Starting /dee2/code/volunteer_pipeline.sh SRR7230819 current disk space = 3053033005056 free memory = 1579511404 SRR7230819 SRAfilesize cdab94ca1916227b193ef4d5cf969405 SRR7230819.sra SRR7230819.sra file validated SRR7230819 is paired end SRR7230819 is conventional basespace SRR7230819 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230819_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.752 34.0 33.0 34.0 32.0 34.0 2 32.9495 34.0 33.0 34.0 31.0 34.0 3 33.03675 34.0 33.0 34.0 32.0 34.0 4 33.122 34.0 33.0 34.0 32.0 34.0 5 33.2115 34.0 33.0 34.0 32.0 34.0 6 36.8875 38.0 37.0 38.0 35.0 38.0 7 37.3205 38.0 38.0 38.0 36.0 38.0 8 37.25975 38.0 38.0 38.0 37.0 38.0 9 37.40375 38.0 38.0 38.0 37.0 38.0 10-14 37.448249999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.346500000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.2534 38.0 38.0 38.0 36.6 38.0 25-29 37.10605 38.0 38.0 38.0 36.4 38.0 30-34 37.09525 38.0 38.0 38.0 36.6 38.0 35-39 37.160450000000004 38.0 38.0 38.0 36.4 38.0 40-44 37.08755 38.0 38.0 38.0 36.0 38.0 45-49 37.13715 38.0 38.0 38.0 36.0 38.0 50-54 37.00815 38.0 38.0 38.0 36.0 38.0 55-59 36.8832 38.0 38.0 38.0 35.4 38.0 60-64 36.834 38.0 38.0 38.0 35.4 38.0 65-69 36.83325 38.0 38.0 38.0 35.4 38.0 70-74 36.36794999999999 38.0 37.6 38.0 32.8 38.0 75-79 36.55065 38.0 38.0 38.0 34.2 38.0 80-84 36.49175 38.0 38.0 38.0 34.0 38.0 85-89 36.34035 38.0 37.8 38.0 33.8 38.0 90-94 36.09455 38.0 37.0 38.0 32.4 38.0 95-99 35.878049999999995 38.0 36.8 38.0 31.6 38.0 100-104 35.59554999999999 38.0 36.8 38.0 30.0 38.0 105-109 35.025400000000005 38.0 35.8 38.0 26.4 38.0 110-114 35.48535 38.0 36.2 38.0 29.8 38.0 115-119 35.206900000000005 38.0 36.0 38.0 28.4 38.0 120-124 35.126099999999994 38.0 35.8 38.0 28.0 38.0 125-129 34.5583 38.0 34.8 38.0 25.4 38.0 130-134 34.198 38.0 34.6 38.0 23.4 38.0 135-139 33.603500000000004 38.0 33.8 38.0 21.4 38.0 140-144 32.924 38.0 32.8 38.0 16.6 38.0 145-149 31.405399999999997 37.6 31.2 38.0 8.6 38.0 150-151 26.340249999999997 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 4.0 16 2.0 17 1.0 18 4.0 19 4.0 20 8.0 21 5.0 22 7.0 23 15.0 24 17.0 25 15.0 26 28.0 27 31.0 28 55.0 29 47.0 30 64.0 31 92.0 32 109.0 33 156.0 34 226.0 35 372.0 36 704.0 37 2030.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.22373591826042 15.771548336389834 10.558029866387216 35.44668587896253 2 22.525000000000002 20.4 34.475 22.6 3 18.37959489872468 27.631907976994246 25.63140785196299 28.35708927231808 4 21.4 35.375 22.3 20.925 5 22.6 35.699999999999996 22.95 18.75 6 16.45 36.9 26.325 20.325 7 13.875000000000002 22.25 44.75 19.125 8 18.125 22.3 31.45 28.125 9 18.224999999999998 23.599999999999998 31.45 26.724999999999998 10-14 19.945 29.695 26.695 23.665 15-19 19.62 28.799999999999997 28.000000000000004 23.580000000000002 20-24 19.59 28.365000000000002 28.025 24.02 25-29 19.895 28.360000000000003 28.04 23.705000000000002 30-34 19.835 28.835 27.845 23.485 35-39 19.625 28.585 27.905 23.885 40-44 20.175 29.03 27.605 23.189999999999998 45-49 19.93 28.345 27.985 23.74 50-54 20.395 29.044999999999998 26.995 23.565 55-59 19.835 29.235 27.455000000000002 23.474999999999998 60-64 20.24 28.194999999999997 27.925 23.64 65-69 20.1 28.249999999999996 27.83 23.82 70-74 20.825 27.794999999999998 27.71 23.669999999999998 75-79 20.74 28.875 27.47 22.915 80-84 20.622217776221678 28.6600310108538 27.719701895663484 22.998049317261042 85-89 20.79138492361633 28.64512897570749 27.292762334084646 23.270723766591537 90-94 20.176317371268283 28.526347425365657 27.95031055900621 23.34702464435985 95-99 19.950000000000003 28.395 27.83 23.825 100-104 20.33140848606578 28.636706000502134 27.612352498116998 23.41953301531509 105-109 19.91882140709561 28.73822409300461 27.806173581880135 23.53678091801964 110-114 21.27 27.805000000000003 28.110000000000003 22.814999999999998 115-119 20.605 28.37 27.544999999999998 23.48 120-124 21.34 27.694999999999997 27.49 23.474999999999998 125-129 20.405 28.754999999999995 27.27 23.57 130-134 21.12 27.915 27.515 23.45 135-139 20.51 28.405 27.034999999999997 24.05 140-144 20.97 28.544999999999998 27.065 23.419999999999998 145-149 20.7020702070207 28.542854285428543 26.8026802680268 23.952395239523952 150-151 20.7 28.549999999999997 27.1375 23.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 0.5 22 0.5 23 2.0 24 4.5 25 4.5 26 6.5 27 9.0 28 10.5 29 16.5 30 25.0 31 31.0 32 37.5 33 45.0 34 53.0 35 76.0 36 99.5 37 117.0 38 145.0 39 167.0 40 192.0 41 216.5 42 244.0 43 287.0 44 280.5 45 252.0 46 235.5 47 230.0 48 212.0 49 191.5 50 174.0 51 134.5 52 108.0 53 86.0 54 69.0 55 59.5 56 47.0 57 39.0 58 31.5 59 18.5 60 10.0 61 6.5 62 6.5 63 4.0 64 3.0 65 2.5 66 2.0 67 2.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.575 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.034999999999999996 85-89 0.17500000000000002 90-94 0.18 95-99 0.0 100-104 0.42500000000000004 105-109 0.22 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24395161290323 98.45 2 0.7056451612903225 1.4000000000000001 3 0.05040322580645161 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.0625 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.7250000000000001 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.9125000000000001 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.1749999999999998 0.0 0.0 0.0 0.0 106-107 1.2999999999999998 0.0 0.0 0.0 0.0 108-109 1.4500000000000002 0.0 0.0 0.0 0.0 110-111 1.7875 0.0 0.0 0.0 0.0 112-113 2.0375 0.0 0.0 0.0 0.0 114-115 2.4375 0.0 0.0 0.0 0.0 116-117 2.7 0.0 0.0 0.0 0.0 118-119 3.05 0.0 0.0 0.0 0.0 120-121 3.4125 0.0 0.0 0.0 0.0 122-123 3.7 0.0 0.0 0.0 0.0 124-125 4.0375 0.0 0.0 0.0 0.0 126-127 4.4375 0.0 0.0 0.0 0.0 128-129 4.7875 0.0 0.0 0.0 0.0 130-131 5.2 0.0 0.0 0.0 0.0 132-133 5.7125 0.0 0.0 0.0 0.0 134-135 6.262499999999999 0.0 0.0 0.0 0.0 136-137 6.9125 0.0 0.0 0.0 0.0 138-139 7.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAACAGA 10 0.006841402 144.925 9 GTCCATC 20 2.6198252E-4 117.50676 1 >>END_MODULE SRR7230819 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230819_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94025 33.0 33.0 34.0 32.0 34.0 2 33.03175 34.0 33.0 34.0 32.0 34.0 3 33.07225 34.0 33.0 34.0 33.0 34.0 4 32.9865 34.0 33.0 34.0 32.0 34.0 5 33.011 34.0 33.0 34.0 32.0 34.0 6 37.10075 38.0 38.0 38.0 37.0 38.0 7 37.098 38.0 38.0 38.0 37.0 38.0 8 37.087 38.0 38.0 38.0 37.0 38.0 9 37.126 38.0 38.0 38.0 37.0 38.0 10-14 36.7374 38.0 38.0 38.0 35.2 38.0 15-19 36.9668 38.0 38.0 38.0 36.6 38.0 20-24 36.98835 38.0 38.0 38.0 36.6 38.0 25-29 37.01695 38.0 38.0 38.0 36.8 38.0 30-34 36.642999999999994 38.0 38.0 38.0 35.4 38.0 35-39 36.9207 38.0 38.0 38.0 36.2 38.0 40-44 36.81995 38.0 38.0 38.0 35.8 38.0 45-49 36.73035 38.0 38.0 38.0 35.0 38.0 50-54 36.817750000000004 38.0 38.0 38.0 35.6 38.0 55-59 36.82 38.0 38.0 38.0 36.0 38.0 60-64 36.791399999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.77235 38.0 38.0 38.0 35.6 38.0 70-74 36.4231 38.0 38.0 38.0 34.4 38.0 75-79 36.59935 38.0 38.0 38.0 35.2 38.0 80-84 36.4966 38.0 38.0 38.0 34.8 38.0 85-89 36.3889 38.0 38.0 38.0 34.0 38.0 90-94 36.130700000000004 38.0 37.8 38.0 33.0 38.0 95-99 36.1303 38.0 38.0 38.0 33.6 38.0 100-104 36.14715 38.0 38.0 38.0 33.8 38.0 105-109 35.6439 38.0 37.0 38.0 31.2 38.0 110-114 35.562349999999995 38.0 37.0 38.0 30.4 38.0 115-119 35.574549999999995 38.0 37.0 38.0 31.0 38.0 120-124 35.34009999999999 38.0 36.6 38.0 30.0 38.0 125-129 34.66345 38.0 35.4 38.0 24.6 38.0 130-134 33.98855 38.0 34.8 38.0 21.6 38.0 135-139 33.5152 38.0 34.0 38.0 20.4 38.0 140-144 33.012899999999995 38.0 33.2 38.0 15.8 38.0 145-149 32.01465 38.0 31.8 38.0 11.2 38.0 150-151 28.123625 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 1.0 5 3.0 6 0.0 7 0.0 8 3.0 9 3.0 10 1.0 11 0.0 12 6.0 13 1.0 14 1.0 15 4.0 16 1.0 17 7.0 18 10.0 19 10.0 20 12.0 21 8.0 22 14.0 23 15.0 24 24.0 25 22.0 26 29.0 27 17.0 28 34.0 29 39.0 30 46.0 31 68.0 32 100.0 33 124.0 34 180.0 35 283.0 36 594.0 37 2335.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.425000000000004 18.8 14.85 28.925 2 25.474999999999998 25.5 33.375 15.65 3 19.85 27.200000000000003 31.075000000000003 21.875 4 24.275 36.175000000000004 21.125 18.425 5 24.275 35.125 22.650000000000002 17.95 6 18.3 37.375 25.025 19.3 7 18.675 18.625 42.449999999999996 20.25 8 20.5 22.900000000000002 28.249999999999996 28.349999999999998 9 22.1 23.825 29.75 24.325 10-14 22.865 28.465 26.32 22.35 15-19 22.705000000000002 27.810000000000002 28.549999999999997 20.935000000000002 20-24 22.400000000000002 27.76 29.154999999999998 20.685000000000002 25-29 22.59 28.54 28.110000000000003 20.76 30-34 22.17 28.03 28.815 20.985 35-39 22.78 28.410000000000004 28.37 20.44 40-44 23.200000000000003 27.855 28.439999999999998 20.505000000000003 45-49 22.63 28.18 28.410000000000004 20.78 50-54 22.255 28.144999999999996 28.985 20.615 55-59 23.25 27.735 28.255000000000003 20.76 60-64 22.384999999999998 28.110000000000003 28.315 21.19 65-69 22.785 27.47 28.51 21.235 70-74 23.05 28.215 28.24 20.495 75-79 23.445 27.625 27.85 21.08 80-84 22.91 27.815 28.410000000000004 20.865000000000002 85-89 23.525 27.685 27.779999999999998 21.01 90-94 23.21 28.79 27.605 20.395 95-99 23.115 27.939999999999998 28.515 20.43 100-104 23.05 28.249999999999996 28.265 20.435 105-109 23.494999999999997 28.449999999999996 27.925 20.13 110-114 23.385 28.185 28.055000000000003 20.375 115-119 23.799999999999997 27.665 28.49 20.044999999999998 120-124 24.11 28.189999999999998 27.655 20.044999999999998 125-129 24.13 28.18 27.38 20.31 130-134 24.86 27.155 27.644999999999996 20.34 135-139 23.95 28.410000000000004 27.29 20.349999999999998 140-144 24.83 27.889999999999997 27.425 19.855 145-149 25.205 28.325 27.145000000000003 19.325 150-151 25.374999999999996 27.6125 28.1375 18.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 2.5 24 3.0 25 3.5 26 5.0 27 7.0 28 9.0 29 12.0 30 18.0 31 31.5 32 47.5 33 52.0 34 51.0 35 65.0 36 83.5 37 113.5 38 139.5 39 164.0 40 203.0 41 226.0 42 253.5 43 274.0 44 283.0 45 292.0 46 264.5 47 241.0 48 217.5 49 177.5 50 154.0 51 128.5 52 102.0 53 83.0 54 68.5 55 57.0 56 39.5 57 24.5 58 22.0 59 19.0 60 15.0 61 13.0 62 12.0 63 6.0 64 2.0 65 2.0 66 2.0 67 3.0 68 2.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36820823856458 98.3 2 0.4043467273186757 0.8 3 0.1263583522870862 0.375 4 0.050543340914834464 0.2 5 0.0 0.0 6 0.025271670457417232 0.15 7 0.025271670457417232 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 7 0.17500000000000002 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.3625 0.0 0.0 0.0 0.0 116-117 2.5875 0.0 0.0 0.0 0.0 118-119 2.925 0.0 0.0 0.0 0.0 120-121 3.2875 0.0 0.0 0.0 0.0 122-123 3.6125 0.0 0.0 0.0 0.0 124-125 3.9375 0.0 0.0 0.0 0.0 126-127 4.3375 0.0 0.0 0.0 0.0 128-129 4.7125 0.0 0.0 0.0 0.0 130-131 5.112500000000001 0.0 0.0 0.0 0.0 132-133 5.637499999999999 0.0 0.0 0.0 0.0 134-135 6.2 0.0 0.0 0.0 0.0 136-137 6.887499999999999 0.0 0.0 0.0 0.0 138-139 7.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 894083 spots for SRR7230819.sra Written 894083 spots for SRR7230819.sra Read 894083 spots for SRR7230819.sra Written 894083 spots for SRR7230819.sra Read 894083 spots for SRR7230819.sra Written 894083 spots for SRR7230819.sra Read 894083 spots for SRR7230819.sra Written 894083 spots for SRR7230819.sra Read 894083 spots for SRR7230819.sra Written 894083 spots for SRR7230819.sra Read 894083 spots for SRR7230819.sra Written 894083 spots for SRR7230819.sra Read 894083 spots for SRR7230819.sra Written 894083 spots for SRR7230819.sra Read 894083 spots for SRR7230819.sra Written 894083 spots for SRR7230819.sra Read 894083 spots for SRR7230819.sra Written 894083 spots for SRR7230819.sra Read 894088 spots for SRR7230819.sra Written 894088 spots for SRR7230819.sra Read 894083 spots for SRR7230819.sra Written 894083 spots for SRR7230819.sra Read 894083 spots for SRR7230819.sra Written 894083 spots for SRR7230819.sra Read 894083 spots for SRR7230819.sra Written 894083 spots for SRR7230819.sra Read 894083 spots for SRR7230819.sra Written 894083 spots for SRR7230819.sra Read 894083 spots for SRR7230819.sra Written 894083 spots for SRR7230819.sra Read 894083 spots for SRR7230819.sra Written 894083 spots for SRR7230819.sra Read 894083 spots for SRR7230819.sra Written 894083 spots for SRR7230819.sra Read 894083 spots for SRR7230819.sra Written 894083 spots for SRR7230819.sra Read 894083 spots for SRR7230819.sra Written 894083 spots for SRR7230819.sra Read 894083 spots for SRR7230819.sra Written 894083 spots for SRR7230819.sra SRR ids: ['SRR7230819.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w940qzno SRR7230819.sra spots: 17881665 blocks: [[1, 894083], [894084, 1788166], [1788167, 2682249], [2682250, 3576332], [3576333, 4470415], [4470416, 5364498], [5364499, 6258581], [6258582, 7152664], [7152665, 8046747], [8046748, 8940830], [8940831, 9834913], [9834914, 10728996], [10728997, 11623079], [11623080, 12517162], [12517163, 13411245], [13411246, 14305328], [14305329, 15199411], [15199412, 16093494], [16093495, 16987577], [16987578, 17881665]] SRR7230819 file size 6037809 SRR7230819 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230819 SRR7230819_1.fastq SRR7230819_2.fastq Input file: SRR7230819_1.fastq Paired file: SRR7230819_2.fastq trimmed: SRR7230819-trimmed-pair1.fastq, SRR7230819-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:40:30 2025 >> started Tue Feb 11 10:40:50 2025 >> done (19.701s) 17881665 read pairs processed; of these: 17434 ( 0.10%) short read pairs filtered out after trimming by size control 12427 ( 0.07%) empty read pairs filtered out after trimming by size control 17851804 (99.83%) read pairs available; of these: 9825376 (55.04%) trimmed read pairs available after processing 8026428 (44.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 4 0.00% 21 3 0.00% 22 10 0.00% 23 4 0.00% 24 6 0.00% 25 6 0.00% 26 9 0.00% 27 10 0.00% 28 6 0.00% 29 6 0.00% 30 17 0.00% 31 11 0.00% 32 8 0.00% 33 12 0.00% 34 16 0.00% 35 13 0.00% 36 15 0.00% 37 18 0.00% 38 21 0.00% 39 24 0.00% 40 27 0.00% 41 35 0.00% 42 42 0.00% 43 49 0.00% 44 45 0.00% 45 42 0.00% 46 59 0.00% 47 62 0.00% 48 75 0.00% 49 95 0.00% 50 89 0.00% 51 116 0.00% 52 112 0.00% 53 127 0.00% 54 172 0.00% 55 191 0.00% 56 194 0.00% 57 204 0.00% 58 271 0.00% 59 275 0.00% 60 324 0.00% 61 354 0.00% 62 427 0.00% 63 420 0.00% 64 495 0.00% 65 576 0.00% 66 652 0.00% 67 703 0.00% 68 848 0.00% 69 1215 0.01% 70 1333 0.01% 71 1314 0.01% 72 1396 0.01% 73 1574 0.01% 74 1721 0.01% 75 1924 0.01% 76 2066 0.01% 77 2330 0.01% 78 2687 0.02% 79 3028 0.02% 80 3344 0.02% 81 3713 0.02% 82 4245 0.02% 83 4857 0.03% 84 6086 0.03% 85 6860 0.04% 86 7496 0.04% 87 7911 0.04% 88 8714 0.05% 89 9125 0.05% 90 9805 0.05% 91 10596 0.06% 92 11361 0.06% 93 12421 0.07% 94 13250 0.07% 95 14012 0.08% 96 14930 0.08% 97 15533 0.09% 98 16619 0.09% 99 17585 0.10% 100 18640 0.10% 101 19343 0.11% 102 20541 0.12% 103 21864 0.12% 104 22836 0.13% 105 24102 0.14% 106 25677 0.14% 107 26582 0.15% 108 27699 0.16% 109 29633 0.17% 110 30547 0.17% 111 31948 0.18% 112 33509 0.19% 113 34860 0.20% 114 36104 0.20% 115 37889 0.21% 116 39626 0.22% 117 40950 0.23% 118 42713 0.24% 119 44185 0.25% 120 45499 0.25% 121 47802 0.27% 122 49620 0.28% 123 52039 0.29% 124 54239 0.30% 125 56324 0.32% 126 58491 0.33% 127 60301 0.34% 128 62734 0.35% 129 66427 0.37% 130 69029 0.39% 131 71998 0.40% 132 75388 0.42% 133 79131 0.44% 134 83207 0.47% 135 87963 0.49% 136 92746 0.52% 137 98383 0.55% 138 105494 0.59% 139 113327 0.63% 140 121588 0.68% 141 134025 0.75% 142 147780 0.83% 143 166275 0.93% 144 190769 1.07% 145 224039 1.25% 146 279407 1.57% 147 369462 2.07% 148 548261 3.07% 149 1044169 5.85% 150 4333847 24.28% 151 8026428 44.96% 17851804 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=13 prefix-density=0.35 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=275.29 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=18.1 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCT criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=22 prefix-density=0.45 prefix-fanout=2.2 sequence=TGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=29.92 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.2 sequence=CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACC SRR7230819 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:41:33 Started mapping on | Feb 11 10:41:34 Finished on | Feb 11 10:43:39 Mapping speed, Million of reads per hour | 514.13 Number of input reads | 17851804 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16667964 Uniquely mapped reads % | 93.37% Average mapped length | 291.78 Number of splices: Total | 15745238 Number of splices: Annotated (sjdb) | 15343270 Number of splices: GT/AG | 15437858 Number of splices: GC/AG | 243352 Number of splices: AT/AC | 9731 Number of splices: Non-canonical | 54297 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 477649 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 98388 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.26% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 727207 727207 727207 N_multimapping 477649 477649 477649 N_noFeature 782375 16325564 925947 N_ambiguous 331328 1434 131538 UnstrandedReadsAssigned:15554261 PositiveStrandReadsAssigned:340966 NegativeStrandReadsAssigned:15610479 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7230819 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230819-trimmed-pair1.fastq SRR7230819-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,851,804 reads, 15,655,853 reads pseudoaligned [quant] estimated average fragment length: 239.208 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,119 rounds 52401 SRR7230819.ke.tsv 34699 SRR7230819.se.tsv 87100 total ==> SRR7230819.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.79 786 24.9818 Potri.005G024800.1.v4.1 1035 796.792 205 14.5539 Potri.004G059700.1.v4.1 961 722.83 11 0.86085 Potri.007G009000.2.v4.1 1416 1177.79 0 0 Potri.003G141000.2.v4.1 2943 2704.79 999.332 20.9 Potri.016G087400.1.v4.1 270 85.0382 672 447.019 Potri.015G069301.1.v4.1 564 331.841 0 0 Potri.010G195200.1.v4.1 1773 1534.79 57 2.10085 Potri.012G127500.1.v4.1 977 738.803 29 2.22044 ==> SRR7230819.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1113 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 340 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 29 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7230819 completed mapping pipeline successfully