Starting /dee2/code/volunteer_pipeline.sh SRR7230815 current disk space = 3053570043904 free memory = 1578562540 SRR7230815 SRAfilesize 3956ce305d76ad07dad98981ed2f3ae6 SRR7230815.sra SRR7230815.sra file validated SRR7230815 is paired end SRR7230815 is conventional basespace SRR7230815 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230815_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3075 34.0 33.0 34.0 33.0 34.0 2 33.35025 34.0 33.0 34.0 33.0 34.0 3 33.4095 34.0 33.0 34.0 33.0 34.0 4 33.347 34.0 34.0 34.0 33.0 34.0 5 33.371 34.0 33.0 34.0 33.0 34.0 6 37.049 38.0 37.0 38.0 36.0 38.0 7 37.382 38.0 38.0 38.0 37.0 38.0 8 37.45 38.0 38.0 38.0 37.0 38.0 9 37.48575 38.0 38.0 38.0 38.0 38.0 10-14 37.5192 38.0 38.0 38.0 38.0 38.0 15-19 37.47585 38.0 38.0 38.0 37.6 38.0 20-24 37.265049999999995 38.0 38.0 38.0 36.6 38.0 25-29 37.275400000000005 38.0 38.0 38.0 37.2 38.0 30-34 37.41755 38.0 38.0 38.0 37.4 38.0 35-39 37.277049999999996 38.0 38.0 38.0 36.8 38.0 40-44 36.719899999999996 38.0 38.0 38.0 35.2 38.0 45-49 37.048500000000004 38.0 38.0 38.0 36.0 38.0 50-54 37.2033 38.0 38.0 38.0 36.8 38.0 55-59 37.1117 38.0 38.0 38.0 36.2 38.0 60-64 37.16455 38.0 38.0 38.0 36.0 38.0 65-69 37.09085 38.0 38.0 38.0 36.0 38.0 70-74 32.21765 38.0 26.8 38.0 15.4 38.0 75-79 33.01089999999999 38.0 35.8 38.0 12.0 38.0 80-84 35.11710000000001 38.0 37.2 38.0 29.0 38.0 85-89 36.146499999999996 38.0 38.0 38.0 33.4 38.0 90-94 36.20215 38.0 37.8 38.0 33.4 38.0 95-99 36.21245 38.0 37.8 38.0 33.8 38.0 100-104 36.1438 38.0 37.6 38.0 33.4 38.0 105-109 36.18435000000001 38.0 37.8 38.0 33.8 38.0 110-114 34.633 38.0 35.0 38.0 25.0 38.0 115-119 34.19834999999999 37.8 34.2 38.0 23.0 38.0 120-124 34.81605 38.0 35.4 38.0 26.8 38.0 125-129 34.18545 38.0 34.4 38.0 23.0 38.0 130-134 34.031 38.0 34.6 38.0 22.8 38.0 135-139 33.4485 37.8 33.6 38.0 20.8 38.0 140-144 33.8968 38.0 34.2 38.0 23.0 38.0 145-149 32.975699999999996 38.0 33.4 38.0 16.6 38.0 150-151 28.355125 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 1.0 13 2.0 14 1.0 15 2.0 16 3.0 17 2.0 18 8.0 19 3.0 20 3.0 21 9.0 22 12.0 23 9.0 24 17.0 25 23.0 26 31.0 27 32.0 28 35.0 29 50.0 30 70.0 31 70.0 32 114.0 33 181.0 34 286.0 35 440.0 36 906.0 37 1688.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.5 15.275 11.075 33.15 2 21.675 18.625 34.725 24.975 3 17.974999999999998 27.55 28.225 26.25 4 21.95 33.050000000000004 23.225 21.775 5 21.25 36.075 23.05 19.625 6 18.275 34.9 26.724999999999998 20.1 7 14.674999999999999 20.95 44.6 19.775000000000002 8 18.025 23.400000000000002 29.25 29.325000000000003 9 17.4 23.974999999999998 32.074999999999996 26.55 10-14 19.94199419941994 30.118011801180117 26.122612261226124 23.817381738173818 15-19 20.05 29.044999999999998 27.365000000000002 23.54 20-24 19.88 29.24 27.169999999999998 23.71 25-29 19.922969187675072 28.53641456582633 28.061224489795915 23.47939175670268 30-34 20.362036203620363 28.412841284128415 27.2977297729773 23.927392739273927 35-39 20.167016701670168 28.782878287828783 27.16271627162716 23.887388738873888 40-44 19.83880656788146 28.344012815378456 28.063676411694033 23.753504205046056 45-49 20.349999999999998 28.110000000000003 27.815 23.724999999999998 50-54 20.47102355117756 28.40642032101605 27.296364818240914 23.826191309565477 55-59 20.798319327731093 28.051220488195277 27.721088435374146 23.42937174869948 60-64 19.762905162064826 28.621448579431775 27.631052420968388 23.984593837535016 65-69 20.06601980594178 28.368510553165947 27.603280984295285 23.96218865659698 70-74 19.75048422012077 29.121567733849833 27.49800615244389 23.629941893585507 75-79 20.40637012630423 28.00109829763866 27.715540911587038 23.87699066447007 80-84 20.582453962342232 28.548520587626736 27.250155183116075 23.61887026691496 85-89 20.98232221775814 28.490357573322623 27.47589393330655 23.051426275612698 90-94 20.514102820564112 28.255651130226045 27.335467093418686 23.894778955791157 95-99 20.877087708770876 28.102810281028102 27.467746774677465 23.552355235523553 100-104 20.622062206220622 28.412841284128415 27.722772277227726 23.242324232423243 105-109 19.96 28.475 27.334999999999997 24.23 110-114 20.421021051052552 28.346417320866042 27.631381569078457 23.60118005900295 115-119 20.823123468520276 27.974196129419415 26.92403860579087 24.27864179626944 120-124 20.48638911128903 28.938150520416333 26.836469175340273 23.738991192954366 125-129 21.105 27.62 27.405 23.87 130-134 20.955 28.37 26.674999999999997 24.0 135-139 21.005 27.655 27.315 24.025 140-144 20.97 28.16 26.724999999999998 24.145 145-149 20.73207320732073 29.03290329032903 26.612661266126615 23.622362236223623 150-151 20.75 28.3125 26.875 24.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 0.5 22 0.0 23 1.0 24 2.5 25 4.5 26 7.5 27 9.5 28 12.5 29 19.0 30 23.0 31 32.5 32 46.0 33 54.5 34 68.5 35 86.5 36 105.0 37 125.5 38 142.5 39 177.0 40 209.5 41 222.5 42 237.5 43 252.5 44 252.5 45 243.5 46 251.5 47 232.0 48 202.0 49 187.0 50 158.5 51 130.5 52 108.0 53 93.0 54 72.5 55 54.5 56 46.0 57 34.0 58 26.5 59 23.0 60 14.5 61 7.0 62 4.5 63 4.0 64 4.5 65 3.0 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.04 30-34 0.01 35-39 0.01 40-44 0.12 45-49 0.0 50-54 0.005 55-59 0.04 60-64 0.04 65-69 0.03 70-74 12.23 75-79 8.95 80-84 3.34 85-89 0.44 90-94 0.02 95-99 0.01 100-104 0.01 105-109 0.0 110-114 0.005 115-119 0.015 120-124 0.08 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08929926637995 97.925 2 0.8095117632178092 1.6 3 0.025297242600556536 0.075 4 0.05059448520111307 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025297242600556536 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAACTAATCTCGTATGC 8 0.2 TruSeq Adapter, Index 23 (97% over 38bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.2374999999999998 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.8 0.0 0.0 0.0 0.0 116-117 2.0250000000000004 0.0 0.0 0.0 0.0 118-119 2.1875 0.0 0.0 0.0 0.0 120-121 2.5625 0.0 0.0 0.0 0.0 122-123 2.9749999999999996 0.0 0.0 0.0 0.0 124-125 3.2875 0.0 0.0 0.0 0.0 126-127 3.55 0.0 0.0 0.0 0.0 128-129 3.7 0.0 0.0 0.0 0.0 130-131 4.2375 0.0 0.0 0.0 0.0 132-133 4.6125 0.0 0.0 0.0 0.0 134-135 5.025 0.0 0.0 0.0 0.0 136-137 5.5125 0.0 0.0 0.0 0.0 138-139 6.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGTAA 10 0.0072561596 142.1 9 >>END_MODULE SRR7230815 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230815_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.80825 33.0 33.0 34.0 32.0 34.0 2 33.017 34.0 33.0 34.0 32.0 34.0 3 32.997 34.0 33.0 34.0 32.0 34.0 4 32.92 34.0 33.0 34.0 33.0 34.0 5 32.864 34.0 33.0 34.0 32.0 34.0 6 36.76325 38.0 38.0 38.0 36.0 38.0 7 36.92475 38.0 38.0 38.0 37.0 38.0 8 36.823 38.0 38.0 38.0 36.0 38.0 9 36.875 38.0 38.0 38.0 36.0 38.0 10-14 36.77795 38.0 38.0 38.0 36.0 38.0 15-19 36.8911 38.0 38.0 38.0 36.6 38.0 20-24 36.876999999999995 38.0 38.0 38.0 36.6 38.0 25-29 36.80800000000001 38.0 38.0 38.0 36.4 38.0 30-34 36.77310000000001 38.0 38.0 38.0 36.6 38.0 35-39 36.51475 38.0 38.0 38.0 35.4 38.0 40-44 36.2748 38.0 38.0 38.0 34.0 38.0 45-49 36.647749999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.606899999999996 38.0 38.0 38.0 35.8 38.0 55-59 36.1883 38.0 38.0 38.0 34.0 38.0 60-64 36.54045 38.0 38.0 38.0 35.4 38.0 65-69 36.229 38.0 38.0 38.0 34.8 38.0 70-74 36.16675 38.0 38.0 38.0 34.2 38.0 75-79 36.298649999999995 38.0 38.0 38.0 34.6 38.0 80-84 36.1943 38.0 38.0 38.0 34.0 38.0 85-89 36.1299 38.0 38.0 38.0 34.0 38.0 90-94 36.07935 38.0 38.0 38.0 34.2 38.0 95-99 35.4418 38.0 37.2 38.0 29.0 38.0 100-104 35.6327 38.0 38.0 38.0 32.2 38.0 105-109 35.083600000000004 38.0 36.8 38.0 28.0 38.0 110-114 35.3998 38.0 37.0 38.0 31.0 38.0 115-119 35.4033 38.0 37.0 38.0 31.0 38.0 120-124 35.15304999999999 38.0 36.8 38.0 29.4 38.0 125-129 34.837599999999995 38.0 36.0 38.0 27.8 38.0 130-134 34.696999999999996 38.0 36.0 38.0 27.4 38.0 135-139 34.30315 38.0 35.6 38.0 24.0 38.0 140-144 33.790800000000004 38.0 34.2 38.0 22.2 38.0 145-149 32.89614999999999 38.0 33.0 38.0 12.4 38.0 150-151 27.244 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 7.0 4 4.0 5 5.0 6 2.0 7 5.0 8 1.0 9 2.0 10 4.0 11 3.0 12 6.0 13 7.0 14 6.0 15 2.0 16 6.0 17 13.0 18 5.0 19 4.0 20 9.0 21 9.0 22 14.0 23 9.0 24 21.0 25 13.0 26 22.0 27 34.0 28 31.0 29 39.0 30 45.0 31 61.0 32 95.0 33 105.0 34 128.0 35 234.0 36 529.0 37 2506.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.95 19.35 15.525 26.174999999999997 2 27.625 23.625 32.025 16.725 3 22.125 28.15 31.1 18.625 4 23.200000000000003 34.675 22.725 19.400000000000002 5 24.65 36.225 21.3 17.825 6 20.375 36.55 23.425 19.650000000000002 7 19.2 18.025 41.449999999999996 21.325 8 21.224999999999998 24.175 26.700000000000003 27.900000000000002 9 22.075 24.05 29.75 24.125 10-14 23.635 28.610000000000003 26.47 21.285 15-19 23.635 27.72 27.845 20.8 20-24 23.13 28.23 28.015 20.625 25-29 23.595 28.515 27.005000000000003 20.885 30-34 23.43 28.134999999999998 27.505000000000003 20.93 35-39 23.141570785392695 27.763881940970485 27.6088044022011 21.48574287143572 40-44 23.373506025903886 27.86417962694404 27.56913537030555 21.19317897684653 45-49 23.210802700675167 27.87696924231058 27.581895473868467 21.330332583145786 50-54 22.955000000000002 27.955000000000002 27.67 21.42 55-59 24.09444863099724 27.0936950514946 27.781964330570208 21.029891986937955 60-64 23.544708941788357 27.395479095819162 27.680536107221442 21.379275855171034 65-69 23.555466076102274 27.441111334809744 27.979665794242 21.023756794845983 70-74 23.381909547738694 27.587939698492463 27.85929648241206 21.170854271356784 75-79 23.391169558477923 28.126406320316015 27.651382569128458 20.831041552077604 80-84 23.850732829773396 27.247261267570405 27.88754939722875 21.014456505427443 85-89 23.875 27.85 27.189999999999998 21.085 90-94 23.51 28.04 27.855 20.595 95-99 23.630000000000003 27.555000000000003 28.13 20.685000000000002 100-104 23.705000000000002 27.810000000000002 28.03 20.455000000000002 105-109 23.745 28.02 27.595 20.64 110-114 23.175 28.395 27.950000000000003 20.48 115-119 23.89 28.035 27.38 20.695 120-124 24.48 27.465 28.105000000000004 19.950000000000003 125-129 24.765 27.439999999999998 27.425 20.369999999999997 130-134 24.625 27.894999999999996 27.47 20.01 135-139 24.71247124712471 27.317731773177318 27.532753275327533 20.437043704370435 140-144 24.82869004151453 28.194868203871355 27.769719401790628 19.206722352823487 145-149 25.019999999999996 28.64 26.534999999999997 19.805 150-151 25.324999999999996 27.400000000000002 27.237499999999997 20.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 1.0 23 1.0 24 2.5 25 4.0 26 5.0 27 5.5 28 5.5 29 8.0 30 11.0 31 13.5 32 25.0 33 37.0 34 50.0 35 64.0 36 78.5 37 105.5 38 133.0 39 161.0 40 179.5 41 210.5 42 233.0 43 242.5 44 266.5 45 281.0 46 261.5 47 236.5 48 248.5 49 217.0 50 159.0 51 134.5 52 125.5 53 116.0 54 100.0 55 77.0 56 51.5 57 38.0 58 27.5 59 23.5 60 20.0 61 12.5 62 9.0 63 5.0 64 1.5 65 0.5 66 0.5 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 1.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.05 40-44 0.015 45-49 0.025 50-54 0.0 55-59 0.475 60-64 0.02 65-69 0.66 70-74 0.5 75-79 0.005 80-84 0.045 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.034999999999999996 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36964195663137 98.52499999999999 2 0.5042864346949066 1.0 3 0.10085728693898136 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.02521432173474534 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 7 0.17500000000000002 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.325 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.7625000000000002 0.0 0.0 0.0 0.0 114-115 2.0125 0.0 0.0 0.0 0.0 116-117 2.2375 0.0 0.0 0.0 0.0 118-119 2.4125 0.0 0.0 0.0 0.0 120-121 2.7750000000000004 0.0 0.0 0.0 0.0 122-123 3.1125 0.0 0.0 0.0 0.0 124-125 3.4125 0.0 0.0 0.0 0.0 126-127 3.7249999999999996 0.0 0.0 0.0 0.0 128-129 3.9000000000000004 0.0 0.0 0.0 0.0 130-131 4.4375 0.0 0.0 0.0 0.0 132-133 4.8375 0.0 0.0 0.0 0.0 134-135 5.25 0.0 0.0 0.0 0.0 136-137 5.775 0.0 0.0 0.0 0.0 138-139 6.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 25 4.956611E-4 29.0201 140-144 >>END_MODULE Read 773187 spots for SRR7230815.sra Written 773187 spots for SRR7230815.sra Read 773187 spots for SRR7230815.sra Written 773187 spots for SRR7230815.sra Read 773187 spots for SRR7230815.sra Written 773187 spots for SRR7230815.sra Read 773187 spots for SRR7230815.sra Written 773187 spots for SRR7230815.sra Read 773187 spots for SRR7230815.sra Written 773187 spots for SRR7230815.sra Read 773187 spots for SRR7230815.sra Written 773187 spots for SRR7230815.sra Read 773187 spots for SRR7230815.sra Written 773187 spots for SRR7230815.sra Read 773187 spots for SRR7230815.sra Written 773187 spots for SRR7230815.sra Read 773187 spots for SRR7230815.sra Written 773187 spots for SRR7230815.sra Read 773187 spots for SRR7230815.sra Written 773187 spots for SRR7230815.sra Read 773187 spots for SRR7230815.sra Written 773187 spots for SRR7230815.sra Read 773197 spots for SRR7230815.sra Written 773197 spots for SRR7230815.sra Read 773187 spots for SRR7230815.sra Written 773187 spots for SRR7230815.sra Read 773187 spots for SRR7230815.sra Written 773187 spots for SRR7230815.sra Read 773187 spots for SRR7230815.sra Written 773187 spots for SRR7230815.sra Read 773187 spots for SRR7230815.sra Written 773187 spots for SRR7230815.sra Read 773187 spots for SRR7230815.sra Written 773187 spots for SRR7230815.sra Read 773187 spots for SRR7230815.sra Written 773187 spots for SRR7230815.sra Read 773187 spots for SRR7230815.sra Written 773187 spots for SRR7230815.sra Read 773187 spots for SRR7230815.sra Written 773187 spots for SRR7230815.sra SRR ids: ['SRR7230815.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zo131bhf SRR7230815.sra spots: 15463750 blocks: [[1, 773187], [773188, 1546374], [1546375, 2319561], [2319562, 3092748], [3092749, 3865935], [3865936, 4639122], [4639123, 5412309], [5412310, 6185496], [6185497, 6958683], [6958684, 7731870], [7731871, 8505057], [8505058, 9278244], [9278245, 10051431], [10051432, 10824618], [10824619, 11597805], [11597806, 12370992], [12370993, 13144179], [13144180, 13917366], [13917367, 14690553], [14690554, 15463750]] SRR7230815 file size 5218457 SRR7230815 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230815 SRR7230815_1.fastq SRR7230815_2.fastq Input file: SRR7230815_1.fastq Paired file: SRR7230815_2.fastq trimmed: SRR7230815-trimmed-pair1.fastq, SRR7230815-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:13:33 2025 >> started Tue Feb 11 10:13:56 2025 >> done (23.782s) 15463750 read pairs processed; of these: 32529 ( 0.21%) short read pairs filtered out after trimming by size control 50405 ( 0.33%) empty read pairs filtered out after trimming by size control 15380816 (99.46%) read pairs available; of these: 7051435 (45.85%) trimmed read pairs available after processing 8329381 (54.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 6 0.00% 21 5 0.00% 22 5 0.00% 23 5 0.00% 24 8 0.00% 25 4 0.00% 26 9 0.00% 27 6 0.00% 28 8 0.00% 29 9 0.00% 30 17 0.00% 31 11 0.00% 32 15 0.00% 33 7 0.00% 34 6 0.00% 35 17 0.00% 36 13 0.00% 37 18 0.00% 38 24 0.00% 39 17 0.00% 40 21 0.00% 41 37 0.00% 42 26 0.00% 43 26 0.00% 44 35 0.00% 45 46 0.00% 46 43 0.00% 47 44 0.00% 48 44 0.00% 49 67 0.00% 50 77 0.00% 51 71 0.00% 52 96 0.00% 53 98 0.00% 54 99 0.00% 55 129 0.00% 56 122 0.00% 57 133 0.00% 58 154 0.00% 59 205 0.00% 60 210 0.00% 61 209 0.00% 62 283 0.00% 63 282 0.00% 64 288 0.00% 65 348 0.00% 66 414 0.00% 67 511 0.00% 68 615 0.00% 69 1144 0.01% 70 1102 0.01% 71 884 0.01% 72 824 0.01% 73 873 0.01% 74 974 0.01% 75 1071 0.01% 76 1226 0.01% 77 1344 0.01% 78 1499 0.01% 79 1744 0.01% 80 1823 0.01% 81 2164 0.01% 82 2742 0.02% 83 2853 0.02% 84 4337 0.03% 85 5249 0.03% 86 5574 0.04% 87 5930 0.04% 88 6031 0.04% 89 6216 0.04% 90 6733 0.04% 91 6943 0.05% 92 7389 0.05% 93 8097 0.05% 94 8494 0.06% 95 8920 0.06% 96 9452 0.06% 97 9972 0.06% 98 10516 0.07% 99 11006 0.07% 100 11456 0.07% 101 12188 0.08% 102 12915 0.08% 103 13888 0.09% 104 14434 0.09% 105 15493 0.10% 106 16055 0.10% 107 16741 0.11% 108 17691 0.12% 109 18689 0.12% 110 19766 0.13% 111 20593 0.13% 112 21309 0.14% 113 22766 0.15% 114 23693 0.15% 115 24616 0.16% 116 25867 0.17% 117 26609 0.17% 118 27564 0.18% 119 28660 0.19% 120 29923 0.19% 121 31238 0.20% 122 32288 0.21% 123 34371 0.22% 124 35897 0.23% 125 37714 0.25% 126 39305 0.26% 127 40267 0.26% 128 41942 0.27% 129 43990 0.29% 130 45596 0.30% 131 48022 0.31% 132 50400 0.33% 133 53355 0.35% 134 56431 0.37% 135 59783 0.39% 136 62170 0.40% 137 67168 0.44% 138 69820 0.45% 139 74764 0.49% 140 79375 0.52% 141 86791 0.56% 142 94668 0.62% 143 105753 0.69% 144 120915 0.79% 145 141830 0.92% 146 173610 1.13% 147 229681 1.49% 148 337884 2.20% 149 651434 4.24% 150 3535985 22.99% 151 8329381 54.15% 15380816 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=18 prefix-density=0.54 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=355.41 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.7 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=21 prefix-density=0.61 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=56.26 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.7 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACA SRR7230815 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:14:42 Started mapping on | Feb 11 10:14:42 Finished on | Feb 11 10:16:41 Mapping speed, Million of reads per hour | 465.30 Number of input reads | 15380816 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14235687 Uniquely mapped reads % | 92.55% Average mapped length | 294.11 Number of splices: Total | 13714757 Number of splices: Annotated (sjdb) | 13411603 Number of splices: GT/AG | 13443853 Number of splices: GC/AG | 222222 Number of splices: AT/AC | 8551 Number of splices: Non-canonical | 40131 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 380844 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 94123 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.21% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 794048 794048 794048 N_multimapping 380844 380844 380844 N_noFeature 550171 13995964 636621 N_ambiguous 249310 969 95452 UnstrandedReadsAssigned:13436206 PositiveStrandReadsAssigned:238754 NegativeStrandReadsAssigned:13503614 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7230815 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230815-trimmed-pair1.fastq SRR7230815-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,380,816 reads, 13,535,779 reads pseudoaligned [quant] estimated average fragment length: 238.797 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR7230815.ke.tsv 34699 SRR7230815.se.tsv 87100 total ==> SRR7230815.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.2 571 21.0066 Potri.005G024800.1.v4.1 1035 797.203 201 16.5126 Potri.004G059700.1.v4.1 961 723.237 18 1.62997 Potri.007G009000.2.v4.1 1416 1178.2 0 0 Potri.003G141000.2.v4.1 2943 2705.2 962 23.2897 Potri.016G087400.1.v4.1 270 80.4598 873 710.597 Potri.015G069301.1.v4.1 564 331.265 0 0 Potri.010G195200.1.v4.1 1773 1535.2 19 0.810543 Potri.012G127500.1.v4.1 977 739.225 110 9.7455 ==> SRR7230815.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 763 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 313 Potri.001G212900.v4.1 41 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 54 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 7 SRR7230815 completed mapping pipeline successfully