: [[1, 592044], [592045, 1184088], [1184089, 1776132], [1776133, 2368176], [2368177, 2960220], [2960221, 3552264], [3552265, 4144308], [4144309, 4736352], [4736353, 5328396], [5328397, 5920440], [5920441, 6512484], [6512485, 7104528], [7104529, 7696572], [7696573, 8288616], [8288617, 8880660], [8880661, 9472704], [9472705, 10064748], [10064749, 10656792], [10656793, 11248836], [11248837, 11840892]] SRR7230808 file size 3990789 SRR7230808 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230808 SRR7230808_1.fastq SRR7230808_2.fastq Input file: SRR7230808_1.fastq Paired file: SRR7230808_2.fastq trimmed: SRR7230808-trimmed-pair1.fastq, SRR7230808-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:40:27 2025 >> started Tue Feb 11 08:40:40 2025 >> done (13.960s) 11840892 read pairs processed; of these: 19326 ( 0.16%) short read pairs filtered out after trimming by size control 21378 ( 0.18%) empty read pairs filtered out after trimming by size control 11800188 (99.66%) read pairs available; of these: 5154286 (43.68%) trimmed read pairs available after processing 6645902 (56.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 17 0.00% 20 13 0.00% 21 12 0.00% 22 12 0.00% 23 13 0.00% 24 15 0.00% 25 19 0.00% 26 20 0.00% 27 19 0.00% 28 12 0.00% 29 20 0.00% 30 12 0.00% 31 29 0.00% 32 18 0.00% 33 19 0.00% 34 16 0.00% 35 15 0.00% 36 29 0.00% 37 22 0.00% 38 22 0.00% 39 27 0.00% 40 31 0.00% 41 35 0.00% 42 28 0.00% 43 35 0.00% 44 34 0.00% 45 52 0.00% 46 58 0.00% 47 59 0.00% 48 67 0.00% 49 63 0.00% 50 89 0.00% 51 105 0.00% 52 109 0.00% 53 120 0.00% 54 122 0.00% 55 145 0.00% 56 141 0.00% 57 149 0.00% 58 198 0.00% 59 205 0.00% 60 220 0.00% 61 259 0.00% 62 310 0.00% 63 286 0.00% 64 339 0.00% 65 408 0.00% 66 454 0.00% 67 648 0.01% 68 858 0.01% 69 1744 0.01% 70 1853 0.02% 71 1080 0.01% 72 952 0.01% 73 1109 0.01% 74 1114 0.01% 75 1174 0.01% 76 1271 0.01% 77 1413 0.01% 78 1588 0.01% 79 1870 0.02% 80 2054 0.02% 81 2216 0.02% 82 2398 0.02% 83 2872 0.02% 84 4026 0.03% 85 4722 0.04% 86 5301 0.04% 87 5420 0.05% 88 5582 0.05% 89 5739 0.05% 90 6095 0.05% 91 6579 0.06% 92 6577 0.06% 93 7153 0.06% 94 7443 0.06% 95 7856 0.07% 96 8173 0.07% 97 8458 0.07% 98 8783 0.07% 99 9396 0.08% 100 9976 0.08% 101 10138 0.09% 102 10761 0.09% 103 11421 0.10% 104 12080 0.10% 105 12253 0.10% 106 12618 0.11% 107 13106 0.11% 108 13304 0.11% 109 14158 0.12% 110 14470 0.12% 111 15052 0.13% 112 15709 0.13% 113 16448 0.14% 114 17276 0.15% 115 17890 0.15% 116 18065 0.15% 117 18311 0.16% 118 19061 0.16% 119 19572 0.17% 120 20139 0.17% 121 20971 0.18% 122 21888 0.19% 123 23032 0.20% 124 23813 0.20% 125 24420 0.21% 126 25428 0.22% 127 26315 0.22% 128 27000 0.23% 129 28022 0.24% 130 28614 0.24% 131 30230 0.26% 132 31763 0.27% 133 33920 0.29% 134 35539 0.30% 135 37584 0.32% 136 39382 0.33% 137 41619 0.35% 138 44520 0.38% 139 47226 0.40% 140 50451 0.43% 141 55058 0.47% 142 60627 0.51% 143 68058 0.58% 144 79356 0.67% 145 94883 0.80% 146 119929 1.02% 147 162928 1.38% 148 238289 2.02% 149 471118 3.99% 150 2712471 22.99% 151 6645902 56.32% 11800188 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=21 prefix-density=0.59 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=15.86 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.5 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=19 prefix-density=0.56 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=114.96 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.3 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT SRR7230808 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:41:27 Started mapping on | Feb 11 08:41:28 Finished on | Feb 11 08:42:54 Mapping speed, Million of reads per hour | 493.96 Number of input reads | 11800188 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 11045273 Uniquely mapped reads % | 93.60% Average mapped length | 294.50 Number of splices: Total | 10397050 Number of splices: Annotated (sjdb) | 10181182 Number of splices: GT/AG | 10184514 Number of splices: GC/AG | 179384 Number of splices: AT/AC | 6109 Number of splices: Non-canonical | 27043 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 298163 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 36263 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.49% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 480968 480968 480968 N_multimapping 298163 298163 298163 N_noFeature 404401 10860399 475113 N_ambiguous 198639 824 84021 UnstrandedReadsAssigned:10442233 PositiveStrandReadsAssigned:184050 NegativeStrandReadsAssigned:10486139 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7230808 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230808-trimmed-pair1.fastq SRR7230808-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,800,188 reads, 10,498,144 reads pseudoaligned [quant] estimated average fragment length: 293.718 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR7230808.ke.tsv 34699 SRR7230808.se.tsv 87100 total ==> SRR7230808.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1725.28 407 22.0881 Potri.005G024800.1.v4.1 1035 742.282 71 8.95599 Potri.004G059700.1.v4.1 961 668.511 16 2.24097 Potri.007G009000.2.v4.1 1416 1123.28 0 0 Potri.003G141000.2.v4.1 2943 2650.28 472 16.6753 Potri.016G087400.1.v4.1 270 82.8255 491 555.062 Potri.015G069301.1.v4.1 564 287.003 0 0 Potri.010G195200.1.v4.1 1773 1480.28 1 0.0632528 Potri.012G127500.1.v4.1 977 684.39 129 17.6486 ==> SRR7230808.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1171 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 319 Potri.001G212900.v4.1 48 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7230808 completed mapping pipeline successfully