Starting /dee2/code/volunteer_pipeline.sh SRR7230811 current disk space = 3054661730304 free memory = 1505125388 SRR7230811 SRAfilesize a5409c205f92adaec7b7030d8b229c7d SRR7230811.sra SRR7230811.sra file validated SRR7230811 is paired end SRR7230811 is conventional basespace SRR7230811 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230811_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.4205 34.0 33.0 34.0 33.0 34.0 2 33.5085 34.0 34.0 34.0 33.0 34.0 3 33.48475 34.0 34.0 34.0 33.0 34.0 4 33.47925 34.0 34.0 34.0 33.0 34.0 5 33.487 34.0 34.0 34.0 33.0 34.0 6 37.3035 38.0 38.0 38.0 36.0 38.0 7 37.48925 38.0 38.0 38.0 37.0 38.0 8 37.43 38.0 38.0 38.0 37.0 38.0 9 37.6135 38.0 38.0 38.0 38.0 38.0 10-14 37.609750000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.5194 38.0 38.0 38.0 37.6 38.0 20-24 37.6452 38.0 38.0 38.0 38.0 38.0 25-29 37.5245 38.0 38.0 38.0 38.0 38.0 30-34 37.411 38.0 38.0 38.0 37.6 38.0 35-39 37.35215000000001 38.0 38.0 38.0 37.0 38.0 40-44 36.9913 38.0 38.0 38.0 36.2 38.0 45-49 37.2411 38.0 38.0 38.0 36.8 38.0 50-54 37.35705 38.0 38.0 38.0 37.0 38.0 55-59 37.35875 38.0 38.0 38.0 37.0 38.0 60-64 37.286199999999994 38.0 38.0 38.0 37.0 38.0 65-69 37.29815 38.0 38.0 38.0 37.0 38.0 70-74 32.0863 38.0 26.6 38.0 15.8 38.0 75-79 33.07405000000001 38.0 35.8 38.0 9.8 38.0 80-84 35.442899999999995 38.0 38.0 38.0 30.8 38.0 85-89 36.3846 38.0 38.0 38.0 34.4 38.0 90-94 36.6231 38.0 38.0 38.0 34.4 38.0 95-99 36.757400000000004 38.0 38.0 38.0 35.2 38.0 100-104 36.63705 38.0 38.0 38.0 34.6 38.0 105-109 36.09155 38.0 37.4 38.0 30.4 38.0 110-114 36.27785 38.0 37.4 38.0 33.0 38.0 115-119 36.191950000000006 38.0 37.6 38.0 33.2 38.0 120-124 35.98135 38.0 37.4 38.0 33.0 38.0 125-129 35.3831 38.0 36.2 38.0 28.8 38.0 130-134 35.648849999999996 38.0 36.0 38.0 31.4 38.0 135-139 35.6343 38.0 36.0 38.0 31.2 38.0 140-144 35.446299999999994 38.0 36.0 38.0 31.2 38.0 145-149 34.7404 38.0 35.6 38.0 28.8 38.0 150-151 31.1735 35.5 30.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 2.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 2.0 14 1.0 15 2.0 16 0.0 17 0.0 18 4.0 19 1.0 20 1.0 21 4.0 22 4.0 23 7.0 24 4.0 25 11.0 26 14.0 27 21.0 28 25.0 29 30.0 30 44.0 31 66.0 32 93.0 33 126.0 34 233.0 35 381.0 36 691.0 37 2231.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.341170585292645 13.506753376688344 10.155077538769385 43.99699849924962 2 18.775 20.625 37.775 22.825 3 20.150000000000002 24.525 25.374999999999996 29.95 4 22.475 33.825 21.85 21.85 5 21.575 37.025000000000006 23.125 18.275 6 16.900000000000002 36.3 26.6 20.200000000000003 7 13.125 23.025000000000002 44.824999999999996 19.025 8 17.25 24.175 31.574999999999996 27.0 9 16.650000000000002 23.599999999999998 34.125 25.624999999999996 10-14 19.425 30.049999999999997 26.455000000000002 24.07 15-19 19.575 28.060000000000002 28.005000000000003 24.36 20-24 19.580000000000002 29.15 27.575 23.695 25-29 19.38 28.804999999999996 27.700000000000003 24.115000000000002 30-34 19.25 28.625 27.834999999999997 24.29 35-39 20.324064812962593 28.52070414082817 27.30546109221844 23.849769953990798 40-44 20.73262272931992 28.244007406295353 27.493369363959363 23.53000050042536 45-49 20.205000000000002 28.749999999999996 27.07 23.974999999999998 50-54 19.78 28.7 27.24 24.279999999999998 55-59 19.89 28.444999999999997 27.38 24.285 60-64 20.00300045006751 28.50927639145872 27.314097114567186 24.173626043906584 65-69 20.555 28.42 26.87 24.154999999999998 70-74 19.974679173620302 28.91753467226794 27.628474420210626 23.479311733901135 75-79 19.770979697958733 28.030093488963875 28.0632848370858 24.135641975991593 80-84 20.085115216940004 28.036122067676978 27.51193689018061 24.366825825202408 85-89 20.536526220066687 28.336869758512677 27.179953521269073 23.946650500151563 90-94 20.065146579804562 27.61713856176397 27.662240040090204 24.65547481834127 95-99 20.596477181745396 28.012409927942354 27.096677341873498 24.29443554843875 100-104 20.947468576293254 28.188692473333667 26.871651059141673 23.99218789123141 105-109 20.64825930372149 28.42637054821929 27.29591836734694 23.629451780712284 110-114 21.128169225383807 27.23908586287943 27.804170625593837 23.82857428614292 115-119 21.223814773980155 27.914202666132105 27.057231632755336 23.804750927132403 120-124 21.055273859129475 28.415081078367386 26.728249410110948 23.801395652392188 125-129 20.82 28.244999999999997 26.36 24.575 130-134 21.12 28.33 26.715 23.835 135-139 20.849999999999998 27.815 26.86 24.474999999999998 140-144 20.86 27.705000000000002 27.08 24.355 145-149 21.135362434921905 27.96355626752102 26.21145374449339 24.689627553063676 150-151 21.6 28.000000000000004 26.625 23.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 1.0 22 2.5 23 5.0 24 3.5 25 2.0 26 7.5 27 10.5 28 12.5 29 19.0 30 27.0 31 31.5 32 44.5 33 60.5 34 70.5 35 90.0 36 111.0 37 129.5 38 157.5 39 196.0 40 207.5 41 200.0 42 214.5 43 239.0 44 235.0 45 238.5 46 250.5 47 234.5 48 203.5 49 177.5 50 159.5 51 136.5 52 106.0 53 80.5 54 76.0 55 63.0 56 49.5 57 38.5 58 25.5 59 24.5 60 19.0 61 9.5 62 5.0 63 3.0 64 4.5 65 3.5 66 1.0 67 2.5 68 2.5 69 0.5 70 0.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.02 40-44 0.08499999999999999 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.015 65-69 0.0 70-74 13.114999999999998 75-79 9.615 80-84 3.66 85-89 1.03 90-94 0.22499999999999998 95-99 0.08 100-104 0.155 105-109 0.04 110-114 0.015 115-119 0.22999999999999998 120-124 0.40499999999999997 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.12 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1672975018925 98.25 2 0.7317688619732526 1.4500000000000002 3 0.10093363613424174 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.07500000000000001 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.5249999999999999 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.8500000000000001 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.4500000000000002 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.9375 0.0 0.0 0.0 0.0 114-115 2.275 0.0 0.0 0.0 0.0 116-117 2.6375 0.0 0.0 0.0 0.0 118-119 2.875 0.0 0.0 0.0 0.0 120-121 3.2125000000000004 0.0 0.0 0.0 0.0 122-123 3.675 0.0 0.0 0.0 0.0 124-125 4.0875 0.0 0.0 0.0 0.0 126-127 4.4625 0.0 0.0 0.0 0.0 128-129 4.85 0.0 0.0 0.0 0.0 130-131 5.35 0.0 0.0 0.0 0.0 132-133 6.025 0.0 0.0 0.0 0.0 134-135 6.737500000000001 0.0 0.0 0.0 0.0 136-137 7.2625 0.0 0.0 0.0 0.0 138-139 7.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7230811 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230811_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.52375 33.0 33.0 34.0 32.0 34.0 2 33.03825 34.0 33.0 34.0 32.0 34.0 3 33.0785 34.0 33.0 34.0 32.0 34.0 4 33.00075 34.0 33.0 34.0 32.0 34.0 5 33.07675 34.0 33.0 34.0 33.0 34.0 6 37.19225 38.0 38.0 38.0 37.0 38.0 7 37.2015 38.0 38.0 38.0 37.0 38.0 8 37.16975 38.0 38.0 38.0 37.0 38.0 9 37.123 38.0 38.0 38.0 37.0 38.0 10-14 37.012649999999994 38.0 38.0 38.0 36.6 38.0 15-19 37.165049999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.112 38.0 38.0 38.0 37.0 38.0 25-29 37.03715 38.0 38.0 38.0 37.0 38.0 30-34 37.1007 38.0 38.0 38.0 37.0 38.0 35-39 36.829499999999996 38.0 38.0 38.0 36.4 38.0 40-44 36.6233 38.0 38.0 38.0 35.4 38.0 45-49 36.83475 38.0 38.0 38.0 36.2 38.0 50-54 36.8202 38.0 38.0 38.0 35.8 38.0 55-59 36.79390000000001 38.0 38.0 38.0 36.0 38.0 60-64 36.9345 38.0 38.0 38.0 36.2 38.0 65-69 36.870599999999996 38.0 38.0 38.0 36.4 38.0 70-74 36.8374 38.0 38.0 38.0 36.0 38.0 75-79 36.83845 38.0 38.0 38.0 36.0 38.0 80-84 36.824600000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.774899999999995 38.0 38.0 38.0 36.0 38.0 90-94 36.682249999999996 38.0 38.0 38.0 35.8 38.0 95-99 36.59655 38.0 38.0 38.0 34.8 38.0 100-104 35.870599999999996 38.0 37.6 38.0 32.0 38.0 105-109 36.183550000000004 38.0 38.0 38.0 33.8 38.0 110-114 36.23010000000001 38.0 38.0 38.0 34.0 38.0 115-119 36.18935 38.0 38.0 38.0 34.0 38.0 120-124 35.82875 38.0 37.6 38.0 32.8 38.0 125-129 35.4807 38.0 36.8 38.0 30.4 38.0 130-134 35.4477 38.0 36.6 38.0 31.2 38.0 135-139 35.07455 38.0 36.0 38.0 29.4 38.0 140-144 34.705349999999996 38.0 35.8 38.0 27.6 38.0 145-149 34.1553 38.0 35.4 38.0 26.8 38.0 150-151 29.543125 35.5 26.5 38.0 10.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 3.0 5 2.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 2.0 12 1.0 13 2.0 14 2.0 15 4.0 16 6.0 17 0.0 18 8.0 19 3.0 20 9.0 21 5.0 22 13.0 23 6.0 24 8.0 25 16.0 26 28.0 27 23.0 28 29.0 29 34.0 30 50.0 31 44.0 32 58.0 33 77.0 34 129.0 35 213.0 36 479.0 37 2736.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.09718345597564 17.00076122811469 13.676731793960922 32.225323521948745 2 23.9 23.799999999999997 36.875 15.425 3 20.9 25.775 32.725 20.599999999999998 4 25.775 34.075 21.45 18.7 5 25.8 35.75 22.125 16.325 6 19.725 37.35 24.6 18.325 7 19.375 17.974999999999998 42.575 20.075000000000003 8 21.0 23.35 27.3 28.349999999999998 9 22.075 23.674999999999997 29.475 24.775 10-14 23.5029266096353 28.200510280654363 26.214417929861423 22.082145179848915 15-19 24.095 27.46 27.51 20.935000000000002 20-24 23.505577509879448 28.117652943824723 27.982592166474912 20.394177379820917 25-29 24.258490471665084 27.81973690791777 27.314560096033613 20.607212524383534 30-34 23.684210526315788 27.601560936561935 27.516509905943565 21.19771863117871 35-39 23.614722944588916 27.58551710342068 27.980596119223843 20.819163832766556 40-44 23.279311724689876 27.761104441776713 27.3359343737495 21.623649459783913 45-49 23.45462735872666 27.06842184293508 27.914310025526802 21.562640772811452 50-54 23.490268674638514 27.39280532346025 28.133286636313603 20.98363936558763 55-59 23.924475384384234 26.98452446536786 27.725747483347522 21.365252666900385 60-64 24.16224867460238 27.233169950985296 27.45323597079124 21.151345403621086 65-69 24.127572222500376 27.061533069644018 28.17303359535373 20.637861112501877 70-74 24.21710855427714 27.583791895947975 27.058529264632313 21.14057028514257 75-79 23.956769738817172 27.874512158510957 26.85880116081257 21.309916941859303 80-84 24.22711355677839 27.428714357178592 27.458729364682345 20.885442721360683 85-89 24.075279042995145 27.644026227538916 27.864257470343862 20.416437259122077 90-94 23.456110499449505 27.52477229506556 27.960164147732957 21.058953057751978 95-99 24.419883976795358 27.61052210442088 27.290458091618326 20.67913582716543 100-104 24.213632044806722 27.04905735860379 27.959193879081862 20.778116717507626 105-109 23.705926481620406 27.76194048512128 27.45686421605401 21.0752688172043 110-114 24.165 27.485 27.779999999999998 20.57 115-119 25.09 27.700000000000003 27.415 19.794999999999998 120-124 24.664932986597318 27.2004400880176 28.035607121424285 20.09901980396079 125-129 24.633475106329747 27.495621716287218 27.835876907680763 20.03502626970228 130-134 25.314999999999998 27.295 27.355 20.035 135-139 25.08001600320064 27.385477095419088 27.325465093018604 20.209041808361672 140-144 25.092564795356747 28.04463124186931 26.85880116081257 20.004002801961374 145-149 25.63884582687403 28.364254638195728 26.77401610241536 19.222883432514877 150-151 26.7625 27.525 26.5125 19.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 0.5 23 0.5 24 2.5 25 4.0 26 4.5 27 5.0 28 5.5 29 10.5 30 20.0 31 22.5 32 19.5 33 28.5 34 51.0 35 60.0 36 67.5 37 95.5 38 119.0 39 144.0 40 160.0 41 199.5 42 229.5 43 228.0 44 248.5 45 262.5 46 266.5 47 271.5 48 255.5 49 219.5 50 189.5 51 160.5 52 133.5 53 115.5 54 101.0 55 77.0 56 52.0 57 38.5 58 32.5 59 25.5 60 15.0 61 11.0 62 13.5 63 10.0 64 3.0 65 1.5 66 2.0 67 1.0 68 2.0 69 2.5 70 2.0 71 1.0 72 0.5 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.055 15-19 0.0 20-24 0.045 25-29 0.034999999999999996 30-34 0.06 35-39 0.02 40-44 0.04 45-49 0.105 50-54 0.065 55-59 0.165 60-64 0.03 65-69 0.135 70-74 0.05 75-79 0.06999999999999999 80-84 0.05 85-89 0.105 90-94 0.09 95-99 0.02 100-104 0.015 105-109 0.025 110-114 0.0 115-119 0.0 120-124 0.02 125-129 0.075 130-134 0.0 135-139 0.02 140-144 0.06999999999999999 145-149 0.015 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1625 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 0.9875 0.0 0.0 0.0 0.0 104-105 1.2 0.0 0.0 0.0 0.0 106-107 1.4249999999999998 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.6125 0.0 0.0 0.0 0.0 112-113 1.9874999999999998 0.0 0.0 0.0 0.0 114-115 2.35 0.0 0.0 0.0 0.0 116-117 2.7249999999999996 0.0 0.0 0.0 0.0 118-119 3.0 0.0 0.0 0.0 0.0 120-121 3.3375000000000004 0.0 0.0 0.0 0.0 122-123 3.8 0.0 0.0 0.0 0.0 124-125 4.2125 0.0 0.0 0.0 0.0 126-127 4.5875 0.0 0.0 0.0 0.0 128-129 4.9625 0.0 0.0 0.0 0.0 130-131 5.5 0.0 0.0 0.0 0.0 132-133 6.175 0.0 0.0 0.0 0.0 134-135 6.85 0.0 0.0 0.0 0.0 136-137 7.3375 0.0 0.0 0.0 0.0 138-139 7.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATTCTA 10 0.0069071017 144.46251 4 AAAAAAA 90 3.3740985E-4 12.84111 15-19 >>END_MODULE Read 720738 spots for SRR7230811.sra Written 720738 spots for SRR7230811.sra Read 720738 spots for SRR7230811.sra Written 720738 spots for SRR7230811.sra Read 720738 spots for SRR7230811.sra Written 720738 spots for SRR7230811.sra Read 720738 spots for SRR7230811.sra Written 720738 spots for SRR7230811.sra Read 720738 spots for SRR7230811.sra Written 720738 spots for SRR7230811.sra Read 720738 spots for SRR7230811.sra Written 720738 spots for SRR7230811.sra Read 720738 spots for SRR7230811.sra Written 720738 spots for SRR7230811.sra Read 720738 spots for SRR7230811.sra Written 720738 spots for SRR7230811.sra Read 720738 spots for SRR7230811.sra Written 720738 spots for SRR7230811.sra Read 720738 spots for SRR7230811.sra Written 720738 spots for SRR7230811.sra Read 720738 spots for SRR7230811.sra Written 720738 spots for SRR7230811.sra Read 720742 spots for SRR7230811.sra Written 720742 spots for SRR7230811.sra Read 720738 spots for SRR7230811.sra Written 720738 spots for SRR7230811.sra Read 720738 spots for SRR7230811.sra Written 720738 spots for SRR7230811.sra Read 720738 spots for SRR7230811.sra Written 720738 spots for SRR7230811.sra Read 720738 spots for SRR7230811.sra Written 720738 spots for SRR7230811.sra Read 720738 spots for SRR7230811.sra Written 720738 spots for SRR7230811.sra Read 720738 spots for SRR7230811.sra Written 720738 spots for SRR7230811.sra Read 720738 spots for SRR7230811.sra Written 720738 spots for SRR7230811.sra Read 720738 spots for SRR7230811.sra Written 720738 spots for SRR7230811.sra SRR ids: ['SRR7230811.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rggkwvx_ SRR7230811.sra spots: 14414764 blocks: [[1, 720738], [720739, 1441476], [1441477, 2162214], [2162215, 2882952], [2882953, 3603690], [3603691, 4324428], [4324429, 5045166], [5045167, 5765904], [5765905, 6486642], [6486643, 7207380], [7207381, 7928118], [7928119, 8648856], [8648857, 9369594], [9369595, 10090332], [10090333, 10811070], [10811071, 11531808], [11531809, 12252546], [12252547, 12973284], [12973285, 13694022], [13694023, 14414764]] SRR7230811 file size 4862990 SRR7230811 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230811 SRR7230811_1.fastq SRR7230811_2.fastq Input file: SRR7230811_1.fastq Paired file: SRR7230811_2.fastq trimmed: SRR7230811-trimmed-pair1.fastq, SRR7230811-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:38:57 2025 >> started Tue Feb 11 09:39:15 2025 >> done (17.175s) 14414764 read pairs processed; of these: 8544 ( 0.06%) short read pairs filtered out after trimming by size control 11533 ( 0.08%) empty read pairs filtered out after trimming by size control 14394687 (99.86%) read pairs available; of these: 6541316 (45.44%) trimmed read pairs available after processing 7853371 (54.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 0 0.00% 23 1 0.00% 24 2 0.00% 25 2 0.00% 26 1 0.00% 27 7 0.00% 28 4 0.00% 29 5 0.00% 30 8 0.00% 31 5 0.00% 32 5 0.00% 33 12 0.00% 34 5 0.00% 35 16 0.00% 36 9 0.00% 37 13 0.00% 38 25 0.00% 39 14 0.00% 40 18 0.00% 41 19 0.00% 42 18 0.00% 43 26 0.00% 44 23 0.00% 45 30 0.00% 46 29 0.00% 47 40 0.00% 48 44 0.00% 49 49 0.00% 50 64 0.00% 51 77 0.00% 52 77 0.00% 53 77 0.00% 54 102 0.00% 55 113 0.00% 56 109 0.00% 57 131 0.00% 58 128 0.00% 59 164 0.00% 60 209 0.00% 61 250 0.00% 62 289 0.00% 63 265 0.00% 64 311 0.00% 65 380 0.00% 66 379 0.00% 67 449 0.00% 68 609 0.00% 69 767 0.01% 70 929 0.01% 71 784 0.01% 72 850 0.01% 73 902 0.01% 74 1007 0.01% 75 1136 0.01% 76 1288 0.01% 77 1440 0.01% 78 1568 0.01% 79 1881 0.01% 80 2202 0.02% 81 2239 0.02% 82 2730 0.02% 83 3011 0.02% 84 3861 0.03% 85 4371 0.03% 86 4685 0.03% 87 5001 0.03% 88 5447 0.04% 89 5885 0.04% 90 6331 0.04% 91 6754 0.05% 92 7437 0.05% 93 8057 0.06% 94 8668 0.06% 95 9416 0.07% 96 9982 0.07% 97 10641 0.07% 98 11517 0.08% 99 12220 0.08% 100 12790 0.09% 101 13659 0.09% 102 14404 0.10% 103 15356 0.11% 104 16259 0.11% 105 17511 0.12% 106 18340 0.13% 107 19217 0.13% 108 20310 0.14% 109 21747 0.15% 110 22404 0.16% 111 23240 0.16% 112 24661 0.17% 113 25540 0.18% 114 26729 0.19% 115 28014 0.19% 116 28986 0.20% 117 30192 0.21% 118 31416 0.22% 119 32976 0.23% 120 34092 0.24% 121 35306 0.25% 122 36840 0.26% 123 38727 0.27% 124 39611 0.28% 125 41003 0.28% 126 42360 0.29% 127 43905 0.31% 128 45647 0.32% 129 47423 0.33% 130 49659 0.34% 131 51440 0.36% 132 53321 0.37% 133 56194 0.39% 134 58026 0.40% 135 61192 0.43% 136 64141 0.45% 137 67486 0.47% 138 71173 0.49% 139 74563 0.52% 140 77572 0.54% 141 83878 0.58% 142 89074 0.62% 143 99314 0.69% 144 112774 0.78% 145 129241 0.90% 146 161173 1.12% 147 199300 1.38% 148 308677 2.14% 149 575299 4.00% 150 3101528 21.55% 151 7853371 54.56% 14394687 reads passed initial QC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=28 prefix-density=0.76 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTTCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=76.81 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=9.6 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=28 prefix-density=0.39 prefix-fanout=2.0 sequence=CTACCCATGTTTGGATGCACTGAGGCATCTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=54.58 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=3.1 sequence=ACACAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA SRR7230811 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:40:02 Started mapping on | Feb 11 09:40:03 Finished on | Feb 11 09:42:20 Mapping speed, Million of reads per hour | 378.25 Number of input reads | 14394687 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13173943 Uniquely mapped reads % | 91.52% Average mapped length | 293.35 Number of splices: Total | 12171069 Number of splices: Annotated (sjdb) | 11888625 Number of splices: GT/AG | 11935410 Number of splices: GC/AG | 191618 Number of splices: AT/AC | 7709 Number of splices: Non-canonical | 36332 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 384536 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 282809 % of reads mapped to too many loci | 1.96% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.34% % of reads unmapped: other | 0.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 845624 845624 845624 N_multimapping 384536 384536 384536 N_noFeature 516222 12895076 608971 N_ambiguous 279411 1082 92649 UnstrandedReadsAssigned:12378310 PositiveStrandReadsAssigned:277785 NegativeStrandReadsAssigned:12472323 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7230811 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230811-trimmed-pair1.fastq SRR7230811-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,394,687 reads, 12,643,447 reads pseudoaligned [quant] estimated average fragment length: 230.099 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,055 rounds 52401 SRR7230811.ke.tsv 34699 SRR7230811.se.tsv 87100 total ==> SRR7230811.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.9 667 23.3924 Potri.005G024800.1.v4.1 1035 805.901 164 12.7672 Potri.004G059700.1.v4.1 961 731.929 3 0.25715 Potri.007G009000.2.v4.1 1416 1186.9 0 0 Potri.003G141000.2.v4.1 2943 2713.9 936 21.638 Potri.016G087400.1.v4.1 270 85.0551 848 625.504 Potri.015G069301.1.v4.1 564 338.782 0 0 Potri.010G195200.1.v4.1 1773 1543.9 125 5.07955 Potri.012G127500.1.v4.1 977 747.913 104 8.72403 ==> SRR7230811.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 536 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 284 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 134 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7230811 completed mapping pipeline successfully