Starting /dee2/code/volunteer_pipeline.sh SRR7230813 current disk space = 3054463660032 free memory = 1518401356 SRR7230813 SRAfilesize 5231bf021d0b64ede9ffb390ab07494d SRR7230813.sra SRR7230813.sra file validated SRR7230813 is paired end SRR7230813 is conventional basespace SRR7230813 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230813_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3595 34.0 33.0 34.0 33.0 34.0 2 33.3675 34.0 33.0 34.0 33.0 34.0 3 33.44 34.0 34.0 34.0 33.0 34.0 4 33.42475 34.0 34.0 34.0 33.0 34.0 5 33.40125 34.0 34.0 34.0 33.0 34.0 6 37.227 38.0 38.0 38.0 36.0 38.0 7 37.4635 38.0 38.0 38.0 37.0 38.0 8 37.54725 38.0 38.0 38.0 38.0 38.0 9 37.5615 38.0 38.0 38.0 38.0 38.0 10-14 37.5805 38.0 38.0 38.0 38.0 38.0 15-19 37.45805 38.0 38.0 38.0 37.4 38.0 20-24 37.3159 38.0 38.0 38.0 37.0 38.0 25-29 37.35744999999999 38.0 38.0 38.0 37.8 38.0 30-34 37.4669 38.0 38.0 38.0 37.8 38.0 35-39 37.379650000000005 38.0 38.0 38.0 37.4 38.0 40-44 36.830549999999995 38.0 38.0 38.0 35.6 38.0 45-49 37.148849999999996 38.0 38.0 38.0 36.6 38.0 50-54 37.3252 38.0 38.0 38.0 37.0 38.0 55-59 37.22055 38.0 38.0 38.0 36.8 38.0 60-64 37.1778 38.0 38.0 38.0 37.0 38.0 65-69 37.200450000000004 38.0 38.0 38.0 36.8 38.0 70-74 30.3906 38.0 21.0 38.0 15.4 38.0 75-79 31.485599999999998 38.0 32.0 38.0 2.0 38.0 80-84 34.612199999999994 38.0 36.8 38.0 25.6 38.0 85-89 36.32435 38.0 38.0 38.0 33.8 38.0 90-94 36.44315 38.0 38.0 38.0 34.2 38.0 95-99 36.49400000000001 38.0 38.0 38.0 34.0 38.0 100-104 36.4229 38.0 38.0 38.0 34.0 38.0 105-109 36.4694 38.0 38.0 38.0 34.2 38.0 110-114 34.76989999999999 38.0 35.0 38.0 23.8 38.0 115-119 34.54545 38.0 34.4 38.0 25.8 38.0 120-124 35.321450000000006 38.0 35.8 38.0 29.6 38.0 125-129 34.47835 38.0 35.0 38.0 23.4 38.0 130-134 34.78195000000001 38.0 35.6 38.0 25.8 38.0 135-139 33.946 38.0 34.0 38.0 22.4 38.0 140-144 34.4544 38.0 34.8 38.0 27.2 38.0 145-149 33.83635 38.0 33.8 38.0 23.4 38.0 150-151 29.973375 35.5 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 0.0 12 2.0 13 0.0 14 0.0 15 2.0 16 2.0 17 1.0 18 2.0 19 6.0 20 5.0 21 7.0 22 10.0 23 15.0 24 11.0 25 17.0 26 17.0 27 31.0 28 29.0 29 37.0 30 61.0 31 82.0 32 121.0 33 173.0 34 286.0 35 521.0 36 866.0 37 1692.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.325 16.6 10.9 30.175 2 22.575 19.650000000000002 33.324999999999996 24.45 3 17.974999999999998 28.000000000000004 27.075 26.950000000000003 4 22.25 35.05 21.775 20.925 5 20.075000000000003 37.7 23.175 19.05 6 18.475 35.0 26.325 20.200000000000003 7 14.674999999999999 22.0 44.95 18.375 8 17.125 23.925 30.375000000000004 28.575 9 17.0 23.925 33.050000000000004 26.025 10-14 20.477047704770477 29.327932793279327 26.242624262426244 23.952395239523952 15-19 20.005 28.854999999999997 27.38 23.76 20-24 19.86 28.565 27.815 23.76 25-29 19.763834684278994 28.039627739417593 28.43490443310317 23.76163314320024 30-34 19.75 28.715000000000003 28.01 23.525 35-39 20.622062206220622 28.11781178117812 27.817781778177817 23.442344234423445 40-44 20.894699929866746 28.659452960625188 27.582406572487727 22.863440537020338 45-49 20.555 28.754999999999995 26.884999999999998 23.805 50-54 19.93 28.405 27.750000000000004 23.915 55-59 20.09906934854398 28.74512158510958 27.309116381467025 23.846692684879418 60-64 20.628408465502577 27.983189072897385 27.693000450292693 23.69540201130735 65-69 20.25006251562891 28.712178044511127 27.336834208552137 23.700925231307828 70-74 20.013330101793507 28.556713523994183 27.617547261269998 23.81240911294232 75-79 20.481927710843372 28.42566438000807 27.503314694183434 23.589093214965125 80-84 20.227965122386806 28.469377035402875 27.523899569282488 23.778758272927828 85-89 20.21319388576026 28.42920353982301 27.493966210780368 23.863636363636363 90-94 20.675168792198047 28.33208302075519 27.686921730432605 23.305826456614152 95-99 20.69 27.96 27.435 23.915 100-104 20.607060706070605 28.597859785978596 27.73777377737774 23.05730573057306 105-109 20.965 27.41 27.72 23.905 110-114 20.349999999999998 28.689999999999998 27.165 23.794999999999998 115-119 20.626031301565078 28.106405320266013 27.501375068753436 23.76618830941547 120-124 20.811446295462506 28.385612086647654 26.904797638701282 23.898143979188553 125-129 21.015 28.050000000000004 27.384999999999998 23.549999999999997 130-134 21.485000000000003 27.615000000000002 27.595 23.305 135-139 21.465 27.915 26.8 23.82 140-144 21.7 28.275 25.935000000000002 24.09 145-149 21.27031757939485 28.152038009502377 26.991747936984247 23.585896474118528 150-151 22.3625 27.85 25.837500000000002 23.95 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 2.5 22 4.0 23 5.5 24 6.0 25 5.0 26 5.0 27 8.5 28 10.5 29 18.5 30 26.5 31 30.5 32 46.0 33 63.5 34 85.5 35 102.5 36 101.0 37 129.5 38 163.0 39 180.5 40 191.5 41 213.5 42 232.5 43 238.5 44 245.5 45 246.5 46 247.5 47 243.5 48 228.5 49 190.5 50 150.0 51 116.5 52 100.0 53 86.5 54 67.5 55 49.5 56 39.0 57 34.5 58 23.5 59 17.0 60 12.0 61 5.5 62 6.0 63 5.5 64 3.5 65 2.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.06999999999999999 30-34 0.0 35-39 0.01 40-44 0.19 45-49 0.0 50-54 0.0 55-59 0.06999999999999999 60-64 0.065 65-69 0.025 70-74 17.48 75-79 13.264999999999999 80-84 4.81 85-89 0.5599999999999999 90-94 0.025 95-99 0.0 100-104 0.01 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.055 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.025 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24395161290323 98.45 2 0.7308467741935484 1.4500000000000002 3 0.0 0.0 4 0.025201612903225805 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.9624999999999999 0.0 0.0 0.0 0.0 108-109 1.0625 0.0 0.0 0.0 0.0 110-111 1.2125 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.3 0.0 0.0 0.0 0.0 120-121 2.5875 0.0 0.0 0.0 0.0 122-123 2.85 0.0 0.0 0.0 0.0 124-125 3.0875000000000004 0.0 0.0 0.0 0.0 126-127 3.4875 0.0 0.0 0.0 0.0 128-129 3.8 0.0 0.0 0.0 0.0 130-131 4.2625 0.0 0.0 0.0 0.0 132-133 4.775 0.0 0.0 0.0 0.0 134-135 5.15 0.0 0.0 0.0 0.0 136-137 5.6875 0.0 0.0 0.0 0.0 138-139 6.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACACGT 10 0.0074031535 141.15001 145 CGGAAGA 20 0.006768989 28.23 135-139 >>END_MODULE SRR7230813 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230813_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82475 33.0 33.0 34.0 32.0 34.0 2 32.85075 34.0 33.0 34.0 32.0 34.0 3 32.892 34.0 33.0 34.0 32.0 34.0 4 32.84 34.0 33.0 34.0 32.0 34.0 5 32.82225 34.0 33.0 34.0 32.0 34.0 6 36.7165 38.0 38.0 38.0 35.0 38.0 7 36.8185 38.0 38.0 38.0 36.0 38.0 8 36.58775 38.0 38.0 38.0 35.0 38.0 9 36.574 38.0 38.0 38.0 35.0 38.0 10-14 36.54885 38.0 38.0 38.0 35.4 38.0 15-19 36.665400000000005 38.0 38.0 38.0 36.0 38.0 20-24 36.65625 38.0 38.0 38.0 36.2 38.0 25-29 36.62405 38.0 38.0 38.0 36.0 38.0 30-34 36.551100000000005 38.0 38.0 38.0 35.8 38.0 35-39 36.2909 38.0 38.0 38.0 34.4 38.0 40-44 35.969199999999994 38.0 38.0 38.0 33.0 38.0 45-49 36.47709999999999 38.0 38.0 38.0 35.8 38.0 50-54 36.4877 38.0 38.0 38.0 36.0 38.0 55-59 35.991550000000004 38.0 38.0 38.0 33.4 38.0 60-64 36.33845 38.0 38.0 38.0 34.8 38.0 65-69 35.96825 38.0 38.0 38.0 34.2 38.0 70-74 35.9517 38.0 38.0 38.0 33.4 38.0 75-79 36.183499999999995 38.0 38.0 38.0 34.2 38.0 80-84 36.11415 38.0 38.0 38.0 34.0 38.0 85-89 36.05245 38.0 38.0 38.0 34.0 38.0 90-94 36.02505000000001 38.0 38.0 38.0 34.0 38.0 95-99 35.458000000000006 38.0 37.2 38.0 30.4 38.0 100-104 35.4867 38.0 37.6 38.0 30.8 38.0 105-109 34.876 38.0 36.4 38.0 25.6 38.0 110-114 35.27675 38.0 37.0 38.0 30.2 38.0 115-119 35.3882 38.0 37.4 38.0 31.4 38.0 120-124 35.087700000000005 38.0 36.8 38.0 29.4 38.0 125-129 34.817400000000006 38.0 36.0 38.0 27.6 38.0 130-134 34.7046 38.0 36.0 38.0 27.0 38.0 135-139 34.34065 38.0 35.8 38.0 24.8 38.0 140-144 33.74550000000001 38.0 34.2 38.0 21.6 38.0 145-149 32.95405 38.0 33.0 38.0 14.4 38.0 150-151 27.10875 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 25.0 4 6.0 5 5.0 6 5.0 7 3.0 8 2.0 9 3.0 10 7.0 11 1.0 12 4.0 13 2.0 14 3.0 15 6.0 16 5.0 17 5.0 18 10.0 19 10.0 20 6.0 21 5.0 22 10.0 23 10.0 24 18.0 25 16.0 26 32.0 27 34.0 28 24.0 29 48.0 30 47.0 31 53.0 32 72.0 33 106.0 34 143.0 35 231.0 36 547.0 37 2483.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.925000000000004 19.025 13.450000000000001 24.6 2 26.974999999999998 23.05 32.0 17.974999999999998 3 21.275 26.5 30.7 21.525 4 23.724999999999998 33.775 23.35 19.15 5 22.45 39.125 20.8 17.625 6 19.625 37.525 23.025000000000002 19.825 7 18.825 18.85 41.475 20.849999999999998 8 21.325 23.7 26.674999999999997 28.299999999999997 9 21.825 23.599999999999998 29.799999999999997 24.775 10-14 23.595 27.77 26.565 22.07 15-19 23.97 27.67 27.565 20.794999999999998 20-24 23.525 27.85 27.505000000000003 21.12 25-29 23.605 27.62 27.775 21.0 30-34 22.785 27.589999999999996 28.08 21.545 35-39 23.435545995698064 27.287279275674052 27.802511130008504 21.47466359861938 40-44 23.133470020503076 28.199229884482673 27.554133119967993 21.11316697504626 45-49 22.573386007901185 27.849177376606495 27.754163124468672 21.823273491023652 50-54 22.915 27.46 28.165000000000003 21.46 55-59 23.48245217653261 27.13762112767987 27.97107998192499 21.408846713862527 60-64 23.488523278491773 27.859178876831525 27.43911586738011 21.213181977296593 65-69 23.587570621468927 27.935835351089587 27.16908797417272 21.307506053268767 70-74 24.254012982438482 27.31344034619836 27.57006994414532 20.86247672721783 75-79 23.285 27.400000000000002 27.839999999999996 21.475 80-84 23.544126475885534 27.691614968981387 27.501500900540325 21.262757654592757 85-89 23.645 27.834999999999997 27.83 20.69 90-94 23.535 27.544999999999998 27.889999999999997 21.029999999999998 95-99 23.635 27.61 27.6 21.154999999999998 100-104 24.224999999999998 27.400000000000002 27.435 20.94 105-109 23.705000000000002 27.384999999999998 28.075 20.835 110-114 23.73 27.82 27.825 20.625 115-119 24.435000000000002 28.01 27.189999999999998 20.365 120-124 24.295 27.88 27.744999999999997 20.080000000000002 125-129 24.215 27.650000000000002 27.389999999999997 20.745 130-134 24.62 27.644999999999996 27.24 20.495 135-139 24.8887333099965 27.62914437165575 27.20908136220433 20.273040956143422 140-144 25.00500200080032 27.986194477791116 26.92076830732293 20.088035214085632 145-149 24.83 28.134999999999998 26.810000000000002 20.225 150-151 25.124999999999996 27.6 27.35 19.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 2.0 22 1.0 23 0.0 24 0.5 25 1.0 26 2.0 27 3.5 28 9.5 29 10.5 30 13.0 31 21.0 32 27.0 33 35.5 34 45.5 35 65.0 36 79.5 37 90.0 38 113.5 39 141.0 40 173.0 41 207.0 42 230.0 43 250.5 44 273.0 45 277.0 46 273.5 47 252.0 48 232.5 49 222.5 50 190.0 51 148.0 52 121.5 53 110.0 54 93.0 55 75.0 56 52.0 57 36.0 58 27.5 59 23.0 60 21.5 61 14.0 62 9.5 63 9.0 64 6.0 65 3.0 66 1.0 67 0.0 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.045 40-44 0.015 45-49 0.015 50-54 0.0 55-59 0.415 60-64 0.015 65-69 0.88 70-74 0.635 75-79 0.0 80-84 0.06 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.015 140-144 0.04 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24242424242425 98.25 2 0.6565656565656566 1.3 3 0.025252525252525252 0.075 4 0.050505050505050504 0.2 5 0.0 0.0 6 0.0 0.0 7 0.025252525252525252 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.8375 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.1125 0.0 0.0 0.0 0.0 112-113 1.325 0.0 0.0 0.0 0.0 114-115 1.6625 0.0 0.0 0.0 0.0 116-117 1.9875 0.0 0.0 0.0 0.0 118-119 2.3 0.0 0.0 0.0 0.0 120-121 2.625 0.0 0.0 0.0 0.0 122-123 2.9 0.0 0.0 0.0 0.0 124-125 3.1875 0.0 0.0 0.0 0.0 126-127 3.5875 0.0 0.0 0.0 0.0 128-129 3.9125 0.0 0.0 0.0 0.0 130-131 4.4 0.0 0.0 0.0 0.0 132-133 5.012499999999999 0.0 0.0 0.0 0.0 134-135 5.4 0.0 0.0 0.0 0.0 136-137 5.875 0.0 0.0 0.0 0.0 138-139 6.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGATG 10 0.006830828 145.0 2 CCATGCG 10 0.006830828 145.0 9 CGTCGTG 10 0.006830828 145.0 145 GAGATGA 10 0.006830828 145.0 3 >>END_MODULE Read 1002837 spots for SRR7230813.sra Written 1002837 spots for SRR7230813.sra Read 1002837 spots for SRR7230813.sra Written 1002837 spots for SRR7230813.sra Read 1002837 spots for SRR7230813.sra Written 1002837 spots for SRR7230813.sra Read 1002837 spots for SRR7230813.sra Written 1002837 spots for SRR7230813.sra Read 1002837 spots for SRR7230813.sra Written 1002837 spots for SRR7230813.sra Read 1002837 spots for SRR7230813.sra Written 1002837 spots for SRR7230813.sra Read 1002837 spots for SRR7230813.sra Written 1002837 spots for SRR7230813.sra Read 1002837 spots for SRR7230813.sra Written 1002837 spots for SRR7230813.sra Read 1002837 spots for SRR7230813.sra Written 1002837 spots for SRR7230813.sra Read 1002837 spots for SRR7230813.sra Written 1002837 spots for SRR7230813.sra Read 1002837 spots for SRR7230813.sra Written 1002837 spots for SRR7230813.sra Read 1002837 spots for SRR7230813.sra Written 1002837 spots for SRR7230813.sra Read 1002837 spots for SRR7230813.sra Written 1002837 spots for SRR7230813.sra Read 1002837 spots for SRR7230813.sra Written 1002837 spots for SRR7230813.sra Read 1002837 spots for SRR7230813.sra Written 1002837 spots for SRR7230813.sra Read 1002837 spots for SRR7230813.sra Written 1002837 spots for SRR7230813.sra Read 1002844 spots for SRR7230813.sra Written 1002844 spots for SRR7230813.sra Read 1002837 spots for SRR7230813.sra Written 1002837 spots for SRR7230813.sra Read 1002837 spots for SRR7230813.sra Written 1002837 spots for SRR7230813.sra Read 1002837 spots for SRR7230813.sra Written 1002837 spots for SRR7230813.sra SRR ids: ['SRR7230813.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xcyviocg SRR7230813.sra spots: 20056747 blocks: [[1, 1002837], [1002838, 2005674], [2005675, 3008511], [3008512, 4011348], [4011349, 5014185], [5014186, 6017022], [6017023, 7019859], [7019860, 8022696], [8022697, 9025533], [9025534, 10028370], [10028371, 11031207], [11031208, 12034044], [12034045, 13036881], [13036882, 14039718], [14039719, 15042555], [15042556, 16045392], [16045393, 17048229], [17048230, 18051066], [18051067, 19053903], [19053904, 20056747]] SRR7230813 file size 6774873 SRR7230813 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230813 SRR7230813_1.fastq SRR7230813_2.fastq Input file: SRR7230813_1.fastq Paired file: SRR7230813_2.fastq trimmed: SRR7230813-trimmed-pair1.fastq, SRR7230813-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:44:29 2025 >> started Tue Feb 11 09:44:53 2025 >> done (24.023s) 20056747 read pairs processed; of these: 45703 ( 0.23%) short read pairs filtered out after trimming by size control 37461 ( 0.19%) empty read pairs filtered out after trimming by size control 19973583 (99.59%) read pairs available; of these: 9135106 (45.74%) trimmed read pairs available after processing 10838477 (54.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 3 0.00% 21 7 0.00% 22 6 0.00% 23 7 0.00% 24 12 0.00% 25 8 0.00% 26 8 0.00% 27 10 0.00% 28 9 0.00% 29 8 0.00% 30 8 0.00% 31 11 0.00% 32 20 0.00% 33 11 0.00% 34 12 0.00% 35 15 0.00% 36 7 0.00% 37 15 0.00% 38 26 0.00% 39 27 0.00% 40 28 0.00% 41 24 0.00% 42 39 0.00% 43 31 0.00% 44 38 0.00% 45 51 0.00% 46 48 0.00% 47 63 0.00% 48 56 0.00% 49 69 0.00% 50 83 0.00% 51 100 0.00% 52 112 0.00% 53 110 0.00% 54 128 0.00% 55 143 0.00% 56 145 0.00% 57 166 0.00% 58 184 0.00% 59 191 0.00% 60 254 0.00% 61 256 0.00% 62 294 0.00% 63 347 0.00% 64 368 0.00% 65 403 0.00% 66 454 0.00% 67 518 0.00% 68 750 0.00% 69 2007 0.01% 70 1686 0.01% 71 879 0.00% 72 926 0.00% 73 1028 0.01% 74 1208 0.01% 75 1233 0.01% 76 1391 0.01% 77 1605 0.01% 78 1712 0.01% 79 1855 0.01% 80 2138 0.01% 81 2545 0.01% 82 3258 0.02% 83 3320 0.02% 84 5492 0.03% 85 6737 0.03% 86 6939 0.03% 87 7321 0.04% 88 7600 0.04% 89 8104 0.04% 90 8462 0.04% 91 8828 0.04% 92 9429 0.05% 93 10030 0.05% 94 10792 0.05% 95 11511 0.06% 96 12256 0.06% 97 13046 0.07% 98 13945 0.07% 99 14472 0.07% 100 15723 0.08% 101 16694 0.08% 102 18251 0.09% 103 19399 0.10% 104 20718 0.10% 105 22024 0.11% 106 23421 0.12% 107 24129 0.12% 108 25866 0.13% 109 27340 0.14% 110 28581 0.14% 111 30129 0.15% 112 32198 0.16% 113 34388 0.17% 114 36190 0.18% 115 37306 0.19% 116 39479 0.20% 117 40859 0.20% 118 42290 0.21% 119 44083 0.22% 120 45936 0.23% 121 47970 0.24% 122 49969 0.25% 123 52936 0.27% 124 55240 0.28% 125 57493 0.29% 126 60029 0.30% 127 62028 0.31% 128 64182 0.32% 129 67242 0.34% 130 69510 0.35% 131 71533 0.36% 132 75681 0.38% 133 79591 0.40% 134 83391 0.42% 135 87739 0.44% 136 91502 0.46% 137 96871 0.48% 138 101376 0.51% 139 106365 0.53% 140 111743 0.56% 141 121474 0.61% 142 130933 0.66% 143 144935 0.73% 144 163994 0.82% 145 187287 0.94% 146 226211 1.13% 147 292477 1.46% 148 418577 2.10% 149 780565 3.91% 150 4363814 21.85% 151 10838477 54.26% 19973583 reads passed initial QC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=13 prefix-density=0.74 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=376.28 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=14.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCT criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=13 prefix-density=0.73 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.17 sequence-density-rank=18 fanout-score=8.19 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=5.3 sequence=CAGCAATGGCAGCA SRR7230813 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:45:52 Started mapping on | Feb 11 09:45:52 Finished on | Feb 11 09:47:51 Mapping speed, Million of reads per hour | 604.24 Number of input reads | 19973583 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 17155997 Uniquely mapped reads % | 85.89% Average mapped length | 290.02 Number of splices: Total | 16761053 Number of splices: Annotated (sjdb) | 16427196 Number of splices: GT/AG | 16415148 Number of splices: GC/AG | 287961 Number of splices: AT/AC | 9317 Number of splices: Non-canonical | 48627 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 455741 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 91279 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.27% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2399692 2399692 2399692 N_multimapping 455741 455741 455741 N_noFeature 527293 16884240 606688 N_ambiguous 372672 1743 179274 UnstrandedReadsAssigned:16256032 PositiveStrandReadsAssigned:270014 NegativeStrandReadsAssigned:16370035 Dataset is classified negative stranded MeadianReadLen=147 20thPercentileLength=146 echo kmer=141 SRR7230813 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230813-trimmed-pair1.fastq SRR7230813-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,973,583 reads, 17,832,103 reads pseudoaligned [quant] estimated average fragment length: 231.387 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52401 SRR7230813.ke.tsv 34699 SRR7230813.se.tsv 87100 total ==> SRR7230813.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.61 602 17.2648 Potri.005G024800.1.v4.1 1035 804.613 116 7.39112 Potri.004G059700.1.v4.1 961 730.649 26 1.82433 Potri.007G009000.2.v4.1 1416 1185.61 0 0 Potri.003G141000.2.v4.1 2943 2712.61 1221.48 23.0855 Potri.016G087400.1.v4.1 270 86.2099 867 515.586 Potri.015G069301.1.v4.1 564 338.225 0 0 Potri.010G195200.1.v4.1 1773 1542.61 18 0.598212 Potri.012G127500.1.v4.1 977 746.625 103 7.07252 ==> SRR7230813.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 786 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 377 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 38 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR7230813 completed mapping pipeline successfully