Starting /dee2/code/volunteer_pipeline.sh SRR7230810 current disk space = 3054879432704 free memory = 1478610104 SRR7230810 SRAfilesize 0d7fb3811f4d1b18275636453777bf2a SRR7230810.sra SRR7230810.sra file validated SRR7230810 is paired end SRR7230810 is conventional basespace SRR7230810 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230810_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.43175 34.0 33.0 34.0 33.0 34.0 2 33.497 34.0 34.0 34.0 33.0 34.0 3 33.496 34.0 34.0 34.0 33.0 34.0 4 33.47725 34.0 34.0 34.0 33.0 34.0 5 33.4225 34.0 34.0 34.0 33.0 34.0 6 37.30875 38.0 38.0 38.0 36.0 38.0 7 37.56075 38.0 38.0 38.0 37.0 38.0 8 37.41225 38.0 38.0 38.0 37.0 38.0 9 37.52525 38.0 38.0 38.0 38.0 38.0 10-14 37.57415 38.0 38.0 38.0 38.0 38.0 15-19 37.56415 38.0 38.0 38.0 37.8 38.0 20-24 37.64805 38.0 38.0 38.0 38.0 38.0 25-29 37.5325 38.0 38.0 38.0 38.0 38.0 30-34 37.37885 38.0 38.0 38.0 37.4 38.0 35-39 37.34395 38.0 38.0 38.0 37.0 38.0 40-44 36.942449999999994 38.0 38.0 38.0 36.2 38.0 45-49 37.2442 38.0 38.0 38.0 36.8 38.0 50-54 37.3685 38.0 38.0 38.0 37.0 38.0 55-59 37.33109999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.23720000000001 38.0 38.0 38.0 36.8 38.0 65-69 37.21894999999999 38.0 38.0 38.0 36.6 38.0 70-74 31.384050000000002 38.0 24.4 38.0 15.6 38.0 75-79 32.4843 38.0 34.4 38.0 9.4 38.0 80-84 35.17395 38.0 37.4 38.0 29.8 38.0 85-89 36.1996 38.0 38.0 38.0 33.8 38.0 90-94 36.44665 38.0 38.0 38.0 34.2 38.0 95-99 36.600350000000006 38.0 38.0 38.0 34.6 38.0 100-104 36.4657 38.0 38.0 38.0 34.2 38.0 105-109 35.8502 38.0 37.2 38.0 30.2 38.0 110-114 36.06045 38.0 37.0 38.0 32.6 38.0 115-119 35.9917 38.0 37.4 38.0 32.6 38.0 120-124 35.675399999999996 38.0 37.0 38.0 31.0 38.0 125-129 35.116400000000006 38.0 35.6 38.0 27.8 38.0 130-134 35.35625 38.0 36.0 38.0 30.4 38.0 135-139 35.2976 38.0 36.0 38.0 30.4 38.0 140-144 35.004200000000004 38.0 35.6 38.0 28.6 38.0 145-149 34.17135 38.0 33.8 38.0 26.0 38.0 150-151 30.794 35.5 29.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 2.0 13 1.0 14 0.0 15 4.0 16 0.0 17 0.0 18 3.0 19 3.0 20 3.0 21 4.0 22 3.0 23 3.0 24 11.0 25 15.0 26 17.0 27 30.0 28 20.0 29 46.0 30 56.0 31 76.0 32 76.0 33 156.0 34 236.0 35 454.0 36 792.0 37 1988.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.283070767691925 13.078269567391848 10.877719429857464 43.76094023505877 2 18.725 22.325 36.975 21.975 3 20.1 25.0 27.05 27.85 4 22.7 33.375 20.95 22.975 5 20.3 37.35 24.55 17.8 6 16.7 36.0 26.674999999999997 20.625 7 13.25 22.05 45.275 19.425 8 18.05 22.25 31.1 28.599999999999998 9 18.25 22.7 32.925 26.125 10-14 19.895 29.315 26.87 23.919999999999998 15-19 19.7 28.64 28.025 23.635 20-24 19.855 28.16 28.15 23.835 25-29 19.45 28.985 28.08 23.485 30-34 20.235 28.835 27.365000000000002 23.565 35-39 20.49602480124006 28.57142857142857 27.346367318365917 23.58617930896545 40-44 20.017018720592652 28.721593753128445 27.700470517569325 23.56091700870958 45-49 20.015 28.04 28.050000000000004 23.895 50-54 20.32 29.115000000000002 27.42 23.145 55-59 20.47 28.26 27.800000000000004 23.47 60-64 20.54616384915475 28.39351805541662 27.348204461338398 23.712113634090226 65-69 19.775000000000002 28.58 27.834999999999997 23.810000000000002 70-74 19.66288835379104 29.09496681740765 28.07306043342926 23.169084395372057 75-79 19.9696833595329 28.278688524590162 28.03166404671008 23.719964069166856 80-84 20.221967486452687 28.324301792413504 27.808461859107965 23.645268862025844 85-89 20.214814064241565 28.61992096463674 27.697841726618705 23.46742324450299 90-94 20.945505589813003 28.15962300095252 27.67834762119617 23.2165237880383 95-99 20.470823941898324 28.409717004758328 27.292762334084646 23.826696719258702 100-104 20.806176677027977 28.25629198836859 27.494234432969016 23.443296901634415 105-109 20.692588700395337 28.694390231696943 27.393284291647902 23.21973677625982 110-114 20.943141471220684 28.0892133820073 27.404110616592487 23.563534530179528 115-119 20.99874529485571 28.47176913425345 27.287327478042663 23.242158092848182 120-124 20.844433274692133 28.233224428248306 27.62000502638854 23.30233727067102 125-129 21.245 27.805000000000003 27.134999999999998 23.815 130-134 20.765 27.805000000000003 27.62 23.810000000000002 135-139 20.97 28.199999999999996 26.834999999999997 23.995 140-144 20.89208920892089 27.852785278527854 27.367736773677372 23.887388738873888 145-149 21.024947400060114 29.03015729886785 26.375112714156902 23.56978258691514 150-151 19.834917458729365 29.739869934967484 27.301150575287643 23.12406203101551 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 2.0 21 2.5 22 3.0 23 5.5 24 7.0 25 7.0 26 7.5 27 14.0 28 19.0 29 20.5 30 24.0 31 36.5 32 46.5 33 56.0 34 80.5 35 99.5 36 104.0 37 122.0 38 166.0 39 192.0 40 203.0 41 225.5 42 243.0 43 248.5 44 263.5 45 251.0 46 231.0 47 221.0 48 188.0 49 172.5 50 143.5 51 105.5 52 88.5 53 84.5 54 79.0 55 58.0 56 41.0 57 34.0 58 27.5 59 21.0 60 16.5 61 10.5 62 6.5 63 3.0 64 1.5 65 2.5 66 2.0 67 1.5 68 2.0 69 1.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.11 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.03 65-69 0.0 70-74 14.865 75-79 10.94 80-84 4.04 85-89 1.31 90-94 0.265 95-99 0.17500000000000002 100-104 0.27 105-109 0.08499999999999999 110-114 0.015 115-119 0.375 120-124 0.525 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.19 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37059415911381 98.675 2 0.5538771399798591 1.0999999999999999 3 0.0755287009063444 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.8999999999999999 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.3624999999999998 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.7375 0.0 0.0 0.0 0.0 116-117 1.9874999999999998 0.0 0.0 0.0 0.0 118-119 2.2125 0.0 0.0 0.0 0.0 120-121 2.5375 0.0 0.0 0.0 0.0 122-123 2.85 0.0 0.0 0.0 0.0 124-125 3.2375 0.0 0.0 0.0 0.0 126-127 3.5250000000000004 0.0 0.0 0.0 0.0 128-129 3.825 0.0 0.0 0.0 0.0 130-131 4.2375 0.0 0.0 0.0 0.0 132-133 4.575 0.0 0.0 0.0 0.0 134-135 4.9625 0.0 0.0 0.0 0.0 136-137 5.4625 0.0 0.0 0.0 0.0 138-139 5.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTTCA 10 0.0073504816 141.4875 4 CCGCAAG 10 0.0073504816 141.4875 1 ATCAAGA 10 0.0073504816 141.4875 6 ACGTCTG 30 0.0019810402 70.74375 145 >>END_MODULE SRR7230810 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230810_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.57675 34.0 33.0 34.0 32.0 34.0 2 33.125 34.0 33.0 34.0 33.0 34.0 3 33.19025 34.0 33.0 34.0 33.0 34.0 4 33.17225 34.0 33.0 34.0 33.0 34.0 5 33.1735 34.0 33.0 34.0 33.0 34.0 6 37.4 38.0 38.0 38.0 37.0 38.0 7 37.35875 38.0 38.0 38.0 37.0 38.0 8 37.322 38.0 38.0 38.0 37.0 38.0 9 37.2425 38.0 38.0 38.0 37.0 38.0 10-14 37.0577 38.0 38.0 38.0 36.6 38.0 15-19 37.32495 38.0 38.0 38.0 37.4 38.0 20-24 37.2442 38.0 38.0 38.0 37.2 38.0 25-29 37.193799999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.227199999999996 38.0 38.0 38.0 37.0 38.0 35-39 36.954100000000004 38.0 38.0 38.0 36.8 38.0 40-44 36.66925 38.0 38.0 38.0 35.0 38.0 45-49 36.924249999999994 38.0 38.0 38.0 36.4 38.0 50-54 36.9539 38.0 38.0 38.0 35.8 38.0 55-59 36.94435 38.0 38.0 38.0 36.4 38.0 60-64 37.09495 38.0 38.0 38.0 36.8 38.0 65-69 37.0324 38.0 38.0 38.0 36.6 38.0 70-74 36.9473 38.0 38.0 38.0 36.2 38.0 75-79 36.9662 38.0 38.0 38.0 36.0 38.0 80-84 36.9037 38.0 38.0 38.0 36.0 38.0 85-89 36.85395 38.0 38.0 38.0 36.0 38.0 90-94 36.8015 38.0 38.0 38.0 36.0 38.0 95-99 36.66875 38.0 38.0 38.0 35.0 38.0 100-104 35.99105 38.0 37.6 38.0 32.6 38.0 105-109 36.26774999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.341249999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.336200000000005 38.0 38.0 38.0 34.0 38.0 120-124 36.0268 38.0 38.0 38.0 33.2 38.0 125-129 35.5734 38.0 37.0 38.0 31.2 38.0 130-134 35.47525 38.0 36.4 38.0 31.4 38.0 135-139 35.1368 38.0 36.0 38.0 30.2 38.0 140-144 34.80505 38.0 36.0 38.0 28.4 38.0 145-149 34.21229999999999 38.0 35.4 38.0 27.2 38.0 150-151 29.998749999999998 35.5 28.0 38.0 11.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 2.0 5 2.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 4.0 12 1.0 13 0.0 14 2.0 15 1.0 16 0.0 17 5.0 18 4.0 19 2.0 20 11.0 21 5.0 22 9.0 23 7.0 24 13.0 25 13.0 26 12.0 27 15.0 28 28.0 29 37.0 30 37.0 31 61.0 32 57.0 33 87.0 34 137.0 35 249.0 36 494.0 37 2699.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.376398779247204 16.454730417090538 14.750762970498474 33.41810783316379 2 24.3 23.65 36.05 16.0 3 21.825 25.7 30.7 21.775 4 24.375 34.449999999999996 22.0 19.175 5 23.724999999999998 37.574999999999996 21.15 17.549999999999997 6 18.099999999999998 38.824999999999996 22.95 20.125 7 18.85 18.175 41.325 21.65 8 20.95 23.25 28.075 27.725 9 22.5 24.025 29.925 23.549999999999997 10-14 22.81439223339839 29.30490917279688 25.957063503978382 21.92363508982635 15-19 22.435 28.449999999999996 27.785 21.33 20-24 22.87215411558669 28.15611708781586 27.570678008506377 21.40105078809107 25-29 22.83370022013208 28.311987192315392 27.856714028417052 20.99759855913548 30-34 22.67540786708037 27.729956961265138 28.300470423381043 21.294164748273445 35-39 22.938350680544435 27.70716573258607 28.12750200160128 21.226981585268216 40-44 23.04689454982233 28.0966918572644 28.17676792953306 20.67964566338021 45-49 22.973649934876264 27.402063921450758 27.727682596934173 21.896603546738806 50-54 22.73227873448138 27.733279935923104 28.308970764917902 21.22547056467761 55-59 23.170609462710505 27.13512429831596 28.262830793905376 21.431435445068164 60-64 23.71278458844133 27.075306479859897 28.516387290467847 20.695521641230926 65-69 23.18484742195721 27.338778373503033 27.854888009219824 21.62148619531994 70-74 23.34250688016012 27.835876907680763 27.935951963972975 20.88566424818614 75-79 22.8893340010015 27.711567351026538 28.11717576364547 21.28192288432649 80-84 23.40489416003603 27.788620327278185 27.41830555972577 21.388179952960016 85-89 23.034158068716817 27.506761494540722 27.862366022237804 21.59671441450466 90-94 23.00295487554465 27.750788801522514 27.57549957429759 21.67075674863525 95-99 23.003051067873756 28.069824438553493 27.564647626669338 21.362476866903414 100-104 23.26081520380095 27.82195548887222 27.76194048512128 21.155288822205552 105-109 23.447896342988646 28.185502026114364 27.62019110510781 20.746410525789184 110-114 23.805 28.345 27.305 20.544999999999998 115-119 23.345 28.015 27.825 20.815 120-124 23.59561802811265 28.027612425591514 28.197688960032014 20.17908058626382 125-129 24.190237797246557 28.120150187734666 27.219023779724655 20.47058823529412 130-134 24.207420742074206 27.667766776677666 27.93779377937794 20.187018701870187 135-139 24.178462461861653 28.104836692842493 27.399589856449758 20.317110988846096 140-144 25.46310203264244 27.846200060078104 27.280464603985184 19.410233303294284 145-149 24.754901960784316 27.21588635454182 27.536014405762305 20.493197278911566 150-151 25.381345336334082 28.294573643410853 26.93173293323331 19.392348087021755 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.5 20 2.0 21 2.0 22 1.5 23 2.5 24 2.0 25 2.0 26 4.5 27 5.0 28 6.0 29 12.0 30 21.0 31 26.5 32 26.5 33 33.5 34 46.5 35 74.5 36 93.5 37 106.0 38 136.5 39 161.5 40 186.5 41 222.5 42 239.0 43 234.0 44 250.5 45 270.5 46 266.5 47 241.0 48 225.0 49 208.0 50 170.5 51 142.0 52 117.5 53 100.0 54 83.0 55 57.0 56 43.0 57 40.0 58 36.5 59 31.5 60 25.5 61 15.5 62 6.0 63 2.5 64 2.5 65 2.0 66 1.0 67 1.0 68 2.0 69 3.5 70 2.0 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7000000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.08499999999999999 15-19 0.0 20-24 0.075 25-29 0.06 30-34 0.09 35-39 0.08 40-44 0.095 45-49 0.19 50-54 0.12 55-59 0.24 60-64 0.075 65-69 0.215 70-74 0.075 75-79 0.15 80-84 0.08499999999999999 85-89 0.16999999999999998 90-94 0.165 95-99 0.034999999999999996 100-104 0.025 105-109 0.055 110-114 0.0 115-119 0.0 120-124 0.045 125-129 0.125 130-134 0.01 135-139 0.034999999999999996 140-144 0.13 145-149 0.04 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24261550113607 98.275 2 0.6563998990154002 1.3 3 0.050492299924261554 0.15 4 0.0 0.0 5 0.025246149962130777 0.125 6 0.025246149962130777 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.23750000000000002 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.1375 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.45 0.0 0.0 0.0 0.0 112-113 1.675 0.0 0.0 0.0 0.0 114-115 1.8625 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.3875 0.0 0.0 0.0 0.0 120-121 2.7125 0.0 0.0 0.0 0.0 122-123 3.05 0.0 0.0 0.0 0.0 124-125 3.4625 0.0 0.0 0.0 0.0 126-127 3.7875 0.0 0.0 0.0 0.0 128-129 4.1 0.0 0.0 0.0 0.0 130-131 4.5 0.0 0.0 0.0 0.0 132-133 4.825 0.0 0.0 0.0 0.0 134-135 5.2375 0.0 0.0 0.0 0.0 136-137 5.75 0.0 0.0 0.0 0.0 138-139 6.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAACGAA 10 0.006832588 144.9875 3 TTAACGA 10 0.006832588 144.9875 2 CGTGTAG 30 0.0017979635 72.49375 145 >>END_MODULE Read 798950 spots for SRR7230810.sra Written 798950 spots for SRR7230810.sra Read 798950 spots for SRR7230810.sra Written 798950 spots for SRR7230810.sra Read 798950 spots for SRR7230810.sra Written 798950 spots for SRR7230810.sra Read 798950 spots for SRR7230810.sra Written 798950 spots for SRR7230810.sra Read 798950 spots for SRR7230810.sra Written 798950 spots for SRR7230810.sra Read 798950 spots for SRR7230810.sra Written 798950 spots for SRR7230810.sra Read 798950 spots for SRR7230810.sra Written 798950 spots for SRR7230810.sra Read 798950 spots for SRR7230810.sra Written 798950 spots for SRR7230810.sra Read 798950 spots for SRR7230810.sra Written 798950 spots for SRR7230810.sra Read 798950 spots for SRR7230810.sra Written 798950 spots for SRR7230810.sra Read 798950 spots for SRR7230810.sra Written 798950 spots for SRR7230810.sra Read 798950 spots for SRR7230810.sra Written 798950 spots for SRR7230810.sra Read 798950 spots for SRR7230810.sra Written 798950 spots for SRR7230810.sra Read 798950 spots for SRR7230810.sra Written 798950 spots for SRR7230810.sra Read 798950 spots for SRR7230810.sra Written 798950 spots for SRR7230810.sra Read 798950 spots for SRR7230810.sra Written 798950 spots for SRR7230810.sra Read 798950 spots for SRR7230810.sra Written 798950 spots for SRR7230810.sra Read 798950 spots for SRR7230810.sra Written 798950 spots for SRR7230810.sra Read 798950 spots for SRR7230810.sra Written 798950 spots for SRR7230810.sra Read 798964 spots for SRR7230810.sra Written 798964 spots for SRR7230810.sra SRR ids: ['SRR7230810.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1egw65vs SRR7230810.sra spots: 15979014 blocks: [[1, 798950], [798951, 1597900], [1597901, 2396850], [2396851, 3195800], [3195801, 3994750], [3994751, 4793700], [4793701, 5592650], [5592651, 6391600], [6391601, 7190550], [7190551, 7989500], [7989501, 8788450], [8788451, 9587400], [9587401, 10386350], [10386351, 11185300], [11185301, 11984250], [11984251, 12783200], [12783201, 13582150], [13582151, 14381100], [14381101, 15180050], [15180051, 15979014]] SRR7230810 file size 5393063 SRR7230810 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230810 SRR7230810_1.fastq SRR7230810_2.fastq Input file: SRR7230810_1.fastq Paired file: SRR7230810_2.fastq trimmed: SRR7230810-trimmed-pair1.fastq, SRR7230810-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:37:30 2025 >> started Tue Feb 11 09:37:47 2025 >> done (16.509s) 15979014 read pairs processed; of these: 9138 ( 0.06%) short read pairs filtered out after trimming by size control 8978 ( 0.06%) empty read pairs filtered out after trimming by size control 15960898 (99.89%) read pairs available; of these: 7121722 (44.62%) trimmed read pairs available after processing 8839176 (55.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 0 0.00% 21 6 0.00% 22 2 0.00% 23 5 0.00% 24 0 0.00% 25 4 0.00% 26 3 0.00% 27 5 0.00% 28 5 0.00% 29 2 0.00% 30 3 0.00% 31 8 0.00% 32 7 0.00% 33 4 0.00% 34 7 0.00% 35 3 0.00% 36 4 0.00% 37 18 0.00% 38 19 0.00% 39 11 0.00% 40 19 0.00% 41 19 0.00% 42 18 0.00% 43 20 0.00% 44 24 0.00% 45 22 0.00% 46 22 0.00% 47 30 0.00% 48 30 0.00% 49 41 0.00% 50 51 0.00% 51 56 0.00% 52 57 0.00% 53 63 0.00% 54 72 0.00% 55 86 0.00% 56 84 0.00% 57 98 0.00% 58 135 0.00% 59 147 0.00% 60 156 0.00% 61 163 0.00% 62 226 0.00% 63 200 0.00% 64 241 0.00% 65 229 0.00% 66 313 0.00% 67 344 0.00% 68 473 0.00% 69 620 0.00% 70 653 0.00% 71 615 0.00% 72 619 0.00% 73 699 0.00% 74 808 0.01% 75 956 0.01% 76 1068 0.01% 77 1147 0.01% 78 1232 0.01% 79 1524 0.01% 80 1791 0.01% 81 1807 0.01% 82 2202 0.01% 83 2339 0.01% 84 3150 0.02% 85 3779 0.02% 86 3887 0.02% 87 4257 0.03% 88 4631 0.03% 89 4939 0.03% 90 5210 0.03% 91 5656 0.04% 92 6086 0.04% 93 6860 0.04% 94 7179 0.04% 95 7686 0.05% 96 8325 0.05% 97 8797 0.06% 98 9498 0.06% 99 10228 0.06% 100 10939 0.07% 101 11266 0.07% 102 12081 0.08% 103 13041 0.08% 104 13551 0.08% 105 14367 0.09% 106 15451 0.10% 107 16214 0.10% 108 17226 0.11% 109 18122 0.11% 110 18871 0.12% 111 19739 0.12% 112 21063 0.13% 113 21803 0.14% 114 22597 0.14% 115 23719 0.15% 116 24882 0.16% 117 26019 0.16% 118 27562 0.17% 119 28462 0.18% 120 29632 0.19% 121 30946 0.19% 122 31830 0.20% 123 33352 0.21% 124 35274 0.22% 125 36556 0.23% 126 37451 0.23% 127 38898 0.24% 128 41283 0.26% 129 43033 0.27% 130 44525 0.28% 131 46210 0.29% 132 48461 0.30% 133 51397 0.32% 134 54181 0.34% 135 56858 0.36% 136 59978 0.38% 137 64041 0.40% 138 67971 0.43% 139 72358 0.45% 140 75390 0.47% 141 81761 0.51% 142 89222 0.56% 143 100786 0.63% 144 116229 0.73% 145 136640 0.86% 146 175141 1.10% 147 222786 1.40% 148 358266 2.24% 149 685342 4.29% 150 3657140 22.91% 151 8839176 55.38% 15960898 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=21 prefix-density=0.39 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=350.39 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=16.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCT criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=15 prefix-density=0.46 prefix-fanout=2.6 sequence=TCCACTTGCACTGCTCGAGAATTGGCCGAGCGAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=53.91 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=3.1 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA SRR7230810 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:38:50 Started mapping on | Feb 11 09:38:50 Finished on | Feb 11 09:41:05 Mapping speed, Million of reads per hour | 425.62 Number of input reads | 15960898 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14599001 Uniquely mapped reads % | 91.47% Average mapped length | 294.61 Number of splices: Total | 13884176 Number of splices: Annotated (sjdb) | 13541252 Number of splices: GT/AG | 13608931 Number of splices: GC/AG | 219064 Number of splices: AT/AC | 8224 Number of splices: Non-canonical | 47957 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 471295 % of reads mapped to multiple loci | 2.95% Number of reads mapped to too many loci | 246308 % of reads mapped to too many loci | 1.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.64% % of reads unmapped: other | 0.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 900968 900968 900968 N_multimapping 471295 471295 471295 N_noFeature 710688 14322909 811806 N_ambiguous 292566 1317 116788 UnstrandedReadsAssigned:13595747 PositiveStrandReadsAssigned:274775 NegativeStrandReadsAssigned:13670407 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7230810 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230810-trimmed-pair1.fastq SRR7230810-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,960,898 reads, 13,753,650 reads pseudoaligned [quant] estimated average fragment length: 244.739 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 SRR7230810.ke.tsv 34699 SRR7230810.se.tsv 87100 total ==> SRR7230810.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.26 588 20.1445 Potri.005G024800.1.v4.1 1035 791.261 81 6.22246 Potri.004G059700.1.v4.1 961 717.354 3 0.254205 Potri.007G009000.2.v4.1 1416 1172.26 0 0 Potri.003G141000.2.v4.1 2943 2699.26 907 20.4249 Potri.016G087400.1.v4.1 270 79.9821 769.052 584.467 Potri.015G069301.1.v4.1 564 326.76 0 0 Potri.010G195200.1.v4.1 1773 1529.26 126 5.00825 Potri.012G127500.1.v4.1 977 733.305 88 7.29449 ==> SRR7230810.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 718 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 256 Potri.001G212900.v4.1 53 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7230810 completed mapping pipeline successfully