Starting /dee2/code/volunteer_pipeline.sh SRR7230816 current disk space = 3053502271488 free memory = 1578615568 SRR7230816 SRAfilesize 9ccded403e0320b9b4cab1f0d57aa31c SRR7230816.sra SRR7230816.sra file validated SRR7230816 is paired end SRR7230816 is conventional basespace SRR7230816 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230816_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.5095 34.0 33.0 34.0 33.0 34.0 2 33.5165 34.0 34.0 34.0 33.0 34.0 3 33.57125 34.0 34.0 34.0 33.0 34.0 4 33.4975 34.0 34.0 34.0 33.0 34.0 5 33.487 34.0 34.0 34.0 33.0 34.0 6 37.335 38.0 38.0 38.0 37.0 38.0 7 37.5765 38.0 38.0 38.0 37.0 38.0 8 37.63725 38.0 38.0 38.0 38.0 38.0 9 37.66625 38.0 38.0 38.0 38.0 38.0 10-14 37.6683 38.0 38.0 38.0 38.0 38.0 15-19 37.39435 38.0 38.0 38.0 37.0 38.0 20-24 37.64325 38.0 38.0 38.0 38.0 38.0 25-29 37.60535 38.0 38.0 38.0 38.0 38.0 30-34 37.560449999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.28159999999999 38.0 38.0 38.0 37.4 38.0 40-44 36.977199999999996 38.0 38.0 38.0 36.0 38.0 45-49 37.0268 38.0 38.0 38.0 36.2 38.0 50-54 36.753699999999995 38.0 37.8 38.0 34.8 38.0 55-59 37.29975 38.0 38.0 38.0 37.0 38.0 60-64 37.33794999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.29345 38.0 38.0 38.0 37.0 38.0 70-74 32.87785 38.0 29.2 38.0 15.8 38.0 75-79 33.2903 38.0 36.6 38.0 14.4 38.0 80-84 35.351600000000005 38.0 38.0 38.0 29.6 38.0 85-89 36.30964999999999 38.0 38.0 38.0 34.0 38.0 90-94 36.67115 38.0 38.0 38.0 34.8 38.0 95-99 36.6991 38.0 38.0 38.0 34.8 38.0 100-104 35.80615 38.0 37.0 38.0 30.2 38.0 105-109 36.30885 38.0 37.6 38.0 33.4 38.0 110-114 35.9251 38.0 37.2 38.0 32.2 38.0 115-119 36.2658 38.0 37.8 38.0 34.0 38.0 120-124 35.41915 38.0 36.2 38.0 27.8 38.0 125-129 35.46379999999999 38.0 36.0 38.0 30.4 38.0 130-134 34.937 38.0 35.2 38.0 26.0 38.0 135-139 35.22175 38.0 35.4 38.0 29.8 38.0 140-144 34.4806 38.0 35.0 38.0 26.0 38.0 145-149 33.7772 38.0 34.2 38.0 22.6 38.0 150-151 30.051625 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 3.0 15 1.0 16 1.0 17 0.0 18 3.0 19 5.0 20 1.0 21 1.0 22 11.0 23 11.0 24 7.0 25 12.0 26 13.0 27 21.0 28 34.0 29 36.0 30 47.0 31 58.0 32 101.0 33 155.0 34 257.0 35 386.0 36 710.0 37 2122.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.9 16.425 7.875 31.8 2 21.224999999999998 19.1 36.225 23.45 3 17.45 26.950000000000003 28.325 27.275 4 22.575 33.125 22.825 21.475 5 21.2 38.05 22.5 18.25 6 17.625 35.625 26.1 20.65 7 14.174999999999999 22.225 45.225 18.375 8 16.900000000000002 23.175 30.875000000000004 29.049999999999997 9 17.299999999999997 21.95 33.15 27.6 10-14 20.23 29.17 27.375 23.225 15-19 19.68 28.51 27.634999999999998 24.175 20-24 20.27 28.050000000000004 27.705000000000002 23.974999999999998 25-29 19.805 28.525 28.015 23.655 30-34 19.77 28.33 28.134999999999998 23.765 35-39 19.91194716830098 28.131879127476484 27.606563938363017 24.349609765859515 40-44 20.134396469585276 29.01058121458302 27.37575848753824 23.479263828293465 45-49 20.385 28.33 27.63 23.655 50-54 19.794999999999998 28.775000000000002 27.675 23.755000000000003 55-59 20.25803870580587 28.4142621393209 27.509126368955343 23.818572785917887 60-64 20.244999999999997 28.735 27.72 23.3 65-69 20.655 28.165000000000003 27.634999999999998 23.544999999999998 70-74 20.30308151653428 28.398400090135766 27.570277730832064 23.72824066249789 75-79 19.879916271896 28.13154125812493 27.49807205023686 24.490470419742206 80-84 20.222615208571725 28.414646832414437 27.384791428274212 23.977946530739626 85-89 20.648878107944206 28.062462098241358 27.3398019001415 23.948857893672933 90-94 20.06 28.21 27.785 23.945 95-99 21.095 27.525 28.02 23.36 100-104 20.975243810952737 28.162040510127532 27.68192048012003 23.1807951987997 105-109 20.426127838351505 27.858357507252173 28.103431029308794 23.612083625087525 110-114 20.75 27.99 27.67 23.59 115-119 20.93 27.51 28.165000000000003 23.395 120-124 20.61 28.275 27.200000000000003 23.915 125-129 20.496521347414788 28.024425646929274 27.724110315831624 23.754942689824315 130-134 21.038128162733607 27.94228167743875 26.855052858359635 24.16453730146801 135-139 20.733109966494975 28.564284642696403 26.869030354553182 23.83357503625544 140-144 21.012101210121013 28.14281428142814 27.21272127212721 23.632363236323634 145-149 20.71828731492597 28.726490596238495 26.720688275310124 23.83453381352541 150-151 21.007877954232836 29.01087907965487 26.372389646117295 23.608853319995 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.5 22 2.0 23 5.0 24 6.0 25 3.0 26 4.5 27 9.5 28 17.0 29 21.0 30 21.5 31 30.0 32 45.5 33 56.5 34 66.0 35 88.0 36 113.5 37 127.0 38 148.5 39 178.5 40 192.0 41 198.5 42 220.0 43 248.0 44 256.0 45 259.5 46 250.5 47 238.0 48 221.5 49 202.5 50 166.5 51 120.0 52 98.5 53 87.0 54 76.0 55 58.0 56 43.5 57 34.0 58 25.0 59 19.0 60 13.5 61 5.5 62 6.0 63 6.0 64 2.0 65 1.0 66 2.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.06 40-44 0.295 45-49 0.0 50-54 0.0 55-59 0.015 60-64 0.0 65-69 0.0 70-74 11.245 75-79 9.229999999999999 80-84 3.8699999999999997 85-89 1.06 90-94 0.0 95-99 0.0 100-104 0.025 105-109 0.03 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.105 130-134 0.20500000000000002 135-139 0.015 140-144 0.01 145-149 0.04 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01415571284126 97.925 2 0.8847320525783621 1.7500000000000002 3 0.07583417593528817 0.22499999999999998 4 0.02527805864509606 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.0750000000000002 0.0 0.0 0.0 0.0 110-111 1.2375 0.0 0.0 0.0 0.0 112-113 1.4500000000000002 0.0 0.0 0.0 0.0 114-115 1.625 0.0 0.0 0.0 0.0 116-117 1.7999999999999998 0.0 0.0 0.0 0.0 118-119 2.025 0.0 0.0 0.0 0.0 120-121 2.325 0.0 0.0 0.0 0.0 122-123 2.575 0.0 0.0 0.0 0.0 124-125 2.95 0.0 0.0 0.0 0.0 126-127 3.2875 0.0 0.0 0.0 0.0 128-129 3.7 0.0 0.0 0.0 0.0 130-131 4.1 0.0 0.0 0.0 0.0 132-133 4.4875 0.0 0.0 0.0 0.0 134-135 4.9125 0.0 0.0 0.0 0.0 136-137 5.2875 0.0 0.0 0.0 0.0 138-139 5.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7230816 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230816_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93525 34.0 33.0 34.0 32.0 34.0 2 33.11075 34.0 33.0 34.0 33.0 34.0 3 33.109 34.0 33.0 34.0 33.0 34.0 4 33.0645 34.0 33.0 34.0 33.0 34.0 5 33.0505 34.0 33.0 34.0 33.0 34.0 6 37.232 38.0 38.0 38.0 37.0 38.0 7 37.17925 38.0 38.0 38.0 38.0 38.0 8 37.2175 38.0 38.0 38.0 38.0 38.0 9 37.14875 38.0 38.0 38.0 37.0 38.0 10-14 37.1374 38.0 38.0 38.0 37.4 38.0 15-19 37.1712 38.0 38.0 38.0 37.4 38.0 20-24 37.113099999999996 38.0 38.0 38.0 37.2 38.0 25-29 37.08265 38.0 38.0 38.0 37.0 38.0 30-34 37.04855 38.0 38.0 38.0 37.0 38.0 35-39 36.89 38.0 38.0 38.0 36.8 38.0 40-44 36.88395 38.0 38.0 38.0 36.8 38.0 45-49 36.965999999999994 38.0 38.0 38.0 37.0 38.0 50-54 36.9956 38.0 38.0 38.0 37.0 38.0 55-59 36.678 38.0 38.0 38.0 36.2 38.0 60-64 36.805150000000005 38.0 38.0 38.0 36.4 38.0 65-69 36.68265 38.0 38.0 38.0 36.4 38.0 70-74 36.44035 38.0 38.0 38.0 35.0 38.0 75-79 36.709700000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.682050000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.68745 38.0 38.0 38.0 35.8 38.0 90-94 36.605599999999995 38.0 38.0 38.0 36.0 38.0 95-99 36.563399999999994 38.0 38.0 38.0 35.6 38.0 100-104 36.31385 38.0 38.0 38.0 34.2 38.0 105-109 36.219899999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.1786 38.0 38.0 38.0 34.0 38.0 115-119 36.06035 38.0 38.0 38.0 33.6 38.0 120-124 35.8275 38.0 38.0 38.0 33.0 38.0 125-129 35.6167 38.0 37.6 38.0 32.6 38.0 130-134 35.5145 38.0 37.6 38.0 32.0 38.0 135-139 34.989149999999995 38.0 36.2 38.0 29.0 38.0 140-144 34.60045 38.0 36.0 38.0 27.8 38.0 145-149 33.7076 38.0 35.4 38.0 21.8 38.0 150-151 28.217750000000002 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 2.0 4 5.0 5 5.0 6 2.0 7 0.0 8 4.0 9 3.0 10 1.0 11 1.0 12 2.0 13 1.0 14 2.0 15 4.0 16 7.0 17 5.0 18 7.0 19 2.0 20 6.0 21 7.0 22 9.0 23 9.0 24 15.0 25 10.0 26 19.0 27 19.0 28 20.0 29 27.0 30 45.0 31 41.0 32 54.0 33 80.0 34 122.0 35 179.0 36 498.0 37 2776.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.69369369369369 21.42142142142142 11.411411411411411 23.473473473473476 2 26.344758568926697 24.0180135101326 32.749562171628725 16.887665749311985 3 20.150000000000002 27.925 32.275 19.650000000000002 4 22.85 36.375 22.8 17.974999999999998 5 23.974999999999998 37.55 21.675 16.8 6 19.15 37.974999999999994 23.45 19.425 7 17.349999999999998 19.625 41.65 21.375 8 20.4 23.575 27.875 28.15 9 21.5 25.124999999999996 29.325000000000003 24.05 10-14 23.314662932586515 28.74574914982996 26.24524904980996 21.694338867773556 15-19 23.002300230023 27.71777177717772 28.237823782378236 21.04210421042104 20-24 22.755688922230558 28.35708927231808 27.51187796949237 21.37534383595899 25-29 22.88915566226491 28.82152861144458 27.03581432573029 21.253501400560225 30-34 22.929585917183438 28.305661132226444 27.650530106021204 21.114222844568914 35-39 22.531265632816407 27.973986993496748 27.56378189094547 21.93096548274137 40-44 22.849569913982798 28.235647129425885 27.510502100420087 21.404280856171233 45-49 22.958366693354684 27.502001601281023 28.16753402722178 21.372097678142516 50-54 23.25255357500501 27.87903064290006 27.66372922090927 21.20468656118566 55-59 23.57203965577978 27.80433797997081 27.688591414624327 20.935030949625084 60-64 22.95706197705296 27.10055614008718 27.89217896688211 22.050202915977753 65-69 23.39634023728132 27.664387693545144 27.860446410617335 21.0788256585562 70-74 23.027407593663565 27.84510937892884 27.412622579834046 21.714860447573546 75-79 23.250812703175793 27.67691922980745 27.486871717929485 21.585396349087272 80-84 23.778746430181876 28.102610351220005 27.1957512901448 20.92289192845333 85-89 23.605 27.62 27.765 21.01 90-94 23.64709412823847 27.948384515354608 27.21816544963489 21.186355906772032 95-99 23.410852713178297 27.686921730432605 27.781945486371594 21.120280070017504 100-104 23.905 27.800000000000004 27.54 20.755000000000003 105-109 23.415 28.275 27.93 20.380000000000003 110-114 23.901731211848293 27.64935454818373 27.694386070249173 20.754528169718803 115-119 23.99219765929779 27.58327498249475 27.698309492847855 20.726217865359608 120-124 24.165 27.855 27.065 20.915 125-129 24.325 27.634999999999998 27.775 20.265 130-134 24.23 28.084999999999997 27.169999999999998 20.515 135-139 24.819675415748346 27.664796633941098 27.008615507914246 20.506912442396313 140-144 24.385 27.735 27.685 20.195 145-149 24.715 28.585 26.724999999999998 19.975 150-151 25.5625 27.762500000000003 26.775 19.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 3.0 24 3.5 25 2.5 26 4.5 27 9.0 28 8.0 29 10.5 30 18.0 31 23.5 32 32.0 33 45.5 34 52.0 35 54.0 36 75.0 37 104.0 38 132.0 39 148.0 40 184.0 41 226.5 42 236.5 43 249.5 44 264.0 45 252.0 46 245.0 47 247.0 48 218.5 49 204.0 50 184.5 51 146.0 52 130.0 53 113.5 54 94.5 55 78.5 56 56.0 57 36.0 58 28.0 59 26.5 60 17.5 61 8.0 62 8.0 63 6.5 64 2.0 65 0.5 66 0.5 67 1.5 68 2.0 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.02 15-19 0.01 20-24 0.025 25-29 0.04 30-34 0.02 35-39 0.05 40-44 0.02 45-49 0.08 50-54 0.13999999999999999 55-59 0.645 60-64 0.20500000000000002 65-69 0.54 70-74 0.575 75-79 0.025 80-84 0.20500000000000002 85-89 0.0 90-94 0.03 95-99 0.025 100-104 0.0 105-109 0.0 110-114 0.06999999999999999 115-119 0.03 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.18 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11437246963563 97.925 2 0.6578947368421052 1.3 3 0.15182186234817813 0.44999999999999996 4 0.05060728744939271 0.2 5 0.025303643724696356 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.48750000000000004 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.3125 0.0 0.0 0.0 0.0 112-113 1.5 0.0 0.0 0.0 0.0 114-115 1.65 0.0 0.0 0.0 0.0 116-117 1.8250000000000002 0.0 0.0 0.0 0.0 118-119 2.05 0.0 0.0 0.0 0.0 120-121 2.3499999999999996 0.0 0.0 0.0 0.0 122-123 2.6 0.0 0.0 0.0 0.0 124-125 2.9875 0.0 0.0 0.0 0.0 126-127 3.3375 0.0 0.0 0.0 0.0 128-129 3.75 0.0 0.0 0.0 0.0 130-131 4.15 0.0 0.0 0.0 0.0 132-133 4.5625 0.0 0.0 0.0 0.0 134-135 5.0 0.0 0.0 0.0 0.0 136-137 5.4125 0.0 0.0 0.0 0.0 138-139 5.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACCAG 10 0.006993593 143.86249 2 TTGGTTC 10 0.006993593 143.86249 3 >>END_MODULE Read 690312 spots for SRR7230816.sra Written 690312 spots for SRR7230816.sra Read 690312 spots for SRR7230816.sra Written 690312 spots for SRR7230816.sra Read 690312 spots for SRR7230816.sra Written 690312 spots for SRR7230816.sra Read 690312 spots for SRR7230816.sra Written 690312 spots for SRR7230816.sra Read 690312 spots for SRR7230816.sra Written 690312 spots for SRR7230816.sra Read 690312 spots for SRR7230816.sra Written 690312 spots for SRR7230816.sra Read 690312 spots for SRR7230816.sra Written 690312 spots for SRR7230816.sra Read 690312 spots for SRR7230816.sra Written 690312 spots for SRR7230816.sra Read 690312 spots for SRR7230816.sra Written 690312 spots for SRR7230816.sra Read 690312 spots for SRR7230816.sra Written 690312 spots for SRR7230816.sra Read 690312 spots for SRR7230816.sra Written 690312 spots for SRR7230816.sra Read 690321 spots for SRR7230816.sra Written 690321 spots for SRR7230816.sra Read 690312 spots for SRR7230816.sra Written 690312 spots for SRR7230816.sra Read 690312 spots for SRR7230816.sra Written 690312 spots for SRR7230816.sra Read 690312 spots for SRR7230816.sra Written 690312 spots for SRR7230816.sra Read 690312 spots for SRR7230816.sra Written 690312 spots for SRR7230816.sra Read 690312 spots for SRR7230816.sra Written 690312 spots for SRR7230816.sra Read 690312 spots for SRR7230816.sra Written 690312 spots for SRR7230816.sra Read 690312 spots for SRR7230816.sra Written 690312 spots for SRR7230816.sra Read 690312 spots for SRR7230816.sra Written 690312 spots for SRR7230816.sra SRR ids: ['SRR7230816.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_frlg_4z9 SRR7230816.sra spots: 13806249 blocks: [[1, 690312], [690313, 1380624], [1380625, 2070936], [2070937, 2761248], [2761249, 3451560], [3451561, 4141872], [4141873, 4832184], [4832185, 5522496], [5522497, 6212808], [6212809, 6903120], [6903121, 7593432], [7593433, 8283744], [8283745, 8974056], [8974057, 9664368], [9664369, 10354680], [10354681, 11044992], [11044993, 11735304], [11735305, 12425616], [12425617, 13115928], [13115929, 13806249]] SRR7230816 file size 4656784 SRR7230816 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230816 SRR7230816_1.fastq SRR7230816_2.fastq Input file: SRR7230816_1.fastq Paired file: SRR7230816_2.fastq trimmed: SRR7230816-trimmed-pair1.fastq, SRR7230816-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:15:07 2025 >> started Tue Feb 11 10:15:22 2025 >> done (14.254s) 13806249 read pairs processed; of these: 18947 ( 0.14%) short read pairs filtered out after trimming by size control 15109 ( 0.11%) empty read pairs filtered out after trimming by size control 13772193 (99.75%) read pairs available; of these: 5744871 (41.71%) trimmed read pairs available after processing 8027322 (58.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 2 0.00% 21 7 0.00% 22 4 0.00% 23 8 0.00% 24 5 0.00% 25 7 0.00% 26 6 0.00% 27 7 0.00% 28 8 0.00% 29 9 0.00% 30 12 0.00% 31 14 0.00% 32 13 0.00% 33 18 0.00% 34 16 0.00% 35 12 0.00% 36 12 0.00% 37 11 0.00% 38 22 0.00% 39 21 0.00% 40 21 0.00% 41 21 0.00% 42 26 0.00% 43 24 0.00% 44 38 0.00% 45 39 0.00% 46 33 0.00% 47 49 0.00% 48 50 0.00% 49 48 0.00% 50 62 0.00% 51 91 0.00% 52 101 0.00% 53 82 0.00% 54 101 0.00% 55 106 0.00% 56 143 0.00% 57 144 0.00% 58 198 0.00% 59 195 0.00% 60 195 0.00% 61 188 0.00% 62 197 0.00% 63 233 0.00% 64 271 0.00% 65 311 0.00% 66 325 0.00% 67 447 0.00% 68 572 0.00% 69 1332 0.01% 70 1272 0.01% 71 727 0.01% 72 729 0.01% 73 821 0.01% 74 850 0.01% 75 879 0.01% 76 1005 0.01% 77 1064 0.01% 78 1239 0.01% 79 1440 0.01% 80 1728 0.01% 81 2424 0.02% 82 2013 0.01% 83 2354 0.02% 84 3862 0.03% 85 3859 0.03% 86 3846 0.03% 87 4304 0.03% 88 4534 0.03% 89 4765 0.03% 90 5276 0.04% 91 5520 0.04% 92 5920 0.04% 93 6367 0.05% 94 6708 0.05% 95 6967 0.05% 96 7426 0.05% 97 7774 0.06% 98 8136 0.06% 99 8745 0.06% 100 9374 0.07% 101 9894 0.07% 102 10357 0.08% 103 10819 0.08% 104 11548 0.08% 105 12173 0.09% 106 12826 0.09% 107 13470 0.10% 108 14159 0.10% 109 15253 0.11% 110 16065 0.12% 111 16773 0.12% 112 17253 0.13% 113 18422 0.13% 114 19153 0.14% 115 20254 0.15% 116 20991 0.15% 117 21989 0.16% 118 22906 0.17% 119 23810 0.17% 120 25126 0.18% 121 26174 0.19% 122 26898 0.20% 123 28639 0.21% 124 29409 0.21% 125 30864 0.22% 126 31859 0.23% 127 33351 0.24% 128 34905 0.25% 129 36799 0.27% 130 38103 0.28% 131 39231 0.28% 132 41113 0.30% 133 43265 0.31% 134 46020 0.33% 135 47690 0.35% 136 50128 0.36% 137 52941 0.38% 138 56009 0.41% 139 59068 0.43% 140 63037 0.46% 141 68379 0.50% 142 73117 0.53% 143 81367 0.59% 144 92286 0.67% 145 107033 0.78% 146 128727 0.93% 147 167423 1.22% 148 246915 1.79% 149 480676 3.49% 150 3022414 21.95% 151 8027322 58.29% 13772193 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=3.69 fanout-score-rank=6 prefix-density=0.83 prefix-fanout=3.0 sequence=CCATTGCTTGCAATGGAAGTAATGTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=55.45 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.8 sequence=AAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCT criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=22 prefix-density=0.84 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=42.78 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.6 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTG SRR7230816 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:16:02 Started mapping on | Feb 11 10:16:02 Finished on | Feb 11 10:17:35 Mapping speed, Million of reads per hour | 533.12 Number of input reads | 13772193 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 12955381 Uniquely mapped reads % | 94.07% Average mapped length | 294.90 Number of splices: Total | 12695537 Number of splices: Annotated (sjdb) | 12429391 Number of splices: GT/AG | 12443126 Number of splices: GC/AG | 214765 Number of splices: AT/AC | 6369 Number of splices: Non-canonical | 31277 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 322026 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 49745 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.13% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 515341 515341 515341 N_multimapping 322026 322026 322026 N_noFeature 485392 12718491 584949 N_ambiguous 228697 983 90699 UnstrandedReadsAssigned:12241292 PositiveStrandReadsAssigned:235907 NegativeStrandReadsAssigned:12279733 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7230816 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230816-trimmed-pair1.fastq SRR7230816-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,772,193 reads, 12,258,301 reads pseudoaligned [quant] estimated average fragment length: 245.324 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,040 rounds 52401 SRR7230816.ke.tsv 34699 SRR7230816.se.tsv 87100 total ==> SRR7230816.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.68 386 15.9282 Potri.005G024800.1.v4.1 1035 790.676 83 7.68304 Potri.004G059700.1.v4.1 961 716.753 13 1.32748 Potri.007G009000.2.v4.1 1416 1171.68 0 0 Potri.003G141000.2.v4.1 2943 2698.68 782 21.2085 Potri.016G087400.1.v4.1 270 79.9621 449 410.975 Potri.015G069301.1.v4.1 564 326.144 0 0 Potri.010G195200.1.v4.1 1773 1528.68 12 0.574539 Potri.012G127500.1.v4.1 977 732.722 14 1.39843 ==> SRR7230816.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 573 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 240 Potri.001G212900.v4.1 23 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR7230816 completed mapping pipeline successfully