Starting /dee2/code/volunteer_pipeline.sh SRR7230814 current disk space = 3053627838464 free memory = 1579144776 SRR7230814 SRAfilesize 85406b348f96c51b615ec83be3499d7c SRR7230814.sra SRR7230814.sra file validated SRR7230814 is paired end SRR7230814 is conventional basespace SRR7230814 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230814_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.45075 34.0 33.0 34.0 33.0 34.0 2 33.51825 34.0 34.0 34.0 33.0 34.0 3 33.5325 34.0 34.0 34.0 33.0 34.0 4 33.4825 34.0 34.0 34.0 33.0 34.0 5 33.508 34.0 34.0 34.0 33.0 34.0 6 37.26675 38.0 38.0 38.0 36.0 38.0 7 37.52175 38.0 38.0 38.0 37.0 38.0 8 37.62575 38.0 38.0 38.0 38.0 38.0 9 37.6805 38.0 38.0 38.0 38.0 38.0 10-14 37.68335 38.0 38.0 38.0 38.0 38.0 15-19 37.42555 38.0 38.0 38.0 37.4 38.0 20-24 37.620900000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.6329 38.0 38.0 38.0 38.0 38.0 30-34 37.598850000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.31875000000001 38.0 38.0 38.0 37.4 38.0 40-44 36.931850000000004 38.0 38.0 38.0 36.2 38.0 45-49 37.0877 38.0 38.0 38.0 36.4 38.0 50-54 36.689750000000004 38.0 37.8 38.0 34.0 38.0 55-59 37.3943 38.0 38.0 38.0 37.0 38.0 60-64 37.380250000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.34655 38.0 38.0 38.0 37.2 38.0 70-74 31.6889 38.0 26.2 38.0 15.8 38.0 75-79 32.32745 38.0 34.2 38.0 7.2 38.0 80-84 35.18435 38.0 37.8 38.0 29.6 38.0 85-89 36.30910000000001 38.0 38.0 38.0 33.8 38.0 90-94 36.70885 38.0 38.0 38.0 34.8 38.0 95-99 36.7976 38.0 38.0 38.0 35.2 38.0 100-104 35.793499999999995 38.0 36.8 38.0 30.2 38.0 105-109 36.454449999999994 38.0 37.8 38.0 34.2 38.0 110-114 36.2348 38.0 37.8 38.0 33.4 38.0 115-119 36.37725 38.0 38.0 38.0 34.0 38.0 120-124 35.308499999999995 38.0 36.0 38.0 28.2 38.0 125-129 35.571749999999994 38.0 36.2 38.0 31.0 38.0 130-134 34.974849999999996 38.0 35.6 38.0 26.6 38.0 135-139 35.349799999999995 38.0 35.8 38.0 30.0 38.0 140-144 34.84805 38.0 35.0 38.0 28.0 38.0 145-149 34.0869 38.0 34.2 38.0 24.8 38.0 150-151 30.4735 35.5 28.5 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 3.0 16 1.0 17 2.0 18 2.0 19 1.0 20 5.0 21 4.0 22 6.0 23 5.0 24 11.0 25 8.0 26 21.0 27 24.0 28 24.0 29 35.0 30 56.0 31 61.0 32 104.0 33 176.0 34 237.0 35 416.0 36 772.0 37 2024.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.1 14.174999999999999 10.6 38.125 2 22.15 19.15 36.1 22.6 3 19.025 25.5 26.05 29.425 4 23.35 33.15 21.075 22.425 5 23.25 34.8 22.75 19.2 6 17.04204204204204 35.76076076076076 26.3013013013013 20.895895895895897 7 13.425 23.25 44.9 18.425 8 17.1 23.3 30.7 28.9 9 16.85 23.05 33.375 26.724999999999998 10-14 20.32 29.195 26.534999999999997 23.95 15-19 20.285 28.82 27.565 23.330000000000002 20-24 19.885 28.71 27.650000000000002 23.755000000000003 25-29 20.14 28.075 27.755000000000003 24.03 30-34 20.135 28.475 27.500000000000004 23.89 35-39 20.476619605487134 28.346850906178034 27.450685891659155 23.725843596675677 40-44 20.0 28.44299347061778 27.56403817177298 23.992968357609243 45-49 20.120060030015008 28.37418709354677 27.503751875937972 24.00200100050025 50-54 20.31 28.475 27.275 23.94 55-59 19.349837459364842 29.27731932983246 27.406851712928233 23.96599149787447 60-64 20.46 27.97 27.889999999999997 23.68 65-69 20.721216364909473 28.30849254776433 27.508252475742722 23.462038611583473 70-74 20.327485380116958 28.280701754385966 27.304093567251464 24.087719298245613 75-79 19.941232977340793 28.818443804034583 27.281460134486068 23.958863084138553 80-84 20.26420217209691 28.487886382623223 27.709899749373434 23.538011695906434 85-89 20.59463012590383 28.10335237902614 26.81903220913182 24.48298528593821 90-94 20.37509377344336 28.08702175543886 27.936984246061513 23.600900225056265 95-99 20.624124824964994 27.775555111022204 27.325465093018604 24.274854970994202 100-104 21.146146146146148 28.74874874874875 26.82182182182182 23.283283283283282 105-109 20.377415156672342 28.5013514866353 27.690459505456 23.43077385123636 110-114 20.418271876719867 28.413468754690545 27.497873617851603 23.670385750737978 115-119 20.83541770885443 27.593796898449224 27.6288144072036 23.94197098549275 120-124 21.015 28.255000000000003 27.245 23.485 125-129 21.387456829671155 27.774162871014564 26.958306221532606 23.88007407778167 130-134 20.706589827111 28.128288649461286 27.4718115760461 23.693309947381607 135-139 20.988148222233335 28.229234385157774 26.689003350502578 24.093614042106314 140-144 21.3953488372093 28.327081770442607 26.676669167291823 23.600900225056265 145-149 21.52253288651028 28.3499224728655 26.94943230130546 23.178112339318762 150-151 21.66791697924481 28.469617404351087 26.36909227306827 23.493373343335833 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 1.5 23 2.5 24 1.5 25 2.0 26 5.0 27 8.5 28 12.0 29 16.0 30 24.0 31 36.5 32 51.5 33 66.5 34 83.5 35 89.5 36 107.0 37 138.0 38 144.5 39 157.5 40 203.0 41 232.5 42 234.5 43 240.5 44 250.5 45 242.0 46 226.0 47 213.5 48 210.5 49 200.0 50 150.0 51 123.0 52 110.0 53 90.5 54 77.5 55 58.0 56 47.5 57 37.0 58 29.0 59 27.0 60 16.0 61 7.0 62 5.0 63 3.0 64 2.0 65 3.0 66 2.5 67 1.0 68 1.5 69 1.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.13 40-44 0.44999999999999996 45-49 0.05 50-54 0.0 55-59 0.025 60-64 0.0 65-69 0.03 70-74 14.499999999999998 75-79 11.515 80-84 4.24 85-89 1.115 90-94 0.025 95-99 0.02 100-104 0.1 105-109 0.11 110-114 0.065 115-119 0.05 120-124 0.0 125-129 0.105 130-134 0.22499999999999998 135-139 0.015 140-144 0.025 145-149 0.034999999999999996 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.2125 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.05 0.0 0.0 0.0 0.0 108-109 1.2374999999999998 0.0 0.0 0.0 0.0 110-111 1.4249999999999998 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.6749999999999998 0.0 0.0 0.0 0.0 116-117 1.9375 0.0 0.0 0.0 0.0 118-119 2.1375 0.0 0.0 0.0 0.0 120-121 2.45 0.0 0.0 0.0 0.0 122-123 2.7375 0.0 0.0 0.0 0.0 124-125 2.9125 0.0 0.0 0.0 0.0 126-127 3.175 0.0 0.0 0.0 0.0 128-129 3.5625 0.0 0.0 0.0 0.0 130-131 3.9499999999999997 0.0 0.0 0.0 0.0 132-133 4.3 0.0 0.0 0.0 0.0 134-135 4.6375 0.0 0.0 0.0 0.0 136-137 5.1125 0.0 0.0 0.0 0.0 138-139 5.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAAGAC 10 0.0073757805 141.325 4 >>END_MODULE SRR7230814 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230814_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9405 34.0 33.0 34.0 32.0 34.0 2 33.122 34.0 33.0 34.0 33.0 34.0 3 33.1845 34.0 33.0 34.0 33.0 34.0 4 33.1195 34.0 33.0 34.0 33.0 34.0 5 33.0855 34.0 33.0 34.0 33.0 34.0 6 37.223 38.0 38.0 38.0 37.0 38.0 7 37.3375 38.0 38.0 38.0 37.0 38.0 8 37.268 38.0 38.0 38.0 37.0 38.0 9 37.2135 38.0 38.0 38.0 37.0 38.0 10-14 37.1356 38.0 38.0 38.0 37.0 38.0 15-19 37.18535 38.0 38.0 38.0 37.0 38.0 20-24 37.1451 38.0 38.0 38.0 37.0 38.0 25-29 37.1105 38.0 38.0 38.0 37.0 38.0 30-34 37.0597 38.0 38.0 38.0 36.8 38.0 35-39 36.851299999999995 38.0 38.0 38.0 36.4 38.0 40-44 36.92835 38.0 38.0 38.0 36.8 38.0 45-49 37.02735 38.0 38.0 38.0 37.0 38.0 50-54 37.02535 38.0 38.0 38.0 37.0 38.0 55-59 36.703450000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.835300000000004 38.0 38.0 38.0 36.2 38.0 65-69 36.684749999999994 38.0 38.0 38.0 36.2 38.0 70-74 36.5441 38.0 38.0 38.0 35.4 38.0 75-79 36.763850000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.686400000000006 38.0 38.0 38.0 36.0 38.0 85-89 36.6923 38.0 38.0 38.0 35.8 38.0 90-94 36.5889 38.0 38.0 38.0 35.8 38.0 95-99 36.4807 38.0 38.0 38.0 35.0 38.0 100-104 36.27759999999999 38.0 38.0 38.0 34.0 38.0 105-109 36.11225 38.0 38.0 38.0 34.0 38.0 110-114 36.114399999999996 38.0 38.0 38.0 33.8 38.0 115-119 36.066599999999994 38.0 38.0 38.0 33.8 38.0 120-124 35.744350000000004 38.0 38.0 38.0 32.6 38.0 125-129 35.50285 38.0 37.4 38.0 31.0 38.0 130-134 35.4708 38.0 37.4 38.0 31.4 38.0 135-139 34.9131 38.0 36.2 38.0 28.6 38.0 140-144 34.60355 38.0 36.0 38.0 28.2 38.0 145-149 33.470549999999996 38.0 35.0 38.0 21.8 38.0 150-151 27.831875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 5.0 5 2.0 6 2.0 7 3.0 8 1.0 9 0.0 10 2.0 11 1.0 12 4.0 13 4.0 14 3.0 15 4.0 16 7.0 17 5.0 18 2.0 19 2.0 20 5.0 21 7.0 22 6.0 23 17.0 24 14.0 25 13.0 26 25.0 27 30.0 28 26.0 29 38.0 30 29.0 31 47.0 32 67.0 33 85.0 34 129.0 35 209.0 36 489.0 37 2713.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.55332999499249 18.678017025538306 16.399599399098648 29.369053580370558 2 26.157697121401753 23.979974968710888 33.516896120150186 16.345431789737173 3 21.5 27.05 31.25 20.200000000000003 4 23.400000000000002 35.275 22.1 19.225 5 24.349999999999998 37.3 21.725 16.625 6 18.75 38.375 22.650000000000002 20.225 7 17.974999999999998 16.875 43.9 21.25 8 21.05 24.05 27.400000000000002 27.500000000000004 9 20.58529264632316 23.56178089044522 30.16508254127064 25.68784392196098 10-14 23.181954586375912 28.33850155046514 26.177853356006803 22.301690507152145 15-19 22.7641056422569 28.211284513805523 27.796118447378955 21.228491396558624 20-24 23.492921106608637 28.185502026114364 27.18995447496123 21.131622392315773 25-29 22.83984589983489 28.753689898433983 27.547906138990342 20.85855806274078 30-34 23.04497923650373 27.92815329964477 28.108270375744233 20.91859708810727 35-39 22.891747159801813 27.40603573394725 27.876482658525596 21.82573444772534 40-44 23.014959723820482 27.82808825736729 27.64797118126782 21.508980837544403 45-49 22.674476819865824 27.410633823971164 28.106538500050064 21.808350856112945 50-54 23.351703406813627 27.590180360721444 27.78056112224449 21.27755511022044 55-59 23.51845325008811 27.601832737525804 27.82337243844721 21.056341573938873 60-64 22.592778335005015 27.567703109327983 28.164493480441323 21.675025075225676 65-69 22.719501156592578 27.914110429447852 27.501760032183448 21.864628381776125 70-74 23.100899904479412 27.474737318385202 27.987532049670705 21.43683072746468 75-79 23.506753376688344 27.368684342171086 27.77888944472236 21.34567283641821 80-84 23.42590735913375 27.591738520152397 27.977742129536797 21.00461199117706 85-89 23.83930358214929 27.001200720432262 27.9217530518311 21.23774264558735 90-94 23.53412047228337 27.7666599959976 27.761656994196514 20.937562537522513 95-99 23.774264558735243 27.22133279967981 27.971783069841905 21.032619571743048 100-104 23.633271645075776 28.15485419896964 27.44460561196419 20.767268543990397 105-109 23.515878969742435 27.031757939484873 28.312078019504877 21.14028507126782 110-114 23.605687393611696 27.93631721237609 27.07019124862321 21.387804145389005 115-119 23.414902667267175 27.87369263874293 27.478356603112648 21.233048090877247 120-124 23.589717943588717 27.48049609921984 27.980596119223843 20.949189837967594 125-129 24.0248049609922 27.845569113822766 27.065413082616523 21.064212842568512 130-134 24.614845938375353 27.74109643857543 27.29591836734694 20.34813925570228 135-139 24.007817197835237 27.861294848667068 27.580677490479054 20.550210463018644 140-144 24.3498699739948 28.235647129425885 27.490498099619927 19.92398479695939 145-149 25.265053010602124 28.085617123424683 26.905381076215246 19.74394878975795 150-151 24.45 28.275 27.325 19.950000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 2.0 21 1.5 22 2.5 23 2.5 24 1.5 25 2.5 26 5.5 27 8.5 28 8.5 29 10.5 30 13.5 31 15.0 32 23.0 33 40.0 34 45.5 35 65.0 36 88.0 37 105.0 38 136.5 39 159.0 40 177.0 41 202.5 42 234.0 43 257.5 44 271.0 45 266.5 46 260.5 47 264.0 48 237.0 49 197.5 50 174.0 51 132.5 52 108.5 53 110.0 54 95.0 55 68.0 56 50.0 57 37.5 58 25.0 59 25.0 60 17.5 61 11.5 62 12.5 63 9.5 64 5.5 65 2.5 66 1.5 67 2.0 68 2.5 69 1.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.05 10-14 0.03 15-19 0.04 20-24 0.055 25-29 0.065 30-34 0.065 35-39 0.095 40-44 0.065 45-49 0.13 50-54 0.2 55-59 0.695 60-64 0.3 65-69 0.5700000000000001 70-74 0.545 75-79 0.05 80-84 0.26 85-89 0.06 90-94 0.06 95-99 0.06 100-104 0.034999999999999996 105-109 0.025 110-114 0.13 115-119 0.08499999999999999 120-124 0.02 125-129 0.02 130-134 0.04 135-139 0.22 140-144 0.02 145-149 0.02 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19273461150352 98.3 2 0.7315842583249244 1.4500000000000002 3 0.050454086781029264 0.15 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1625 0.0 0.0 0.0 0.0 84-85 0.23750000000000002 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7125 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.05 0.0 0.0 0.0 0.0 108-109 1.2374999999999998 0.0 0.0 0.0 0.0 110-111 1.4249999999999998 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.6749999999999998 0.0 0.0 0.0 0.0 116-117 1.95 0.0 0.0 0.0 0.0 118-119 2.1875 0.0 0.0 0.0 0.0 120-121 2.525 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.0125 0.0 0.0 0.0 0.0 126-127 3.2625 0.0 0.0 0.0 0.0 128-129 3.6125 0.0 0.0 0.0 0.0 130-131 4.0375 0.0 0.0 0.0 0.0 132-133 4.4 0.0 0.0 0.0 0.0 134-135 4.7875 0.0 0.0 0.0 0.0 136-137 5.2625 0.0 0.0 0.0 0.0 138-139 5.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGTGTA 10 0.0069124657 144.425 145 >>END_MODULE Read 849019 spots for SRR7230814.sra Written 849019 spots for SRR7230814.sra Read 849019 spots for SRR7230814.sra Written 849019 spots for SRR7230814.sra Read 849019 spots for SRR7230814.sra Written 849019 spots for SRR7230814.sra Read 849019 spots for SRR7230814.sra Written 849019 spots for SRR7230814.sra Read 849019 spots for SRR7230814.sra Written 849019 spots for SRR7230814.sra Read 849019 spots for SRR7230814.sra Written 849019 spots for SRR7230814.sra Read 849019 spots for SRR7230814.sra Written 849019 spots for SRR7230814.sra Read 849019 spots for SRR7230814.sra Written 849019 spots for SRR7230814.sra Read 849019 spots for SRR7230814.sra Written 849019 spots for SRR7230814.sra Read 849019 spots for SRR7230814.sra Written 849019 spots for SRR7230814.sra Read 849019 spots for SRR7230814.sra Written 849019 spots for SRR7230814.sra Read 849019 spots for SRR7230814.sra Written 849019 spots for SRR7230814.sra Read 849019 spots for SRR7230814.sra Written 849019 spots for SRR7230814.sra Read 849019 spots for SRR7230814.sra Written 849019 spots for SRR7230814.sra Read 849019 spots for SRR7230814.sra Written 849019 spots for SRR7230814.sra Read 849019 spots for SRR7230814.sra Written 849019 spots for SRR7230814.sra Read 849019 spots for SRR7230814.sra Written 849019 spots for SRR7230814.sra Read 849019 spots for SRR7230814.sra Written 849019 spots for SRR7230814.sra Read 849019 spots for SRR7230814.sra Written 849019 spots for SRR7230814.sra Read 849019 spots for SRR7230814.sra Written 849019 spots for SRR7230814.sra SRR ids: ['SRR7230814.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__w3ikxxc SRR7230814.sra spots: 16980380 blocks: [[1, 849019], [849020, 1698038], [1698039, 2547057], [2547058, 3396076], [3396077, 4245095], [4245096, 5094114], [5094115, 5943133], [5943134, 6792152], [6792153, 7641171], [7641172, 8490190], [8490191, 9339209], [9339210, 10188228], [10188229, 11037247], [11037248, 11886266], [11886267, 12735285], [12735286, 13584304], [13584305, 14433323], [14433324, 15282342], [15282343, 16131361], [16131362, 16980380]] SRR7230814 file size 5732393 SRR7230814 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230814 SRR7230814_1.fastq SRR7230814_2.fastq Input file: SRR7230814_1.fastq Paired file: SRR7230814_2.fastq trimmed: SRR7230814-trimmed-pair1.fastq, SRR7230814-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:11:59 2025 >> started Tue Feb 11 10:12:18 2025 >> done (18.372s) 16980380 read pairs processed; of these: 14197 ( 0.08%) short read pairs filtered out after trimming by size control 9572 ( 0.06%) empty read pairs filtered out after trimming by size control 16956611 (99.86%) read pairs available; of these: 6961351 (41.05%) trimmed read pairs available after processing 9995260 (58.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 4 0.00% 21 1 0.00% 22 10 0.00% 23 7 0.00% 24 5 0.00% 25 4 0.00% 26 2 0.00% 27 7 0.00% 28 7 0.00% 29 8 0.00% 30 3 0.00% 31 10 0.00% 32 8 0.00% 33 12 0.00% 34 11 0.00% 35 10 0.00% 36 14 0.00% 37 18 0.00% 38 11 0.00% 39 16 0.00% 40 18 0.00% 41 23 0.00% 42 17 0.00% 43 31 0.00% 44 32 0.00% 45 30 0.00% 46 28 0.00% 47 49 0.00% 48 45 0.00% 49 57 0.00% 50 54 0.00% 51 59 0.00% 52 111 0.00% 53 123 0.00% 54 94 0.00% 55 119 0.00% 56 175 0.00% 57 170 0.00% 58 220 0.00% 59 206 0.00% 60 207 0.00% 61 222 0.00% 62 245 0.00% 63 260 0.00% 64 325 0.00% 65 356 0.00% 66 443 0.00% 67 437 0.00% 68 544 0.00% 69 1015 0.01% 70 1035 0.01% 71 865 0.01% 72 987 0.01% 73 1103 0.01% 74 1078 0.01% 75 1160 0.01% 76 1277 0.01% 77 1450 0.01% 78 1726 0.01% 79 1903 0.01% 80 2282 0.01% 81 3141 0.02% 82 2848 0.02% 83 3064 0.02% 84 4518 0.03% 85 4204 0.02% 86 4743 0.03% 87 5278 0.03% 88 5679 0.03% 89 5995 0.04% 90 6554 0.04% 91 7146 0.04% 92 7476 0.04% 93 7889 0.05% 94 8343 0.05% 95 9058 0.05% 96 9534 0.06% 97 9995 0.06% 98 10551 0.06% 99 11171 0.07% 100 11969 0.07% 101 12757 0.08% 102 13486 0.08% 103 14005 0.08% 104 14764 0.09% 105 15686 0.09% 106 16426 0.10% 107 17233 0.10% 108 18072 0.11% 109 19483 0.11% 110 20128 0.12% 111 21285 0.13% 112 22173 0.13% 113 23583 0.14% 114 24210 0.14% 115 25519 0.15% 116 26345 0.16% 117 27328 0.16% 118 28327 0.17% 119 29367 0.17% 120 30644 0.18% 121 31993 0.19% 122 33285 0.20% 123 34753 0.20% 124 36258 0.21% 125 37238 0.22% 126 38942 0.23% 127 40542 0.24% 128 41957 0.25% 129 44525 0.26% 130 45657 0.27% 131 47720 0.28% 132 49802 0.29% 133 52005 0.31% 134 54573 0.32% 135 57567 0.34% 136 60259 0.36% 137 63369 0.37% 138 66772 0.39% 139 70621 0.42% 140 74574 0.44% 141 81169 0.48% 142 88292 0.52% 143 97367 0.57% 144 109405 0.65% 145 127670 0.75% 146 153809 0.91% 147 201010 1.19% 148 296652 1.75% 149 578285 3.41% 150 3664548 21.61% 151 9995260 58.95% 16956611 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=24 prefix-density=0.56 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=22 fanout-score=34.01 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=11.1 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=3.24 fanout-score-rank=11 prefix-density=0.58 prefix-fanout=2.6 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=154.54 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.4 sequence=AAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7230814 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:13:02 Started mapping on | Feb 11 10:13:02 Finished on | Feb 11 10:15:08 Mapping speed, Million of reads per hour | 484.47 Number of input reads | 16956611 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15597954 Uniquely mapped reads % | 91.99% Average mapped length | 294.85 Number of splices: Total | 14677748 Number of splices: Annotated (sjdb) | 14344365 Number of splices: GT/AG | 14384671 Number of splices: GC/AG | 241741 Number of splices: AT/AC | 8564 Number of splices: Non-canonical | 42772 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 484335 % of reads mapped to multiple loci | 2.86% Number of reads mapped to too many loci | 241652 % of reads mapped to too many loci | 1.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.47% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 892005 892005 892005 N_multimapping 484335 484335 484335 N_noFeature 601564 15383154 690444 N_ambiguous 250261 1102 123697 UnstrandedReadsAssigned:14746129 PositiveStrandReadsAssigned:213698 NegativeStrandReadsAssigned:14783813 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7230814 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230814-trimmed-pair1.fastq SRR7230814-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,956,611 reads, 14,996,075 reads pseudoaligned [quant] estimated average fragment length: 252.672 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR7230814.ke.tsv 34699 SRR7230814.se.tsv 87100 total ==> SRR7230814.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.33 818 31.418 Potri.005G024800.1.v4.1 1035 783.328 134 11.6054 Potri.004G059700.1.v4.1 961 709.418 17 1.62571 Potri.007G009000.2.v4.1 1416 1164.33 0 0 Potri.003G141000.2.v4.1 2943 2691.33 589.307 14.855 Potri.016G087400.1.v4.1 270 80.3282 818 690.848 Potri.015G069301.1.v4.1 564 320.565 0 0 Potri.010G195200.1.v4.1 1773 1521.33 18 0.802688 Potri.012G127500.1.v4.1 977 725.382 244 22.8203 ==> SRR7230814.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 907 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 321 Potri.001G212900.v4.1 30 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7230814 completed mapping pipeline successfully