Starting /dee2/code/volunteer_pipeline.sh SRR7230809 current disk space = 3055462502400 free memory = 1445093960 SRR7230809 SRAfilesize 1016a506a3647b5ea2eb89c4d2c568c7 SRR7230809.sra SRR7230809.sra file validated SRR7230809 is paired end SRR7230809 is conventional basespace SRR7230809 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230809_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.489 34.0 33.0 34.0 33.0 34.0 2 33.52925 34.0 34.0 34.0 33.0 34.0 3 33.5335 34.0 34.0 34.0 33.0 34.0 4 33.4495 34.0 34.0 34.0 33.0 34.0 5 33.49025 34.0 34.0 34.0 33.0 34.0 6 37.25 38.0 38.0 38.0 36.0 38.0 7 37.49925 38.0 38.0 38.0 37.0 38.0 8 37.588 38.0 38.0 38.0 38.0 38.0 9 37.6455 38.0 38.0 38.0 38.0 38.0 10-14 37.6391 38.0 38.0 38.0 38.0 38.0 15-19 37.36165 38.0 38.0 38.0 37.0 38.0 20-24 37.58085 38.0 38.0 38.0 38.0 38.0 25-29 37.591750000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.570049999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.2776 38.0 38.0 38.0 37.2 38.0 40-44 36.95585 38.0 38.0 38.0 36.0 38.0 45-49 37.0033 38.0 38.0 38.0 36.0 38.0 50-54 36.786449999999995 38.0 37.8 38.0 34.8 38.0 55-59 37.29795 38.0 38.0 38.0 37.0 38.0 60-64 37.302499999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.24835 38.0 38.0 38.0 37.0 38.0 70-74 32.94675 38.0 29.6 38.0 15.8 38.0 75-79 33.4601 38.0 36.6 38.0 16.6 38.0 80-84 35.4465 38.0 38.0 38.0 30.2 38.0 85-89 36.31205 38.0 38.0 38.0 34.0 38.0 90-94 36.601099999999995 38.0 38.0 38.0 34.4 38.0 95-99 36.66885 38.0 38.0 38.0 34.6 38.0 100-104 35.78985 38.0 36.8 38.0 30.2 38.0 105-109 36.25515 38.0 37.4 38.0 33.4 38.0 110-114 35.7812 38.0 36.8 38.0 31.4 38.0 115-119 36.113150000000005 38.0 37.2 38.0 33.4 38.0 120-124 35.3224 38.0 36.0 38.0 28.8 38.0 125-129 35.18265 38.0 35.8 38.0 28.6 38.0 130-134 34.81275 38.0 35.2 38.0 25.0 38.0 135-139 35.055150000000005 38.0 35.4 38.0 28.4 38.0 140-144 34.33605 38.0 35.0 38.0 24.6 38.0 145-149 33.60625 38.0 33.8 38.0 21.4 38.0 150-151 30.111625 35.5 28.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 0.0 16 2.0 17 4.0 18 3.0 19 3.0 20 4.0 21 3.0 22 3.0 23 9.0 24 9.0 25 13.0 26 21.0 27 24.0 28 36.0 29 48.0 30 47.0 31 67.0 32 105.0 33 161.0 34 212.0 35 372.0 36 816.0 37 2036.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.699999999999996 15.5 9.975000000000001 33.825 2 22.0 19.5 35.15 23.35 3 19.05 26.974999999999998 27.625 26.35 4 23.125 34.425 21.925 20.525 5 21.075 36.449999999999996 23.974999999999998 18.5 6 17.10855427713857 35.09254627313656 27.113556778389196 20.68534267133567 7 13.425 22.7 44.074999999999996 19.8 8 17.175 23.825 30.8 28.199999999999996 9 17.849999999999998 22.925 32.0 27.224999999999998 10-14 20.244999999999997 29.054999999999996 27.13 23.57 15-19 20.335 28.144999999999996 27.965 23.555 20-24 20.175 28.625 27.755000000000003 23.445 25-29 20.09 28.375 27.71 23.825 30-34 19.689999999999998 28.525 28.015 23.77 35-39 20.157251602564102 28.32532051282051 27.854567307692307 23.662860576923077 40-44 20.29334940727346 28.782399035563593 27.807916415511354 23.116335141651597 45-49 19.613922784556912 28.720744148829763 27.71054210842168 23.954790958191637 50-54 20.044999999999998 28.18 27.88 23.895 55-59 20.342119741909666 29.210223578252386 27.16950932826489 23.27814735157305 60-64 20.169999999999998 28.24 28.050000000000004 23.54 65-69 20.121036310893267 28.653596078823647 27.8333500050015 23.392017605281584 70-74 20.202190395956194 28.35720303285594 27.773097444538053 23.667509126649815 75-79 20.17428477474515 28.548723007782527 27.622492601118054 23.65449961635427 80-84 20.60546368773003 28.438131771292312 27.354725001295943 23.601679539681715 85-89 20.759864598595463 28.722275551962817 27.04996716010711 23.46789268933461 90-94 20.965 27.785 27.765 23.485 95-99 20.543081462219334 28.294244136620495 27.589138370755613 23.57353603040456 100-104 20.421442514640372 28.54997747635017 27.488863306471796 23.539716702537664 105-109 20.272299529482428 28.20102112323556 28.090899989988987 23.435779357293022 110-114 20.936515083295813 27.760268147481113 27.565160838461157 23.73805593076192 115-119 20.834375468961035 28.72792756740533 26.682006903106398 23.755690060527236 120-124 21.060000000000002 28.465 26.87 23.605 125-129 21.275211450878334 27.8214303588409 27.125769481006955 23.77758870927381 130-134 21.428571428571427 28.040100250626566 27.56390977443609 22.967418546365913 135-139 20.946047302365116 28.16140807040352 26.48132406620331 24.411220561028053 140-144 21.092382333816836 28.309908467963783 26.544290501675587 24.05341869654379 145-149 21.243497398959583 28.17627050820328 26.630652260904363 23.949579831932773 150-151 21.390173771721464 28.27853481685211 26.903362920365048 23.427928491061383 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 0.5 20 2.0 21 3.5 22 2.5 23 3.0 24 3.5 25 5.0 26 8.5 27 14.0 28 16.0 29 15.0 30 25.0 31 37.0 32 47.0 33 60.0 34 77.0 35 92.5 36 116.0 37 128.5 38 143.0 39 178.5 40 190.5 41 209.0 42 243.0 43 254.5 44 255.0 45 240.5 46 215.5 47 205.0 48 204.5 49 199.0 50 169.5 51 139.5 52 110.5 53 86.5 54 70.5 55 51.5 56 42.5 57 37.0 58 32.5 59 23.5 60 13.0 61 9.5 62 7.0 63 3.5 64 1.5 65 0.0 66 0.5 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.16 40-44 0.45999999999999996 45-49 0.02 50-54 0.0 55-59 0.034999999999999996 60-64 0.0 65-69 0.03 70-74 10.975 75-79 8.77 80-84 3.5450000000000004 85-89 1.035 90-94 0.0 95-99 0.015 100-104 0.105 105-109 0.11 110-114 0.055 115-119 0.045 120-124 0.0 125-129 0.095 130-134 0.25 135-139 0.005 140-144 0.034999999999999996 145-149 0.04 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26952141057934 98.52499999999999 2 0.7052896725440806 1.4000000000000001 3 0.025188916876574305 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5375 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.7875000000000001 0.0 0.0 0.0 0.0 106-107 0.9 0.0 0.0 0.0 0.0 108-109 1.1749999999999998 0.0 0.0 0.0 0.0 110-111 1.3625 0.0 0.0 0.0 0.0 112-113 1.5 0.0 0.0 0.0 0.0 114-115 1.825 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.675 0.0 0.0 0.0 0.0 122-123 2.9625000000000004 0.0 0.0 0.0 0.0 124-125 3.45 0.0 0.0 0.0 0.0 126-127 3.8375 0.0 0.0 0.0 0.0 128-129 4.1375 0.0 0.0 0.0 0.0 130-131 4.5875 0.0 0.0 0.0 0.0 132-133 5.0875 0.0 0.0 0.0 0.0 134-135 5.425 0.0 0.0 0.0 0.0 136-137 5.975 0.0 0.0 0.0 0.0 138-139 6.574999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATTGCT 10 0.007313715 141.725 5 AGAATTT 10 0.007313715 141.725 2 GACGAAT 10 0.007313715 141.725 6 >>END_MODULE SRR7230809 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230809_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8895 34.0 33.0 34.0 32.0 34.0 2 32.98175 34.0 33.0 34.0 32.0 34.0 3 33.01825 34.0 33.0 34.0 32.0 34.0 4 33.0065 34.0 33.0 34.0 33.0 34.0 5 33.0425 34.0 33.0 34.0 33.0 34.0 6 37.093 38.0 38.0 38.0 37.0 38.0 7 37.11225 38.0 38.0 38.0 37.0 38.0 8 37.03875 38.0 38.0 38.0 37.0 38.0 9 37.06075 38.0 38.0 38.0 37.0 38.0 10-14 37.0325 38.0 38.0 38.0 37.0 38.0 15-19 37.00514999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.00785 38.0 38.0 38.0 37.0 38.0 25-29 36.93535 38.0 38.0 38.0 37.0 38.0 30-34 36.8953 38.0 38.0 38.0 37.0 38.0 35-39 36.7421 38.0 38.0 38.0 36.6 38.0 40-44 36.764599999999994 38.0 38.0 38.0 36.4 38.0 45-49 36.77890000000001 38.0 38.0 38.0 36.4 38.0 50-54 36.790350000000004 38.0 38.0 38.0 36.8 38.0 55-59 36.3973 38.0 38.0 38.0 35.6 38.0 60-64 36.617349999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.428 38.0 38.0 38.0 35.8 38.0 70-74 36.20205 38.0 38.0 38.0 34.4 38.0 75-79 36.52685 38.0 38.0 38.0 35.6 38.0 80-84 36.499849999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.526799999999994 38.0 38.0 38.0 35.6 38.0 90-94 36.400549999999996 38.0 38.0 38.0 35.0 38.0 95-99 36.30165 38.0 38.0 38.0 34.8 38.0 100-104 36.1363 38.0 38.0 38.0 34.0 38.0 105-109 36.0159 38.0 38.0 38.0 33.6 38.0 110-114 36.04055 38.0 38.0 38.0 34.0 38.0 115-119 35.9162 38.0 38.0 38.0 33.8 38.0 120-124 35.67045 38.0 37.8 38.0 32.2 38.0 125-129 35.45645 38.0 37.0 38.0 31.2 38.0 130-134 35.319900000000004 38.0 36.6 38.0 31.0 38.0 135-139 34.76265 38.0 36.0 38.0 28.2 38.0 140-144 34.301649999999995 38.0 35.6 38.0 25.8 38.0 145-149 33.2171 38.0 34.0 38.0 18.0 38.0 150-151 27.740000000000002 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 8.0 4 6.0 5 6.0 6 7.0 7 5.0 8 0.0 9 4.0 10 2.0 11 2.0 12 5.0 13 4.0 14 4.0 15 3.0 16 4.0 17 4.0 18 2.0 19 2.0 20 4.0 21 5.0 22 10.0 23 8.0 24 9.0 25 12.0 26 27.0 27 21.0 28 38.0 29 25.0 30 44.0 31 52.0 32 55.0 33 70.0 34 130.0 35 217.0 36 502.0 37 2694.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.13026052104208 19.08817635270541 13.977955911823647 26.803607214428858 2 26.34610568494866 25.870272977710997 30.77886301026797 17.004758327072377 3 20.674999999999997 28.050000000000004 31.1 20.175 4 24.075 35.275 21.825 18.825 5 22.35 37.5 22.475 17.675 6 19.650000000000002 36.725 24.95 18.675 7 18.875 17.724999999999998 41.325 22.075 8 19.425 24.15 29.5 26.924999999999997 9 21.224999999999998 24.775 27.800000000000004 26.200000000000003 10-14 23.609443777511004 28.47639055622249 26.5906362545018 21.323529411764707 15-19 23.228129845445906 27.899764917721203 27.679687890761766 21.192417346071124 20-24 22.88758817349542 28.07043874130772 27.920356195907747 21.121616889289108 25-29 23.087315486614962 28.006004503377536 27.745809357017766 21.16087065298974 30-34 22.878727236341806 28.13688212927757 27.606563938363017 21.37782669601761 35-39 23.141612854783 27.586724733443457 27.852029834309455 21.419632577464085 40-44 22.763210568454763 27.872297838270615 28.672938350680543 20.691553242594075 45-49 23.075381918357124 27.01728024042074 28.1893313298272 21.71800651139494 50-54 22.988620983507946 27.485086971778035 27.906160709810013 21.620131334904006 55-59 23.45554490897171 27.384134348681226 27.782540723183217 21.37778001916385 60-64 23.150657432500253 27.712536384623103 27.762722071665163 21.374084111211484 65-69 23.7865055387714 27.326283987915406 27.880161127895263 21.007049345417926 70-74 23.42995169082126 27.873389694041865 27.329911433172306 21.366747181964573 75-79 23.49527192675239 28.108270375744233 27.497873617851603 20.898584079651776 80-84 23.41086825746942 27.757168638459994 27.551634249047524 21.280328855023058 85-89 23.281640820410203 27.428714357178592 27.99399699849925 21.295647823911956 90-94 23.16621635144601 27.579305513859705 27.92454718302812 21.329930951666164 95-99 23.425226397158152 27.898133786961527 28.023215089808375 20.653424726071947 100-104 23.400850212553138 27.866966741685424 28.16704176044011 20.56514128532133 105-109 23.066920076022807 27.668300490147047 28.123437031109333 21.141342402720817 110-114 23.821923982172365 27.758024938654913 27.74300165256147 20.677049426611248 115-119 23.801421279151235 28.300470423381043 27.399659693724352 20.49844860374337 120-124 23.893584037605642 27.954193128969347 27.85417812671901 20.298044706706005 125-129 24.30864629694454 27.539130869630448 27.444116617492625 20.70810621593239 130-134 24.57105697563904 27.452353559101596 27.537391826321844 20.43919763893752 135-139 24.657946173507746 27.80534255500426 27.294141231894955 20.242570039593044 140-144 24.673701055158272 27.36410461569235 27.759163874581187 20.203030454568186 145-149 25.533830074511176 27.839175876381457 27.009051357703655 19.617942691403712 150-151 25.7125 28.037499999999998 27.725 18.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 3.0 24 5.0 25 4.5 26 4.0 27 7.5 28 12.5 29 14.0 30 16.0 31 21.0 32 32.0 33 41.0 34 48.0 35 66.5 36 75.5 37 94.0 38 129.5 39 158.0 40 181.5 41 208.5 42 242.5 43 255.5 44 267.0 45 279.0 46 256.0 47 234.5 48 227.5 49 217.0 50 173.5 51 137.5 52 123.0 53 99.5 54 82.5 55 62.0 56 49.5 57 39.0 58 34.0 59 30.5 60 19.5 61 12.5 62 10.5 63 7.5 64 3.5 65 2.0 66 1.5 67 1.0 68 1.5 69 1.5 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.04 15-19 0.034999999999999996 20-24 0.055 25-29 0.075 30-34 0.06 35-39 0.11499999999999999 40-44 0.08 45-49 0.17500000000000002 50-54 0.255 55-59 0.855 60-64 0.37 65-69 0.7000000000000001 70-74 0.64 75-79 0.065 80-84 0.26 85-89 0.05 90-94 0.06999999999999999 95-99 0.065 100-104 0.025 105-109 0.03 110-114 0.155 115-119 0.09 120-124 0.015 125-129 0.015 130-134 0.045 135-139 0.23500000000000001 140-144 0.015 145-149 0.015 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06565656565657 98.075 2 0.8838383838383838 1.7500000000000002 3 0.025252525252525252 0.075 4 0.025252525252525252 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.775 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.6375000000000002 0.0 0.0 0.0 0.0 114-115 1.9749999999999999 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.5875 0.0 0.0 0.0 0.0 120-121 2.8499999999999996 0.0 0.0 0.0 0.0 122-123 3.1875 0.0 0.0 0.0 0.0 124-125 3.6625 0.0 0.0 0.0 0.0 126-127 4.05 0.0 0.0 0.0 0.0 128-129 4.3875 0.0 0.0 0.0 0.0 130-131 4.8375 0.0 0.0 0.0 0.0 132-133 5.35 0.0 0.0 0.0 0.0 134-135 5.7125 0.0 0.0 0.0 0.0 136-137 6.225 0.0 0.0 0.0 0.0 138-139 6.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATGGC 10 0.0068400395 144.91139 2 >>END_MODULE Read 631447 spots for SRR7230809.sra Written 631447 spots for SRR7230809.sra Read 631447 spots for SRR7230809.sra Written 631447 spots for SRR7230809.sra Read 631447 spots for SRR7230809.sra Written 631447 spots for SRR7230809.sra Read 631447 spots for SRR7230809.sra Written 631447 spots for SRR7230809.sra Read 631447 spots for SRR7230809.sra Written 631447 spots for SRR7230809.sra Read 631447 spots for SRR7230809.sra Written 631447 spots for SRR7230809.sra Read 631447 spots for SRR7230809.sra Written 631447 spots for SRR7230809.sra Read 631447 spots for SRR7230809.sra Written 631447 spots for SRR7230809.sra Read 631447 spots for SRR7230809.sra Written 631447 spots for SRR7230809.sra Read 631447 spots for SRR7230809.sra Written 631447 spots for SRR7230809.sra Read 631447 spots for SRR7230809.sra Written 631447 spots for SRR7230809.sra Read 631447 spots for SRR7230809.sra Written 631447 spots for SRR7230809.sra Read 631456 spots for SRR7230809.sra Written 631456 spots for SRR7230809.sra Read 631447 spots for SRR7230809.sra Written 631447 spots for SRR7230809.sra Read 631447 spots for SRR7230809.sra Written 631447 spots for SRR7230809.sra Read 631447 spots for SRR7230809.sra Written 631447 spots for SRR7230809.sra Read 631447 spots for SRR7230809.sra Written 631447 spots for SRR7230809.sra Read 631447 spots for SRR7230809.sra Written 631447 spots for SRR7230809.sra Read 631447 spots for SRR7230809.sra Written 631447 spots for SRR7230809.sra Read 631447 spots for SRR7230809.sra Written 631447 spots for SRR7230809.sra SRR ids: ['SRR7230809.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__zrv5a8g SRR7230809.sra spots: 12628949 blocks: [[1, 631447], [631448, 1262894], [1262895, 1894341], [1894342, 2525788], [2525789, 3157235], [3157236, 3788682], [3788683, 4420129], [4420130, 5051576], [5051577, 5683023], [5683024, 6314470], [6314471, 6945917], [6945918, 7577364], [7577365, 8208811], [8208812, 8840258], [8840259, 9471705], [9471706, 10103152], [10103153, 10734599], [10734600, 11366046], [11366047, 11997493], [11997494, 12628949]] SRR7230809 file size 4257836 SRR7230809 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230809 SRR7230809_1.fastq SRR7230809_2.fastq Input file: SRR7230809_1.fastq Paired file: SRR7230809_2.fastq trimmed: SRR7230809-trimmed-pair1.fastq, SRR7230809-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:07:11 2025 >> started Tue Feb 11 09:07:25 2025 >> done (13.554s) 12628949 read pairs processed; of these: 20181 ( 0.16%) short read pairs filtered out after trimming by size control 15010 ( 0.12%) empty read pairs filtered out after trimming by size control 12593758 (99.72%) read pairs available; of these: 5431366 (43.13%) trimmed read pairs available after processing 7162392 (56.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 3 0.00% 21 1 0.00% 22 3 0.00% 23 6 0.00% 24 1 0.00% 25 5 0.00% 26 1 0.00% 27 7 0.00% 28 5 0.00% 29 9 0.00% 30 11 0.00% 31 5 0.00% 32 14 0.00% 33 9 0.00% 34 10 0.00% 35 5 0.00% 36 13 0.00% 37 16 0.00% 38 13 0.00% 39 22 0.00% 40 10 0.00% 41 21 0.00% 42 23 0.00% 43 25 0.00% 44 19 0.00% 45 37 0.00% 46 37 0.00% 47 38 0.00% 48 66 0.00% 49 43 0.00% 50 74 0.00% 51 75 0.00% 52 82 0.00% 53 110 0.00% 54 88 0.00% 55 100 0.00% 56 128 0.00% 57 130 0.00% 58 186 0.00% 59 167 0.00% 60 201 0.00% 61 222 0.00% 62 220 0.00% 63 276 0.00% 64 247 0.00% 65 317 0.00% 66 389 0.00% 67 426 0.00% 68 592 0.00% 69 1289 0.01% 70 1279 0.01% 71 808 0.01% 72 796 0.01% 73 934 0.01% 74 920 0.01% 75 1049 0.01% 76 1140 0.01% 77 1228 0.01% 78 1411 0.01% 79 1653 0.01% 80 1934 0.02% 81 2602 0.02% 82 2326 0.02% 83 2608 0.02% 84 4147 0.03% 85 4271 0.03% 86 4410 0.04% 87 4719 0.04% 88 5024 0.04% 89 5441 0.04% 90 5752 0.05% 91 6156 0.05% 92 6528 0.05% 93 7070 0.06% 94 7558 0.06% 95 7888 0.06% 96 8383 0.07% 97 8695 0.07% 98 9322 0.07% 99 9829 0.08% 100 10317 0.08% 101 11032 0.09% 102 11792 0.09% 103 12310 0.10% 104 12954 0.10% 105 13840 0.11% 106 14314 0.11% 107 15010 0.12% 108 15641 0.12% 109 16777 0.13% 110 17416 0.14% 111 17925 0.14% 112 19111 0.15% 113 19983 0.16% 114 20765 0.16% 115 21833 0.17% 116 22580 0.18% 117 23047 0.18% 118 24067 0.19% 119 25068 0.20% 120 26151 0.21% 121 27435 0.22% 122 28133 0.22% 123 29375 0.23% 124 30939 0.25% 125 31608 0.25% 126 32990 0.26% 127 34483 0.27% 128 35817 0.28% 129 37074 0.29% 130 38135 0.30% 131 39996 0.32% 132 41221 0.33% 133 43520 0.35% 134 45699 0.36% 135 47611 0.38% 136 49648 0.39% 137 51774 0.41% 138 54650 0.43% 139 57574 0.46% 140 60806 0.48% 141 65819 0.52% 142 70770 0.56% 143 78266 0.62% 144 88795 0.71% 145 101745 0.81% 146 121810 0.97% 147 158339 1.26% 148 232310 1.84% 149 449232 3.57% 150 2742177 21.77% 151 7162392 56.87% 12593758 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=15 prefix-density=0.53 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=414.81 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=17.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCT criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=21 prefix-density=0.62 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=42.99 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.1 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA SRR7230809 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:08:10 Started mapping on | Feb 11 09:08:10 Finished on | Feb 11 09:09:43 Mapping speed, Million of reads per hour | 487.50 Number of input reads | 12593758 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11643820 Uniquely mapped reads % | 92.46% Average mapped length | 293.91 Number of splices: Total | 11084549 Number of splices: Annotated (sjdb) | 10824444 Number of splices: GT/AG | 10862223 Number of splices: GC/AG | 180814 Number of splices: AT/AC | 6504 Number of splices: Non-canonical | 35008 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.03% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 335152 % of reads mapped to multiple loci | 2.66% Number of reads mapped to too many loci | 146123 % of reads mapped to too many loci | 1.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.49% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 635656 635656 635656 N_multimapping 335152 335152 335152 N_noFeature 528447 11427018 619523 N_ambiguous 215804 1091 89325 UnstrandedReadsAssigned:10899569 PositiveStrandReadsAssigned:215711 NegativeStrandReadsAssigned:10934972 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7230809 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230809-trimmed-pair1.fastq SRR7230809-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,593,758 reads, 10,990,747 reads pseudoaligned [quant] estimated average fragment length: 246.139 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,051 rounds 52401 SRR7230809.ke.tsv 34699 SRR7230809.se.tsv 87100 total ==> SRR7230809.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.86 443 20.801 Potri.005G024800.1.v4.1 1035 789.861 57 6.00729 Potri.004G059700.1.v4.1 961 715.973 5 0.581337 Potri.007G009000.2.v4.1 1416 1170.86 0 0 Potri.003G141000.2.v4.1 2943 2697.86 684 21.1053 Potri.016G087400.1.v4.1 270 82.3772 429 433.516 Potri.015G069301.1.v4.1 564 326.961 0 0 Potri.010G195200.1.v4.1 1773 1527.86 24 1.30762 Potri.012G127500.1.v4.1 977 731.932 49 5.57288 ==> SRR7230809.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 687 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 205 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7230809 completed mapping pipeline successfully