Starting /dee2/code/volunteer_pipeline.sh SRR7230812 current disk space = 3055061954560 free memory = 1448429216 SRR7230812 SRAfilesize 0e42387d60f3ba41ab827d418f65fea2 SRR7230812.sra SRR7230812.sra file validated SRR7230812 is paired end SRR7230812 is conventional basespace SRR7230812 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230812_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.35275 34.0 33.0 34.0 33.0 34.0 2 33.4735 34.0 34.0 34.0 33.0 34.0 3 33.44625 34.0 34.0 34.0 33.0 34.0 4 33.39425 34.0 34.0 34.0 33.0 34.0 5 33.42575 34.0 34.0 34.0 33.0 34.0 6 37.2195 38.0 38.0 38.0 36.0 38.0 7 37.46575 38.0 38.0 38.0 37.0 38.0 8 37.47875 38.0 38.0 38.0 37.0 38.0 9 37.57575 38.0 38.0 38.0 38.0 38.0 10-14 37.563300000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.4033 38.0 38.0 38.0 37.4 38.0 20-24 37.568799999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.476600000000005 38.0 38.0 38.0 37.8 38.0 30-34 37.3861 38.0 38.0 38.0 37.8 38.0 35-39 37.3369 38.0 38.0 38.0 37.0 38.0 40-44 36.9979 38.0 38.0 38.0 36.0 38.0 45-49 37.25025000000001 38.0 38.0 38.0 36.8 38.0 50-54 37.31205 38.0 38.0 38.0 37.0 38.0 55-59 37.315099999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.199850000000005 38.0 38.0 38.0 36.8 38.0 65-69 37.219800000000006 38.0 38.0 38.0 37.0 38.0 70-74 32.5081 38.0 26.8 38.0 15.6 38.0 75-79 33.334250000000004 38.0 36.4 38.0 14.2 38.0 80-84 35.495000000000005 38.0 37.8 38.0 30.8 38.0 85-89 36.3273 38.0 38.0 38.0 34.0 38.0 90-94 36.611 38.0 38.0 38.0 34.6 38.0 95-99 36.64975 38.0 38.0 38.0 35.0 38.0 100-104 36.57885 38.0 38.0 38.0 34.6 38.0 105-109 36.0837 38.0 37.4 38.0 31.8 38.0 110-114 36.1993 38.0 37.6 38.0 33.0 38.0 115-119 35.981399999999994 38.0 37.6 38.0 32.4 38.0 120-124 35.82255 38.0 37.0 38.0 31.8 38.0 125-129 35.242 38.0 35.8 38.0 28.4 38.0 130-134 35.475049999999996 38.0 36.0 38.0 31.0 38.0 135-139 35.30045 38.0 36.0 38.0 31.0 38.0 140-144 35.0372 38.0 36.0 38.0 29.4 38.0 145-149 34.20715 38.0 34.4 38.0 25.8 38.0 150-151 30.819249999999997 35.5 29.5 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 2.0 16 1.0 17 2.0 18 4.0 19 1.0 20 2.0 21 7.0 22 10.0 23 10.0 24 7.0 25 9.0 26 9.0 27 29.0 28 26.0 29 42.0 30 51.0 31 73.0 32 85.0 33 122.0 34 253.0 35 371.0 36 711.0 37 2171.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.425 13.425 10.4 43.75 2 21.349999999999998 20.575 37.625 20.45 3 19.125 25.174999999999997 25.775 29.925 4 22.975 34.050000000000004 21.625 21.349999999999998 5 21.275 36.25 25.1 17.375 6 16.725 36.3 26.950000000000003 20.025000000000002 7 14.224999999999998 21.5 44.2 20.075000000000003 8 17.0 22.650000000000002 30.875000000000004 29.475 9 16.975 22.1 33.300000000000004 27.625 10-14 20.435 29.544999999999998 26.14 23.880000000000003 15-19 20.169999999999998 27.82 27.855 24.154999999999998 20-24 20.44 28.494999999999997 27.229999999999997 23.835 25-29 20.005 28.675 27.525 23.794999999999998 30-34 20.185 28.754999999999995 27.41 23.65 35-39 20.136006800340017 29.401470073503678 27.251362568128407 23.211160558027903 40-44 20.372130245585954 28.925123793327668 27.069474316010606 23.633271645075776 45-49 20.580000000000002 28.735 26.415 24.27 50-54 20.669999999999998 28.465 27.405 23.46 55-59 20.595 28.92 27.029999999999998 23.455000000000002 60-64 20.621186355906772 28.523557067120137 27.478243473041914 23.37701310393118 65-69 20.8 28.025 27.384999999999998 23.79 70-74 20.816535120095395 28.215319970473 27.516892851058998 23.451252058372607 75-79 19.76808089690042 28.77005935370411 27.692899538360077 23.76896021103539 80-84 20.58945405573397 28.094892779446806 28.094892779446806 23.220760385372426 85-89 20.1757043320206 29.046753509037664 27.45127739068969 23.326264768252045 90-94 20.151272290122222 27.920256461630938 27.609697455419756 24.318773792827088 95-99 21.09003553375707 27.56618787848456 28.36194384665432 22.98183274110405 100-104 20.56584877315974 28.592889334001004 27.060590886329493 23.780671006509767 105-109 20.65032516258129 28.189094547273637 27.763881940970485 23.39669834917459 110-114 20.81812271840776 28.05420813121968 27.689153373005954 23.438515777366607 115-119 20.36777232187594 28.60006012626516 27.061829842669603 23.970337709189298 120-124 20.72460859092734 28.226615816940985 27.50903251706142 23.539743075070252 125-129 21.14 27.939999999999998 27.455000000000002 23.465 130-134 21.605 28.084999999999997 26.625 23.685000000000002 135-139 21.42 28.1 26.939999999999998 23.54 140-144 21.906095304765238 27.961398069903492 26.3913195659783 23.741187059352967 145-149 21.307372741378448 28.0894939686671 26.532859502477603 24.07027378747685 150-151 21.492873218304574 27.28182045511378 26.406601650412604 24.81870467616904 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 2.0 23 3.0 24 3.0 25 4.0 26 5.0 27 9.0 28 15.0 29 22.0 30 29.5 31 27.0 32 37.5 33 58.0 34 66.5 35 85.0 36 106.0 37 124.0 38 150.5 39 181.0 40 198.0 41 210.5 42 234.5 43 251.5 44 256.0 45 265.5 46 254.5 47 228.5 48 202.0 49 177.0 50 158.0 51 128.5 52 102.5 53 89.0 54 77.5 55 58.5 56 41.5 57 35.0 58 27.0 59 20.0 60 19.5 61 12.5 62 8.5 63 6.0 64 2.0 65 0.5 66 0.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.034999999999999996 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.03 65-69 0.0 70-74 11.945 75-79 9.02 80-84 3.47 85-89 0.97 90-94 0.18 95-99 0.095 100-104 0.15 105-109 0.05 110-114 0.015 115-119 0.21 120-124 0.36 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.105 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3704356585243 98.65 2 0.528834046839587 1.05 3 0.1007302946361118 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.8375 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.175 0.0 0.0 0.0 0.0 110-111 1.45 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 2.0125 0.0 0.0 0.0 0.0 116-117 2.2125000000000004 0.0 0.0 0.0 0.0 118-119 2.4875 0.0 0.0 0.0 0.0 120-121 2.9124999999999996 0.0 0.0 0.0 0.0 122-123 3.3 0.0 0.0 0.0 0.0 124-125 3.65 0.0 0.0 0.0 0.0 126-127 4.1375 0.0 0.0 0.0 0.0 128-129 4.4125 0.0 0.0 0.0 0.0 130-131 4.887499999999999 0.0 0.0 0.0 0.0 132-133 5.3625 0.0 0.0 0.0 0.0 134-135 5.9 0.0 0.0 0.0 0.0 136-137 6.475 0.0 0.0 0.0 0.0 138-139 6.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGCTG 10 0.0072447225 142.175 8 >>END_MODULE SRR7230812 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230812_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.512 33.0 33.0 34.0 32.0 34.0 2 33.00325 34.0 33.0 34.0 32.0 34.0 3 33.11875 34.0 33.0 34.0 32.0 34.0 4 33.017 34.0 33.0 34.0 32.0 34.0 5 33.04425 34.0 33.0 34.0 32.0 34.0 6 37.24025 38.0 38.0 38.0 37.0 38.0 7 37.18475 38.0 38.0 38.0 37.0 38.0 8 37.15325 38.0 38.0 38.0 37.0 38.0 9 37.01175 38.0 38.0 38.0 37.0 38.0 10-14 36.89874999999999 38.0 38.0 38.0 36.2 38.0 15-19 37.150549999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.107749999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.0655 38.0 38.0 38.0 37.0 38.0 30-34 37.065650000000005 38.0 38.0 38.0 37.0 38.0 35-39 36.864900000000006 38.0 38.0 38.0 36.0 38.0 40-44 36.637649999999994 38.0 38.0 38.0 35.2 38.0 45-49 36.802150000000005 38.0 38.0 38.0 36.0 38.0 50-54 36.8032 38.0 38.0 38.0 36.0 38.0 55-59 36.76325 38.0 38.0 38.0 35.8 38.0 60-64 36.89525 38.0 38.0 38.0 36.2 38.0 65-69 36.840199999999996 38.0 38.0 38.0 36.2 38.0 70-74 36.7761 38.0 38.0 38.0 36.0 38.0 75-79 36.78445 38.0 38.0 38.0 36.0 38.0 80-84 36.73305 38.0 38.0 38.0 35.8 38.0 85-89 36.65445 38.0 38.0 38.0 36.0 38.0 90-94 36.612249999999996 38.0 38.0 38.0 35.2 38.0 95-99 36.44644999999999 38.0 38.0 38.0 34.6 38.0 100-104 35.875299999999996 38.0 37.6 38.0 32.0 38.0 105-109 36.14505 38.0 38.0 38.0 33.8 38.0 110-114 36.12965 38.0 38.0 38.0 34.0 38.0 115-119 36.0268 38.0 38.0 38.0 33.4 38.0 120-124 35.74335 38.0 37.8 38.0 32.4 38.0 125-129 35.32345 38.0 36.6 38.0 30.0 38.0 130-134 35.187799999999996 38.0 36.0 38.0 28.8 38.0 135-139 34.97385 38.0 36.0 38.0 28.2 38.0 140-144 34.525800000000004 38.0 35.2 38.0 27.2 38.0 145-149 33.867149999999995 38.0 34.2 38.0 24.2 38.0 150-151 29.568125000000002 35.5 26.5 38.0 6.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 0.0 5 2.0 6 1.0 7 1.0 8 2.0 9 0.0 10 0.0 11 0.0 12 0.0 13 4.0 14 3.0 15 1.0 16 5.0 17 4.0 18 8.0 19 3.0 20 9.0 21 10.0 22 10.0 23 13.0 24 19.0 25 24.0 26 19.0 27 24.0 28 37.0 29 35.0 30 38.0 31 55.0 32 67.0 33 80.0 34 122.0 35 216.0 36 470.0 37 2710.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.708851128582296 16.535632766928735 14.86178037027644 32.89373573421253 2 23.45 23.05 38.025 15.475 3 20.5 26.900000000000002 29.875 22.725 4 24.25 34.150000000000006 21.8 19.8 5 22.45 37.675 22.475 17.4 6 19.025 37.075 24.65 19.25 7 17.925 17.075000000000003 43.35 21.65 8 21.349999999999998 22.0 27.925 28.725 9 22.075 23.400000000000002 29.9 24.625 10-14 22.82211658744058 29.001751313485112 25.99449587190393 22.18163622717038 15-19 23.24 27.950000000000003 27.560000000000002 21.25 20-24 22.722041531148363 28.656492369276958 27.610708031023268 21.010758068551414 25-29 22.437853248637023 28.90011504026409 26.95443405191817 21.707597659180713 30-34 22.24279423538831 28.202562049639713 27.72718174539632 21.82746196957566 35-39 23.096548274137067 28.019009504752372 27.66383191595798 21.220610305152576 40-44 23.24627239067347 28.389872911037727 27.2690883618533 21.094766336435505 45-49 22.975272800080088 27.275002502753026 28.37120832916208 21.378516368004803 50-54 22.88131351053712 27.852029834309455 27.74690894528708 21.519747709866348 55-59 23.490537699008712 27.79112846700711 27.430659857815158 21.287673976169017 60-64 23.263958375025016 26.956173704222536 28.417050230138084 21.36281769061437 65-69 23.30714178469546 27.185826535208445 27.61623542365247 21.890796256443622 70-74 23.410216640816532 27.232701255816284 27.923150047530893 21.433932055836294 75-79 23.188986232790988 27.264080100125156 27.629536921151438 21.917396745932415 80-84 22.635845091564093 27.839487641348942 27.979585709996996 21.54508155708996 85-89 23.47255608974359 27.69931891025641 27.54407051282051 21.28405448717949 90-94 22.980619960939457 27.31233411788272 27.818118083028693 21.88892783814913 95-99 22.98189456837051 28.233470041012303 27.72331699509853 21.061318395518654 100-104 23.61972394478896 27.315463092618526 27.89057811562313 21.174234846969394 105-109 23.803331165908066 27.31956184664633 27.934777172010207 20.942329815435404 110-114 23.305 27.38 28.075 21.240000000000002 115-119 23.72 27.500000000000004 27.834999999999997 20.945 120-124 24.005802611175028 28.127657445850634 27.56240308138662 20.304136861587715 125-129 24.888644212001402 27.851458885941643 26.84049847354987 20.419398428507083 130-134 24.39121956097805 27.83139156957848 27.121356067803394 20.65603280164008 135-139 24.17725317595279 28.39351805541662 26.662998899669898 20.76622986896069 140-144 24.974974974974977 27.927927927927925 27.29229229229229 19.804804804804803 145-149 25.532659797939385 27.443232969890968 27.07812343703111 19.94598379513854 150-151 24.90311288911114 26.803350418802353 27.453431678959873 20.840105013126642 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 2.5 20 0.5 21 1.0 22 1.0 23 2.0 24 2.0 25 2.0 26 3.5 27 2.5 28 5.0 29 10.5 30 14.0 31 19.5 32 29.5 33 39.5 34 41.5 35 53.0 36 83.5 37 98.0 38 122.0 39 165.5 40 199.0 41 224.0 42 246.0 43 264.0 44 255.0 45 244.0 46 260.5 47 265.0 48 230.5 49 197.0 50 180.0 51 150.0 52 123.0 53 101.0 54 79.0 55 68.0 56 58.5 57 44.5 58 29.5 59 24.0 60 17.5 61 8.5 62 8.5 63 9.0 64 4.5 65 2.0 66 2.0 67 1.5 68 1.0 69 0.5 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.075 15-19 0.0 20-24 0.075 25-29 0.034999999999999996 30-34 0.08 35-39 0.05 40-44 0.06999999999999999 45-49 0.11 50-54 0.11499999999999999 55-59 0.13 60-64 0.06 65-69 0.095 70-74 0.065 75-79 0.125 80-84 0.06999999999999999 85-89 0.16 90-94 0.155 95-99 0.03 100-104 0.02 105-109 0.034999999999999996 110-114 0.0 115-119 0.0 120-124 0.045 125-129 0.095 130-134 0.005 135-139 0.03 140-144 0.1 145-149 0.03 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21677614957048 98.175 2 0.631632137443153 1.25 3 0.12632642748863063 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025265285497726126 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 8 0.2 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.2 0.0 0.0 0.0 0.0 110-111 1.4875 0.0 0.0 0.0 0.0 112-113 1.8 0.0 0.0 0.0 0.0 114-115 2.0625 0.0 0.0 0.0 0.0 116-117 2.2375 0.0 0.0 0.0 0.0 118-119 2.5125 0.0 0.0 0.0 0.0 120-121 2.975 0.0 0.0 0.0 0.0 122-123 3.3499999999999996 0.0 0.0 0.0 0.0 124-125 3.6875 0.0 0.0 0.0 0.0 126-127 4.1625 0.0 0.0 0.0 0.0 128-129 4.4625 0.0 0.0 0.0 0.0 130-131 4.9125 0.0 0.0 0.0 0.0 132-133 5.3875 0.0 0.0 0.0 0.0 134-135 5.9375 0.0 0.0 0.0 0.0 136-137 6.525 0.0 0.0 0.0 0.0 138-139 6.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCAGTT 10 0.006577216 146.82278 1 TTGGTGC 10 0.006832588 144.9875 2 >>END_MODULE Read 604405 spots for SRR7230812.sra Written 604405 spots for SRR7230812.sra Read 604405 spots for SRR7230812.sra Written 604405 spots for SRR7230812.sra Read 604405 spots for SRR7230812.sra Written 604405 spots for SRR7230812.sra Read 604405 spots for SRR7230812.sra Written 604405 spots for SRR7230812.sra Read 604405 spots for SRR7230812.sra Written 604405 spots for SRR7230812.sra Read 604405 spots for SRR7230812.sra Written 604405 spots for SRR7230812.sra Read 604405 spots for SRR7230812.sra Written 604405 spots for SRR7230812.sra Read 604405 spots for SRR7230812.sra Written 604405 spots for SRR7230812.sra Read 604405 spots for SRR7230812.sra Written 604405 spots for SRR7230812.sra Read 604405 spots for SRR7230812.sra Written 604405 spots for SRR7230812.sra Read 604405 spots for SRR7230812.sra Written 604405 spots for SRR7230812.sra Read 604405 spots for SRR7230812.sra Written 604405 spots for SRR7230812.sra Read 604405 spots for SRR7230812.sra Written 604405 spots for SRR7230812.sra Read 604405 spots for SRR7230812.sra Written 604405 spots for SRR7230812.sra Read 604405 spots for SRR7230812.sra Written 604405 spots for SRR7230812.sra Read 604405 spots for SRR7230812.sra Written 604405 spots for SRR7230812.sra Read 604405 spots for SRR7230812.sra Written 604405 spots for SRR7230812.sra Read 604405 spots for SRR7230812.sra Written 604405 spots for SRR7230812.sra Read 604412 spots for SRR7230812.sra Written 604412 spots for SRR7230812.sra Read 604405 spots for SRR7230812.sra Written 604405 spots for SRR7230812.sra SRR ids: ['SRR7230812.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qlr16gnq SRR7230812.sra spots: 12088107 blocks: [[1, 604405], [604406, 1208810], [1208811, 1813215], [1813216, 2417620], [2417621, 3022025], [3022026, 3626430], [3626431, 4230835], [4230836, 4835240], [4835241, 5439645], [5439646, 6044050], [6044051, 6648455], [6648456, 7252860], [7252861, 7857265], [7857266, 8461670], [8461671, 9066075], [9066076, 9670480], [9670481, 10274885], [10274886, 10879290], [10879291, 11483695], [11483696, 12088107]] SRR7230812 file size 4074562 SRR7230812 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230812 SRR7230812_1.fastq SRR7230812_2.fastq Input file: SRR7230812_1.fastq Paired file: SRR7230812_2.fastq trimmed: SRR7230812-trimmed-pair1.fastq, SRR7230812-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:17:29 2025 >> started Tue Feb 11 09:17:43 2025 >> done (14.367s) 12088107 read pairs processed; of these: 7579 ( 0.06%) short read pairs filtered out after trimming by size control 7958 ( 0.07%) empty read pairs filtered out after trimming by size control 12072570 (99.87%) read pairs available; of these: 5417460 (44.87%) trimmed read pairs available after processing 6655110 (55.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 1 0.00% 21 3 0.00% 22 1 0.00% 23 4 0.00% 24 5 0.00% 25 2 0.00% 26 3 0.00% 27 4 0.00% 28 1 0.00% 29 11 0.00% 30 4 0.00% 31 4 0.00% 32 6 0.00% 33 7 0.00% 34 6 0.00% 35 9 0.00% 36 9 0.00% 37 5 0.00% 38 10 0.00% 39 13 0.00% 40 14 0.00% 41 17 0.00% 42 21 0.00% 43 27 0.00% 44 23 0.00% 45 19 0.00% 46 20 0.00% 47 32 0.00% 48 39 0.00% 49 36 0.00% 50 52 0.00% 51 49 0.00% 52 46 0.00% 53 59 0.00% 54 68 0.00% 55 76 0.00% 56 71 0.00% 57 92 0.00% 58 104 0.00% 59 130 0.00% 60 140 0.00% 61 124 0.00% 62 176 0.00% 63 206 0.00% 64 214 0.00% 65 235 0.00% 66 305 0.00% 67 339 0.00% 68 398 0.00% 69 492 0.00% 70 532 0.00% 71 561 0.00% 72 628 0.01% 73 639 0.01% 74 792 0.01% 75 846 0.01% 76 981 0.01% 77 1106 0.01% 78 1181 0.01% 79 1314 0.01% 80 1540 0.01% 81 1748 0.01% 82 2047 0.02% 83 2241 0.02% 84 2827 0.02% 85 3216 0.03% 86 3301 0.03% 87 3753 0.03% 88 3948 0.03% 89 4377 0.04% 90 4661 0.04% 91 4944 0.04% 92 5265 0.04% 93 5788 0.05% 94 6142 0.05% 95 6694 0.06% 96 7178 0.06% 97 7659 0.06% 98 7988 0.07% 99 8548 0.07% 100 9221 0.08% 101 9646 0.08% 102 10188 0.08% 103 10811 0.09% 104 11310 0.09% 105 12070 0.10% 106 13020 0.11% 107 13359 0.11% 108 14138 0.12% 109 14825 0.12% 110 15678 0.13% 111 16325 0.14% 112 17359 0.14% 113 18092 0.15% 114 18510 0.15% 115 19513 0.16% 116 20630 0.17% 117 21460 0.18% 118 22321 0.18% 119 23236 0.19% 120 24212 0.20% 121 25433 0.21% 122 26626 0.22% 123 27899 0.23% 124 28909 0.24% 125 29646 0.25% 126 31080 0.26% 127 31995 0.27% 128 33385 0.28% 129 35263 0.29% 130 36776 0.30% 131 38093 0.32% 132 40069 0.33% 133 42792 0.35% 134 44093 0.37% 135 46553 0.39% 136 48842 0.40% 137 52083 0.43% 138 55583 0.46% 139 58534 0.48% 140 61958 0.51% 141 66778 0.55% 142 71620 0.59% 143 80976 0.67% 144 92923 0.77% 145 107914 0.89% 146 136178 1.13% 147 172984 1.43% 148 267500 2.22% 149 504679 4.18% 150 2678192 22.18% 151 6655110 55.13% 12072570 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=14 prefix-density=0.64 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.26 sequence-density-rank=16 fanout-score=7.46 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=4.7 sequence=CCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=19 prefix-density=0.69 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=23.75 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=1.8 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR7230812 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:18:29 Started mapping on | Feb 11 09:18:29 Finished on | Feb 11 09:20:07 Mapping speed, Million of reads per hour | 443.48 Number of input reads | 12072570 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11322875 Uniquely mapped reads % | 93.79% Average mapped length | 294.20 Number of splices: Total | 10558305 Number of splices: Annotated (sjdb) | 10327143 Number of splices: GT/AG | 10347444 Number of splices: GC/AG | 175937 Number of splices: AT/AC | 6402 Number of splices: Non-canonical | 28522 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 359808 % of reads mapped to multiple loci | 2.98% Number of reads mapped to too many loci | 83935 % of reads mapped to too many loci | 0.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.35% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 398281 398281 398281 N_multimapping 359808 359808 359808 N_noFeature 430207 11160074 512222 N_ambiguous 153775 674 72558 UnstrandedReadsAssigned:10738893 PositiveStrandReadsAssigned:162127 NegativeStrandReadsAssigned:10738095 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7230812 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230812-trimmed-pair1.fastq SRR7230812-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,072,570 reads, 10,832,609 reads pseudoaligned [quant] estimated average fragment length: 240.326 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,019 rounds 52401 SRR7230812.ke.tsv 34699 SRR7230812.se.tsv 87100 total ==> SRR7230812.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.67 363 19.815 Potri.005G024800.1.v4.1 1035 795.674 138 16.8394 Potri.004G059700.1.v4.1 961 721.725 1 0.134528 Potri.007G009000.2.v4.1 1416 1176.67 0 0 Potri.003G141000.2.v4.1 2943 2703.67 495.517 17.7946 Potri.016G087400.1.v4.1 270 82.022 474 561.089 Potri.015G069301.1.v4.1 564 330.333 0 0 Potri.010G195200.1.v4.1 1773 1533.67 27 1.70928 Potri.012G127500.1.v4.1 977 737.703 252 33.1667 ==> SRR7230812.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 11 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 201 Potri.001G212900.v4.1 169 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 39 SRR7230812 completed mapping pipeline successfully