Starting /dee2/code/volunteer_pipeline.sh SRR7230817 current disk space = 3053163991040 free memory = 1573696488 SRR7230817 SRAfilesize ee9d4b3958d652e8e32554bee3b1bc3a SRR7230817.sra SRR7230817.sra file validated SRR7230817 is paired end SRR7230817 is conventional basespace SRR7230817 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230817_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.798 33.0 33.0 34.0 32.0 34.0 2 33.19075 34.0 33.0 34.0 32.0 34.0 3 33.3255 34.0 33.0 34.0 33.0 34.0 4 33.36675 34.0 33.0 34.0 33.0 34.0 5 31.8455 34.0 33.0 34.0 27.0 34.0 6 36.54625 38.0 37.0 38.0 33.0 38.0 7 37.2 38.0 38.0 38.0 36.0 38.0 8 37.5235 38.0 38.0 38.0 37.0 38.0 9 37.4895 38.0 38.0 38.0 38.0 38.0 10-14 37.46489999999999 38.0 38.0 38.0 37.8 38.0 15-19 37.47785 38.0 38.0 38.0 37.8 38.0 20-24 36.944900000000004 38.0 38.0 38.0 35.6 38.0 25-29 37.36875 38.0 38.0 38.0 37.0 38.0 30-34 37.31755 38.0 38.0 38.0 36.8 38.0 35-39 37.0646 38.0 38.0 38.0 36.0 38.0 40-44 36.7513 38.0 38.0 38.0 35.0 38.0 45-49 37.2134 38.0 38.0 38.0 36.8 38.0 50-54 37.1869 38.0 38.0 38.0 36.6 38.0 55-59 37.06445 38.0 38.0 38.0 36.0 38.0 60-64 37.11725 38.0 38.0 38.0 36.0 38.0 65-69 37.12325 38.0 38.0 38.0 36.0 38.0 70-74 30.151750000000003 38.0 19.0 38.0 15.4 38.0 75-79 31.166000000000004 38.0 30.8 38.0 7.0 38.0 80-84 34.626349999999995 38.0 36.6 38.0 25.6 38.0 85-89 35.99185 38.0 37.8 38.0 31.8 38.0 90-94 36.382400000000004 38.0 37.8 38.0 33.6 38.0 95-99 36.3038 38.0 38.0 38.0 33.6 38.0 100-104 36.458349999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.3477 38.0 38.0 38.0 34.0 38.0 110-114 36.23975 38.0 37.8 38.0 33.8 38.0 115-119 35.912099999999995 38.0 37.0 38.0 32.8 38.0 120-124 35.5935 38.0 36.4 38.0 31.0 38.0 125-129 35.1571 38.0 36.0 38.0 28.2 38.0 130-134 34.947 38.0 35.4 38.0 27.8 38.0 135-139 34.93755 38.0 35.2 38.0 28.0 38.0 140-144 34.40785 38.0 35.0 38.0 25.4 38.0 145-149 33.794200000000004 38.0 33.4 38.0 23.4 38.0 150-151 29.48075 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 2.0 16 2.0 17 3.0 18 1.0 19 2.0 20 5.0 21 5.0 22 9.0 23 8.0 24 13.0 25 18.0 26 13.0 27 23.0 28 34.0 29 37.0 30 74.0 31 92.0 32 104.0 33 210.0 34 301.0 35 459.0 36 885.0 37 1696.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.875 15.475 8.774999999999999 33.875 2 22.2 19.425 35.525 22.85 3 18.475 26.974999999999998 27.500000000000004 27.05 4 21.475 34.35 23.3 20.875 5 21.55 36.725 23.525 18.2 6 18.175 35.099999999999994 25.275 21.45 7 13.375 21.275 45.25 20.1 8 16.650000000000002 22.725 32.074999999999996 28.549999999999997 9 18.8 22.175 31.75 27.275 10-14 20.395 29.549999999999997 26.83 23.225 15-19 19.695 28.37 28.199999999999996 23.735 20-24 20.8 29.160000000000004 27.045 22.994999999999997 25-29 20.0 28.57 27.584999999999997 23.845 30-34 19.605 29.62 26.91 23.865 35-39 20.405 28.845 26.83 23.919999999999998 40-44 20.266079823947184 28.348504551365412 27.728318495548663 23.65709712913874 45-49 20.225 28.525 27.529999999999998 23.72 50-54 19.250962548127408 29.386469323466173 27.801390069503473 23.561178058902946 55-59 20.37120416228926 28.280554304867678 27.500125068787835 23.84811646405523 60-64 19.85694993247637 28.810083529235232 26.98944630620717 24.34352023208123 65-69 20.14007003501751 28.199099549774886 27.49374687343672 24.167083541770886 70-74 20.565427123404774 27.62410697930024 27.990474445869207 23.81999145142578 75-79 20.321257294736235 27.95978505806899 27.87311492459698 23.845842722597794 80-84 20.35351675522121 28.63380503971803 27.255510547635332 23.75716765742543 85-89 20.857070834383666 28.268212755230653 27.50693219057222 23.367784219813462 90-94 20.369999999999997 28.23 27.725 23.674999999999997 95-99 20.845 28.34 27.169999999999998 23.645 100-104 20.905 28.134999999999998 27.315 23.645 105-109 20.26 28.255000000000003 27.76 23.724999999999998 110-114 21.465 28.175 27.61 22.75 115-119 20.815 28.46 27.16 23.565 120-124 20.695 28.305000000000003 27.38 23.62 125-129 20.61 27.939999999999998 27.700000000000003 23.75 130-134 20.955 28.294999999999998 27.115000000000002 23.635 135-139 20.630000000000003 28.68 27.375 23.315 140-144 21.404999999999998 27.51 27.1 23.985 145-149 20.655 28.215 26.97 24.16 150-151 21.475 27.150000000000002 27.05 24.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 1.5 22 2.0 23 0.5 24 2.0 25 5.0 26 6.0 27 11.0 28 16.0 29 26.0 30 31.5 31 30.5 32 47.5 33 62.0 34 70.5 35 95.0 36 115.0 37 134.0 38 151.5 39 178.5 40 215.5 41 218.5 42 220.5 43 234.0 44 245.5 45 239.5 46 238.0 47 233.0 48 202.5 49 196.0 50 172.5 51 137.5 52 120.0 53 97.5 54 65.0 55 42.0 56 34.5 57 23.0 58 19.0 59 16.5 60 12.5 61 9.0 62 5.5 63 4.0 64 1.5 65 0.5 66 1.0 67 1.5 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.03 45-49 0.0 50-54 0.005 55-59 0.055 60-64 0.034999999999999996 65-69 0.05 70-74 18.115000000000002 75-79 13.465 80-84 4.955 85-89 0.8250000000000001 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26933736457546 98.5 2 0.6802721088435374 1.35 3 0.05039052658100278 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.6625 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 0.9875 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.7875 0.0 0.0 0.0 0.0 124-125 2.0375 0.0 0.0 0.0 0.0 126-127 2.3375 0.0 0.0 0.0 0.0 128-129 2.475 0.0 0.0 0.0 0.0 130-131 2.8125 0.0 0.0 0.0 0.0 132-133 3.125 0.0 0.0 0.0 0.0 134-135 3.5250000000000004 0.0 0.0 0.0 0.0 136-137 4.0 0.0 0.0 0.0 0.0 138-139 4.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7230817 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230817_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8275 33.0 33.0 34.0 32.0 34.0 2 32.9605 34.0 33.0 34.0 32.0 34.0 3 33.027 34.0 33.0 34.0 32.0 34.0 4 33.0235 34.0 33.0 34.0 32.0 34.0 5 32.53925 34.0 33.0 34.0 32.0 34.0 6 36.73625 38.0 38.0 38.0 35.0 38.0 7 36.9035 38.0 38.0 38.0 36.0 38.0 8 36.89125 38.0 38.0 38.0 36.0 38.0 9 36.92825 38.0 38.0 38.0 36.0 38.0 10-14 36.63815 38.0 38.0 38.0 34.6 38.0 15-19 37.18895 38.0 38.0 38.0 37.0 38.0 20-24 37.05865 38.0 38.0 38.0 36.6 38.0 25-29 36.728449999999995 38.0 38.0 38.0 35.2 38.0 30-34 36.90245 38.0 38.0 38.0 36.0 38.0 35-39 36.70245 38.0 38.0 38.0 35.2 38.0 40-44 36.261399999999995 38.0 38.0 38.0 32.8 38.0 45-49 36.7308 38.0 38.0 38.0 35.2 38.0 50-54 36.86375 38.0 38.0 38.0 35.6 38.0 55-59 36.8399 38.0 38.0 38.0 36.0 38.0 60-64 36.62545 38.0 38.0 38.0 35.2 38.0 65-69 36.33489999999999 38.0 37.8 38.0 33.4 38.0 70-74 36.58945 38.0 38.0 38.0 35.0 38.0 75-79 36.6479 38.0 38.0 38.0 35.0 38.0 80-84 36.57135 38.0 38.0 38.0 35.0 38.0 85-89 36.6068 38.0 38.0 38.0 35.0 38.0 90-94 36.5339 38.0 38.0 38.0 34.8 38.0 95-99 36.2723 38.0 38.0 38.0 34.0 38.0 100-104 35.6549 38.0 37.0 38.0 30.8 38.0 105-109 35.662 38.0 37.2 38.0 31.2 38.0 110-114 35.870999999999995 38.0 37.2 38.0 32.6 38.0 115-119 35.908750000000005 38.0 37.8 38.0 33.0 38.0 120-124 35.56625 38.0 37.0 38.0 31.4 38.0 125-129 35.127300000000005 38.0 36.0 38.0 28.4 38.0 130-134 35.088499999999996 38.0 36.0 38.0 28.4 38.0 135-139 34.7732 38.0 35.8 38.0 27.6 38.0 140-144 34.1913 38.0 34.6 38.0 24.4 38.0 145-149 33.2226 38.0 33.0 38.0 17.4 38.0 150-151 26.658749999999998 34.5 15.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 3.0 5 1.0 6 1.0 7 1.0 8 2.0 9 3.0 10 3.0 11 0.0 12 2.0 13 6.0 14 3.0 15 4.0 16 2.0 17 2.0 18 3.0 19 5.0 20 13.0 21 5.0 22 4.0 23 7.0 24 19.0 25 25.0 26 15.0 27 21.0 28 38.0 29 56.0 30 58.0 31 65.0 32 81.0 33 126.0 34 160.0 35 256.0 36 590.0 37 2415.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.65 18.4 13.125 26.825 2 24.15 24.3 33.775 17.775 3 20.65 27.525 30.775000000000002 21.05 4 21.825 36.125 21.85 20.200000000000003 5 23.200000000000003 36.85 22.75 17.2 6 20.75 37.625 23.0 18.625 7 18.425 18.25 42.15 21.175 8 21.6 22.95 28.050000000000004 27.400000000000002 9 22.925 24.025 28.675 24.375 10-14 22.884999999999998 29.044999999999998 26.155 21.915000000000003 15-19 23.16 28.035 27.6 21.205 20-24 22.585 27.76 28.084999999999997 21.57 25-29 23.375 28.035 27.255000000000003 21.335 30-34 22.53 28.54 27.400000000000002 21.529999999999998 35-39 22.869999999999997 28.1 27.77 21.26 40-44 22.830000000000002 27.834999999999997 27.725 21.61 45-49 22.305 27.93 28.494999999999997 21.27 50-54 22.560152068430796 27.822520134060326 27.802511130008504 21.814816667500374 55-59 23.192831397677214 27.282739287144576 28.02863436123348 21.49579495394473 60-64 23.225 27.384999999999998 27.845 21.545 65-69 23.405746320953046 27.790569626589246 27.4251676844529 21.378516368004803 70-74 23.52735098343426 27.781392322706573 27.240878834893152 21.450377858966018 75-79 23.31 27.389999999999997 28.22 21.08 80-84 23.01345201780267 27.72415862379357 28.22423363504526 21.038155723358503 85-89 23.765 27.57 27.68 20.985 90-94 22.895 27.72 28.04 21.345 95-99 22.855 27.334999999999997 28.1 21.709999999999997 100-104 23.405 27.250000000000004 28.000000000000004 21.345 105-109 23.26 27.950000000000003 27.750000000000004 21.04 110-114 23.105 28.294999999999998 28.225 20.375 115-119 23.385 28.13 27.915 20.57 120-124 23.44 27.700000000000003 28.03 20.830000000000002 125-129 24.23 27.505000000000003 28.215 20.05 130-134 24.27 27.765 27.71 20.255000000000003 135-139 23.880000000000003 27.315 28.139999999999997 20.665 140-144 24.04 27.74 27.534999999999997 20.685000000000002 145-149 25.095 27.389999999999997 27.474999999999998 20.04 150-151 24.4 27.950000000000003 27.05 20.599999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 1.5 23 1.0 24 1.5 25 2.5 26 2.0 27 6.5 28 9.0 29 15.5 30 20.5 31 22.5 32 26.0 33 37.5 34 56.5 35 61.5 36 74.5 37 97.0 38 113.5 39 145.5 40 180.0 41 201.0 42 227.5 43 258.5 44 282.0 45 277.0 46 280.0 47 270.5 48 227.0 49 196.0 50 173.5 51 144.5 52 127.0 53 104.5 54 77.5 55 69.5 56 57.5 57 44.0 58 28.0 59 21.0 60 19.5 61 12.0 62 8.0 63 6.0 64 4.5 65 3.5 66 1.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.045 55-59 0.12 60-64 0.0 65-69 0.11 70-74 0.095 75-79 0.0 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21717171717171 98.225 2 0.6818181818181818 1.35 3 0.025252525252525252 0.075 4 0.025252525252525252 0.1 5 0.050505050505050504 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TCTCAATCCATATTTCTTCACTATGAGTCCTTTTTCTTACATATCGTTGT 5 0.125 No Hit CTTCGATTAACAGCTGGTGTCTCACCTCTGTCTCTGCCTCTAAGAGATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.025 0.0 0.0 0.025 0.0 88-89 0.025 0.0 0.0 0.025 0.0 90-91 0.0875 0.0 0.0 0.025 0.0 92-93 0.1875 0.0 0.0 0.025 0.0 94-95 0.25 0.0 0.0 0.025 0.0 96-97 0.2875 0.0 0.0 0.025 0.0 98-99 0.35 0.0 0.0 0.025 0.0 100-101 0.42500000000000004 0.0 0.0 0.025 0.0 102-103 0.475 0.0 0.0 0.025 0.0 104-105 0.5375000000000001 0.0 0.0 0.025 0.0 106-107 0.6875 0.0 0.0 0.025 0.0 108-109 0.75 0.0 0.0 0.025 0.0 110-111 0.8 0.0 0.0 0.025 0.0 112-113 0.85 0.0 0.0 0.025 0.0 114-115 1.0125 0.0 0.0 0.025 0.0 116-117 1.2375 0.0 0.0 0.025 0.0 118-119 1.3125 0.0 0.0 0.025 0.0 120-121 1.5875 0.0 0.0 0.025 0.0 122-123 1.8125 0.0 0.0 0.025 0.0 124-125 2.05 0.0 0.0 0.025 0.0 126-127 2.3375 0.0 0.0 0.025 0.0 128-129 2.475 0.0 0.0 0.025 0.0 130-131 2.8499999999999996 0.0 0.0 0.025 0.0 132-133 3.1500000000000004 0.0 0.0 0.025 0.0 134-135 3.55 0.0 0.0 0.025 0.0 136-137 3.975 0.0 0.0 0.025 0.0 138-139 4.35 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAACAAG 10 0.006830828 145.0 9 AATAACA 10 0.006830828 145.0 7 >>END_MODULE Read 1142560 spots for SRR7230817.sra Written 1142560 spots for SRR7230817.sra Read 1142560 spots for SRR7230817.sra Written 1142560 spots for SRR7230817.sra Read 1142560 spots for SRR7230817.sra Written 1142560 spots for SRR7230817.sra Read 1142560 spots for SRR7230817.sra Written 1142560 spots for SRR7230817.sra Read 1142560 spots for SRR7230817.sra Written 1142560 spots for SRR7230817.sra Read 1142560 spots for SRR7230817.sra Written 1142560 spots for SRR7230817.sra Read 1142560 spots for SRR7230817.sra Written 1142560 spots for SRR7230817.sra Read 1142560 spots for SRR7230817.sra Written 1142560 spots for SRR7230817.sra Read 1142560 spots for SRR7230817.sra Written 1142560 spots for SRR7230817.sra Read 1142560 spots for SRR7230817.sra Written 1142560 spots for SRR7230817.sra Read 1142560 spots for SRR7230817.sra Written 1142560 spots for SRR7230817.sra Read 1142560 spots for SRR7230817.sra Written 1142560 spots for SRR7230817.sra Read 1142560 spots for SRR7230817.sra Written 1142560 spots for SRR7230817.sra Read 1142560 spots for SRR7230817.sra Written 1142560 spots for SRR7230817.sra Read 1142560 spots for SRR7230817.sra Written 1142560 spots for SRR7230817.sra Read 1142560 spots for SRR7230817.sra Written 1142560 spots for SRR7230817.sra Read 1142560 spots for SRR7230817.sra Written 1142560 spots for SRR7230817.sra Read 1142560 spots for SRR7230817.sra Written 1142560 spots for SRR7230817.sra Read 1142573 spots for SRR7230817.sra Written 1142573 spots for SRR7230817.sra Read 1142560 spots for SRR7230817.sra Written 1142560 spots for SRR7230817.sra SRR ids: ['SRR7230817.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n4fqcd_0 SRR7230817.sra spots: 22851213 blocks: [[1, 1142560], [1142561, 2285120], [2285121, 3427680], [3427681, 4570240], [4570241, 5712800], [5712801, 6855360], [6855361, 7997920], [7997921, 9140480], [9140481, 10283040], [10283041, 11425600], [11425601, 12568160], [12568161, 13710720], [13710721, 14853280], [14853281, 15995840], [15995841, 17138400], [17138401, 18280960], [18280961, 19423520], [19423521, 20566080], [20566081, 21708640], [21708641, 22851213]] SRR7230817 file size 7721825 SRR7230817 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230817 SRR7230817_1.fastq SRR7230817_2.fastq Input file: SRR7230817_1.fastq Paired file: SRR7230817_2.fastq trimmed: SRR7230817-trimmed-pair1.fastq, SRR7230817-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:34:54 2025 >> started Tue Feb 11 10:35:17 2025 >> done (23.228s) 22851213 read pairs processed; of these: 19073 ( 0.08%) short read pairs filtered out after trimming by size control 18917 ( 0.08%) empty read pairs filtered out after trimming by size control 22813223 (99.83%) read pairs available; of these: 10196973 (44.70%) trimmed read pairs available after processing 12616250 (55.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 0 0.00% 21 4 0.00% 22 5 0.00% 23 6 0.00% 24 6 0.00% 25 5 0.00% 26 9 0.00% 27 5 0.00% 28 5 0.00% 29 9 0.00% 30 17 0.00% 31 9 0.00% 32 8 0.00% 33 16 0.00% 34 12 0.00% 35 13 0.00% 36 15 0.00% 37 21 0.00% 38 22 0.00% 39 17 0.00% 40 27 0.00% 41 20 0.00% 42 29 0.00% 43 30 0.00% 44 29 0.00% 45 31 0.00% 46 38 0.00% 47 43 0.00% 48 42 0.00% 49 52 0.00% 50 59 0.00% 51 62 0.00% 52 62 0.00% 53 79 0.00% 54 96 0.00% 55 107 0.00% 56 117 0.00% 57 141 0.00% 58 135 0.00% 59 153 0.00% 60 180 0.00% 61 197 0.00% 62 232 0.00% 63 312 0.00% 64 295 0.00% 65 331 0.00% 66 390 0.00% 67 391 0.00% 68 481 0.00% 69 691 0.00% 70 725 0.00% 71 708 0.00% 72 754 0.00% 73 835 0.00% 74 887 0.00% 75 1019 0.00% 76 1090 0.00% 77 1228 0.01% 78 1444 0.01% 79 1572 0.01% 80 1884 0.01% 81 2062 0.01% 82 2294 0.01% 83 2636 0.01% 84 3905 0.02% 85 4557 0.02% 86 4766 0.02% 87 5151 0.02% 88 5360 0.02% 89 5641 0.02% 90 6172 0.03% 91 6510 0.03% 92 7025 0.03% 93 7580 0.03% 94 8123 0.04% 95 8427 0.04% 96 9088 0.04% 97 9561 0.04% 98 10255 0.04% 99 10779 0.05% 100 11763 0.05% 101 12303 0.05% 102 13227 0.06% 103 13927 0.06% 104 14665 0.06% 105 15507 0.07% 106 16333 0.07% 107 17542 0.08% 108 18339 0.08% 109 19467 0.09% 110 20387 0.09% 111 21682 0.10% 112 22637 0.10% 113 23928 0.10% 114 25318 0.11% 115 26525 0.12% 116 27554 0.12% 117 28909 0.13% 118 30318 0.13% 119 32007 0.14% 120 33507 0.15% 121 35027 0.15% 122 36729 0.16% 123 39190 0.17% 124 41244 0.18% 125 42974 0.19% 126 45515 0.20% 127 47475 0.21% 128 49973 0.22% 129 52822 0.23% 130 55117 0.24% 131 58360 0.26% 132 61746 0.27% 133 65724 0.29% 134 69687 0.31% 135 74845 0.33% 136 79457 0.35% 137 85158 0.37% 138 91831 0.40% 139 99957 0.44% 140 106299 0.47% 141 116386 0.51% 142 129780 0.57% 143 146423 0.64% 144 171681 0.75% 145 213736 0.94% 146 261395 1.15% 147 352048 1.54% 148 524136 2.30% 149 1039869 4.56% 150 5419445 23.76% 151 12616250 55.30% 22813223 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=13 prefix-density=0.82 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.16 sequence-density-rank=19 fanout-score=30.01 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=10.6 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=21 prefix-density=0.94 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=91.57 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=8.7 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAAG SRR7230817 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:36:21 Started mapping on | Feb 11 10:36:22 Finished on | Feb 11 10:39:01 Mapping speed, Million of reads per hour | 516.53 Number of input reads | 22813223 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 21410750 Uniquely mapped reads % | 93.85% Average mapped length | 295.59 Number of splices: Total | 20613553 Number of splices: Annotated (sjdb) | 20199101 Number of splices: GT/AG | 20177218 Number of splices: GC/AG | 374549 Number of splices: AT/AC | 11601 Number of splices: Non-canonical | 50185 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 615073 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 96735 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.92% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 807625 807625 807625 N_multimapping 615073 615073 615073 N_noFeature 748378 21096261 875889 N_ambiguous 345175 1283 157340 UnstrandedReadsAssigned:20317197 PositiveStrandReadsAssigned:313206 NegativeStrandReadsAssigned:20377521 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7230817 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230817-trimmed-pair1.fastq SRR7230817-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,813,223 reads, 20,383,970 reads pseudoaligned [quant] estimated average fragment length: 256.139 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,238 rounds 52401 SRR7230817.ke.tsv 34699 SRR7230817.se.tsv 87100 total ==> SRR7230817.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.86 676 17.745 Potri.005G024800.1.v4.1 1035 779.861 127 7.5359 Potri.004G059700.1.v4.1 961 705.948 13 0.852156 Potri.007G009000.2.v4.1 1416 1160.86 0 0 Potri.003G141000.2.v4.1 2943 2687.86 979 16.8548 Potri.016G087400.1.v4.1 270 74.9035 956 590.614 Potri.015G069301.1.v4.1 564 316.517 0 0 Potri.010G195200.1.v4.1 1773 1517.86 35 1.06705 Potri.012G127500.1.v4.1 977 721.902 638 40.8969 ==> SRR7230817.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 181 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 326 Potri.001G212900.v4.1 98 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 20 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7230817 completed mapping pipeline successfully