Starting /dee2/code/volunteer_pipeline.sh SRR7230820 current disk space = 3054287499264 free memory = 1446394012 SRR7230820 SRAfilesize f01b7a768807a1db281e0f4e5a892a09 SRR7230820.sra SRR7230820.sra file validated SRR7230820 is paired end SRR7230820 is conventional basespace SRR7230820 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230820_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.493 34.0 33.0 34.0 33.0 34.0 2 33.528 34.0 34.0 34.0 33.0 34.0 3 33.52875 34.0 34.0 34.0 33.0 34.0 4 33.43475 34.0 34.0 34.0 33.0 34.0 5 33.495 34.0 34.0 34.0 33.0 34.0 6 37.26075 38.0 38.0 38.0 36.0 38.0 7 37.48725 38.0 38.0 38.0 37.0 38.0 8 37.60925 38.0 38.0 38.0 38.0 38.0 9 37.58025 38.0 38.0 38.0 38.0 38.0 10-14 37.58455 38.0 38.0 38.0 38.0 38.0 15-19 37.25139999999999 38.0 38.0 38.0 36.8 38.0 20-24 37.518499999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.5166 38.0 38.0 38.0 38.0 38.0 30-34 37.4782 38.0 38.0 38.0 38.0 38.0 35-39 37.15205 38.0 38.0 38.0 37.0 38.0 40-44 36.7633 38.0 38.0 38.0 35.8 38.0 45-49 36.8192 38.0 38.0 38.0 35.4 38.0 50-54 36.5385 38.0 37.8 38.0 33.6 38.0 55-59 37.11065 38.0 38.0 38.0 36.6 38.0 60-64 37.12335 38.0 38.0 38.0 37.0 38.0 65-69 37.129000000000005 38.0 38.0 38.0 36.8 38.0 70-74 32.253949999999996 38.0 26.8 38.0 15.6 38.0 75-79 32.8487 38.0 35.0 38.0 12.0 38.0 80-84 35.1589 38.0 37.6 38.0 28.8 38.0 85-89 36.05225 38.0 38.0 38.0 33.2 38.0 90-94 36.37245 38.0 38.0 38.0 34.2 38.0 95-99 36.38295000000001 38.0 38.0 38.0 34.0 38.0 100-104 35.33045 38.0 36.6 38.0 27.0 38.0 105-109 35.9186 38.0 37.0 38.0 32.4 38.0 110-114 35.48295 38.0 36.8 38.0 30.8 38.0 115-119 35.71704999999999 38.0 37.0 38.0 31.8 38.0 120-124 34.834649999999996 38.0 35.6 38.0 26.4 38.0 125-129 34.97689999999999 38.0 35.8 38.0 28.0 38.0 130-134 34.384100000000004 38.0 35.2 38.0 24.2 38.0 135-139 34.51075 38.0 35.2 38.0 25.4 38.0 140-144 33.87935 38.0 34.8 38.0 22.4 38.0 145-149 32.965900000000005 38.0 33.8 38.0 16.8 38.0 150-151 29.427625 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 3.0 9 0.0 10 1.0 11 0.0 12 1.0 13 1.0 14 4.0 15 5.0 16 3.0 17 5.0 18 9.0 19 5.0 20 3.0 21 11.0 22 7.0 23 9.0 24 11.0 25 15.0 26 27.0 27 29.0 28 32.0 29 38.0 30 48.0 31 82.0 32 105.0 33 176.0 34 260.0 35 378.0 36 873.0 37 1858.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.35 14.000000000000002 12.625 35.025 2 21.475 19.8 34.225 24.5 3 19.525000000000002 26.474999999999998 26.224999999999998 27.775 4 22.35 33.225 22.675 21.75 5 21.2 36.075 23.3 19.425 6 17.10855427713857 35.56778389194598 27.33866933466733 19.984992496248125 7 14.499999999999998 22.6 43.9 19.0 8 18.175 23.125 29.599999999999998 29.099999999999998 9 17.05 24.099999999999998 32.05 26.8 10-14 19.67 29.49 26.825 24.015 15-19 19.545 28.15 28.634999999999998 23.669999999999998 20-24 19.375 28.4 28.055000000000003 24.169999999999998 25-29 19.645000000000003 28.49 27.79 24.075 30-34 20.39 28.405 27.435 23.77 35-39 19.801682692307693 28.690905448717945 27.604166666666668 23.903245192307693 40-44 19.648064353946708 29.089994972347917 26.93815987933635 24.32378079436903 45-49 19.648929785957193 28.370674134826967 27.670534106821364 24.30986197239448 50-54 20.325 28.249999999999996 27.485 23.94 55-59 20.04800720108016 28.54428164224634 27.71915787368105 23.68855328299245 60-64 20.26 28.060000000000002 27.49 24.19 65-69 20.06901380276055 28.425685137027408 27.640528105621126 23.86477295459092 70-74 20.02055146429183 28.73208882799566 27.384826168864528 23.862533538847977 75-79 20.435455349248453 28.271441202475682 27.49778956675508 23.795313881520777 80-84 20.165057614450326 28.687843870030104 27.810650887573964 23.336447627945603 85-89 19.799878714372348 27.946230038407116 28.264604810996563 23.989286436223974 90-94 20.37203720372037 28.472847284728473 27.71277127712771 23.442344234423445 95-99 19.776977697769777 28.227822782278228 28.047804780478046 23.94739473947395 100-104 20.51731038623174 28.392035221132677 27.431458875325195 23.659195517310387 105-109 20.123080002001302 28.743683394206233 27.75303947565918 23.380197128133286 110-114 20.4111233370011 28.863659097729315 27.17815344603381 23.54706411923577 115-119 20.754150830166033 28.055611122224445 27.375475095019002 23.814762952590517 120-124 20.925 28.235 26.875 23.965 125-129 20.77473599919924 28.231820229217757 27.325959661678596 23.66748410990441 130-134 20.74166875469807 28.128288649461286 27.23628163367577 23.89376096216487 135-139 21.423213482022305 27.86918037705656 27.184077611641744 23.523528529279393 140-144 20.568085212781916 28.059208881332196 27.05905885882882 24.313647047057056 145-149 20.617216025608965 28.059820937328066 26.824388535987598 24.498574501075375 150-151 21.20795298236839 27.77291484306615 27.622858571964485 23.396273602600974 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 1.5 19 1.5 20 0.0 21 0.5 22 2.0 23 2.5 24 3.0 25 7.5 26 11.5 27 14.0 28 17.5 29 22.5 30 34.0 31 47.0 32 54.5 33 58.0 34 69.5 35 88.5 36 110.0 37 132.0 38 158.5 39 176.5 40 185.0 41 195.0 42 215.0 43 251.5 44 246.5 45 233.5 46 241.0 47 236.5 48 205.0 49 167.0 50 151.5 51 135.0 52 108.5 53 82.5 54 67.5 55 59.0 56 47.5 57 36.0 58 31.0 59 23.5 60 18.0 61 18.0 62 13.0 63 5.5 64 3.5 65 2.0 66 1.0 67 1.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.16 40-44 0.5499999999999999 45-49 0.02 50-54 0.0 55-59 0.015 60-64 0.0 65-69 0.02 70-74 12.415 75-79 9.520000000000001 80-84 3.6700000000000004 85-89 1.06 90-94 0.01 95-99 0.01 100-104 0.06 105-109 0.065 110-114 0.03 115-119 0.02 120-124 0.0 125-129 0.095 130-134 0.22499999999999998 135-139 0.015 140-144 0.015 145-149 0.034999999999999996 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24318869828456 98.35000000000001 2 0.6811301715438951 1.35 3 0.050454086781029264 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025227043390514632 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC 6 0.15 TruSeq Adapter, Index 3 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.7875 0.0 0.0 0.0 0.0 104-105 0.9125000000000001 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.3624999999999998 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.8125 0.0 0.0 0.0 0.0 116-117 2.1125 0.0 0.0 0.0 0.0 118-119 2.425 0.0 0.0 0.0 0.0 120-121 2.7375 0.0 0.0 0.0 0.0 122-123 3.0375 0.0 0.0 0.0 0.0 124-125 3.3625 0.0 0.0 0.0 0.0 126-127 3.7 0.0 0.0 0.0 0.0 128-129 4.0375 0.0 0.0 0.0 0.0 130-131 4.3125 0.0 0.0 0.0 0.0 132-133 4.6875 0.0 0.0 0.0 0.0 134-135 5.05 0.0 0.0 0.0 0.0 136-137 5.550000000000001 0.0 0.0 0.0 0.0 138-139 6.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCCAG 10 0.0073156436 141.71251 5 ATCCAGG 10 0.0073156436 141.71251 6 >>END_MODULE SRR7230820 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230820_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82775 33.0 33.0 34.0 32.0 34.0 2 32.91475 34.0 33.0 34.0 32.0 34.0 3 32.9335 34.0 33.0 34.0 32.0 34.0 4 32.8835 34.0 33.0 34.0 32.0 34.0 5 32.89 34.0 33.0 34.0 32.0 34.0 6 37.08775 38.0 38.0 38.0 37.0 38.0 7 37.10375 38.0 38.0 38.0 37.0 38.0 8 37.055 38.0 38.0 38.0 37.0 38.0 9 37.0395 38.0 38.0 38.0 37.0 38.0 10-14 36.95825 38.0 38.0 38.0 37.0 38.0 15-19 36.910849999999996 38.0 38.0 38.0 37.0 38.0 20-24 36.912850000000006 38.0 38.0 38.0 37.0 38.0 25-29 36.84795 38.0 38.0 38.0 37.0 38.0 30-34 36.77915 38.0 38.0 38.0 36.8 38.0 35-39 36.639050000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.68545 38.0 38.0 38.0 36.2 38.0 45-49 36.72125 38.0 38.0 38.0 36.0 38.0 50-54 36.7115 38.0 38.0 38.0 36.2 38.0 55-59 36.3981 38.0 38.0 38.0 36.0 38.0 60-64 36.546800000000005 38.0 38.0 38.0 35.8 38.0 65-69 36.36355 38.0 38.0 38.0 35.6 38.0 70-74 36.082 38.0 38.0 38.0 34.0 38.0 75-79 36.3486 38.0 38.0 38.0 34.8 38.0 80-84 36.2902 38.0 38.0 38.0 35.0 38.0 85-89 36.32620000000001 38.0 38.0 38.0 34.8 38.0 90-94 36.15695000000001 38.0 38.0 38.0 35.0 38.0 95-99 36.0317 38.0 38.0 38.0 34.0 38.0 100-104 35.82155 38.0 38.0 38.0 33.4 38.0 105-109 35.67615 38.0 38.0 38.0 32.6 38.0 110-114 35.67379999999999 38.0 38.0 38.0 33.2 38.0 115-119 35.45505000000001 38.0 38.0 38.0 32.2 38.0 120-124 35.26025 38.0 37.4 38.0 31.4 38.0 125-129 35.0172 38.0 37.0 38.0 29.6 38.0 130-134 34.9042 38.0 36.4 38.0 28.4 38.0 135-139 34.2901 38.0 35.6 38.0 24.4 38.0 140-144 33.8651 38.0 35.0 38.0 22.6 38.0 145-149 32.78065 38.0 32.8 38.0 14.0 38.0 150-151 27.100375 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 11.0 4 4.0 5 3.0 6 3.0 7 2.0 8 2.0 9 3.0 10 3.0 11 8.0 12 5.0 13 5.0 14 7.0 15 7.0 16 6.0 17 12.0 18 6.0 19 6.0 20 4.0 21 9.0 22 12.0 23 13.0 24 12.0 25 19.0 26 10.0 27 22.0 28 39.0 29 27.0 30 32.0 31 44.0 32 68.0 33 99.0 34 118.0 35 210.0 36 512.0 37 2641.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.688688688688686 19.494494494494493 17.56756756756757 24.24924924924925 2 27.795846885163872 24.418313735301474 29.847385539154363 17.938453840380287 3 22.175 28.275 29.9 19.650000000000002 4 24.224999999999998 33.5 22.925 19.35 5 23.825 36.625 22.575 16.975 6 19.775000000000002 35.85 24.275 20.1 7 18.95 19.0 40.6 21.45 8 22.05 23.95 27.275 26.724999999999998 9 20.625 25.575 29.275000000000002 24.525 10-14 23.654730946189236 28.62572514502901 25.93518703740748 21.784356871374275 15-19 23.04345651847777 28.264239635945394 27.889183377506626 20.80312046807021 20-24 23.08423369347739 28.12625050020008 27.931172468987597 20.858343337334933 25-29 22.919167667066827 28.431372549019606 27.756102440976388 20.893357342937176 30-34 22.99919967987195 28.036214485794318 28.021208483393355 20.943377350940377 35-39 22.258355013007805 28.40704422653592 27.91675005003002 21.417850710426258 40-44 23.02420968387355 28.49139655862345 27.39095638255302 21.093437374949982 45-49 23.187027676292477 27.67128772333717 28.03663480306291 21.105049797307444 50-54 23.316477244279778 28.0578781354829 27.877634806989438 20.748009813247883 55-59 22.694107583153023 27.001459266341264 28.767674734564487 21.536758415941225 60-64 23.597194388777556 27.49498997995992 27.880761523046093 21.027054108216433 65-69 23.440719706488416 27.8333417098055 27.953962908981257 20.771975674724832 70-74 23.03786012368646 27.980290612901605 28.000402232389764 20.981447031022174 75-79 23.70829790426649 27.499624868704046 27.629670384634625 21.162406842394837 80-84 23.78375670123754 27.79698381682449 27.461295656094997 20.957963825842977 85-89 23.872161648494547 27.81834550365109 27.728318495548663 20.58117435230569 90-94 23.453208623018057 27.564647626669338 28.569999499824938 20.41214425048767 95-99 23.903366178162358 27.699694893212623 27.854749162206772 20.542189766418247 100-104 23.74737473747375 27.807780778077806 28.027802780278027 20.417041704170416 105-109 24.132413241324134 27.35273527352735 27.96279627962796 20.552055205520553 110-114 23.886497848063257 28.050245220698628 27.87508757882094 20.188169352417177 115-119 24.283355845715143 27.465105808194508 27.77527640202111 20.476261944069236 120-124 24.122412241224122 27.45274527452745 27.597759775977597 20.82708270827083 125-129 24.322432243224323 28.30783078307831 27.762776277627765 19.606960696069606 130-134 24.184836967393476 28.09061812362473 27.61052210442088 20.114022804560914 135-139 24.382422207746654 27.64944630956557 27.76469409229844 20.203437390389336 140-144 25.18251825182518 28.08780878087809 26.547654765476548 20.18201820182018 145-149 24.902490249024904 28.14281428142814 27.037703770377036 19.916991699169916 150-151 25.362499999999997 29.1125 25.887500000000003 19.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.5 12 1.5 13 1.0 14 0.0 15 1.5 16 2.0 17 0.5 18 0.5 19 1.5 20 2.0 21 1.5 22 2.0 23 3.0 24 3.0 25 4.0 26 9.0 27 14.5 28 13.0 29 15.0 30 24.0 31 26.0 32 30.0 33 37.5 34 59.0 35 76.5 36 86.0 37 102.5 38 128.0 39 155.5 40 177.0 41 196.0 42 217.5 43 230.5 44 254.0 45 257.5 46 249.5 47 249.0 48 226.5 49 213.0 50 185.0 51 144.0 52 114.5 53 103.0 54 96.5 55 71.0 56 48.5 57 44.0 58 36.0 59 24.5 60 17.5 61 14.5 62 9.5 63 5.5 64 2.5 65 1.5 66 2.5 67 2.5 68 1.0 69 0.5 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.02 15-19 0.015 20-24 0.04 25-29 0.04 30-34 0.04 35-39 0.06 40-44 0.04 45-49 0.095 50-54 0.135 55-59 0.635 60-64 0.2 65-69 0.515 70-74 0.555 75-79 0.034999999999999996 80-84 0.20500000000000002 85-89 0.03 90-94 0.034999999999999996 95-99 0.034999999999999996 100-104 0.01 105-109 0.01 110-114 0.09 115-119 0.055 120-124 0.01 125-129 0.01 130-134 0.02 135-139 0.215 140-144 0.01 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26841574167507 98.375 2 0.6306760847628659 1.25 3 0.07568113017154389 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.025227043390514632 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 6 0.15 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.38749999999999996 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.1875 0.0 0.0 0.0 0.0 110-111 1.325 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 2.0375 0.0 0.0 0.0 0.0 118-119 2.325 0.0 0.0 0.0 0.0 120-121 2.65 0.0 0.0 0.0 0.0 122-123 2.95 0.0 0.0 0.0 0.0 124-125 3.2874999999999996 0.0 0.0 0.0 0.0 126-127 3.6625 0.0 0.0 0.0 0.0 128-129 3.9625 0.0 0.0 0.0 0.0 130-131 4.225 0.0 0.0 0.0 0.0 132-133 4.6 0.0 0.0 0.0 0.0 134-135 5.0 0.0 0.0 0.0 0.0 136-137 5.550000000000001 0.0 0.0 0.0 0.0 138-139 6.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTTTG 10 0.0069035282 144.4875 9 >>END_MODULE Read 716321 spots for SRR7230820.sra Written 716321 spots for SRR7230820.sra Read 716321 spots for SRR7230820.sra Written 716321 spots for SRR7230820.sra Read 716321 spots for SRR7230820.sra Written 716321 spots for SRR7230820.sra Read 716321 spots for SRR7230820.sra Written 716321 spots for SRR7230820.sra Read 716321 spots for SRR7230820.sra Written 716321 spots for SRR7230820.sra Read 716321 spots for SRR7230820.sra Written 716321 spots for SRR7230820.sra Read 716321 spots for SRR7230820.sra Written 716321 spots for SRR7230820.sra Read 716321 spots for SRR7230820.sra Written 716321 spots for SRR7230820.sra Read 716321 spots for SRR7230820.sra Written 716321 spots for SRR7230820.sra Read 716321 spots for SRR7230820.sra Written 716321 spots for SRR7230820.sra Read 716321 spots for SRR7230820.sra Written 716321 spots for SRR7230820.sra Read 716321 spots for SRR7230820.sra Written 716321 spots for SRR7230820.sra Read 716321 spots for SRR7230820.sra Written 716321 spots for SRR7230820.sra Read 716321 spots for SRR7230820.sra Written 716321 spots for SRR7230820.sra Read 716321 spots for SRR7230820.sra Written 716321 spots for SRR7230820.sra Read 716321 spots for SRR7230820.sra Written 716321 spots for SRR7230820.sra Read 716321 spots for SRR7230820.sra Written 716321 spots for SRR7230820.sra Read 716321 spots for SRR7230820.sra Written 716321 spots for SRR7230820.sra Read 716321 spots for SRR7230820.sra Written 716321 spots for SRR7230820.sra Read 716321 spots for SRR7230820.sra Written 716321 spots for SRR7230820.sra SRR ids: ['SRR7230820.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_566tu1qz SRR7230820.sra spots: 14326420 blocks: [[1, 716321], [716322, 1432642], [1432643, 2148963], [2148964, 2865284], [2865285, 3581605], [3581606, 4297926], [4297927, 5014247], [5014248, 5730568], [5730569, 6446889], [6446890, 7163210], [7163211, 7879531], [7879532, 8595852], [8595853, 9312173], [9312174, 10028494], [10028495, 10744815], [10744816, 11461136], [11461137, 12177457], [12177458, 12893778], [12893779, 13610099], [13610100, 14326420]] SRR7230820 file size 4833053 SRR7230820 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230820 SRR7230820_1.fastq SRR7230820_2.fastq Input file: SRR7230820_1.fastq Paired file: SRR7230820_2.fastq trimmed: SRR7230820-trimmed-pair1.fastq, SRR7230820-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:52:01 2025 >> started Tue Feb 11 09:52:18 2025 >> done (16.976s) 14326420 read pairs processed; of these: 29725 ( 0.21%) short read pairs filtered out after trimming by size control 33696 ( 0.24%) empty read pairs filtered out after trimming by size control 14262999 (99.56%) read pairs available; of these: 6302413 (44.19%) trimmed read pairs available after processing 7960586 (55.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 3 0.00% 21 3 0.00% 22 8 0.00% 23 8 0.00% 24 4 0.00% 25 9 0.00% 26 8 0.00% 27 4 0.00% 28 6 0.00% 29 7 0.00% 30 10 0.00% 31 14 0.00% 32 8 0.00% 33 12 0.00% 34 12 0.00% 35 11 0.00% 36 14 0.00% 37 16 0.00% 38 12 0.00% 39 24 0.00% 40 19 0.00% 41 20 0.00% 42 27 0.00% 43 27 0.00% 44 33 0.00% 45 45 0.00% 46 55 0.00% 47 60 0.00% 48 57 0.00% 49 63 0.00% 50 76 0.00% 51 94 0.00% 52 111 0.00% 53 139 0.00% 54 98 0.00% 55 121 0.00% 56 180 0.00% 57 166 0.00% 58 233 0.00% 59 194 0.00% 60 205 0.00% 61 293 0.00% 62 282 0.00% 63 301 0.00% 64 322 0.00% 65 427 0.00% 66 477 0.00% 67 639 0.00% 68 811 0.01% 69 2376 0.02% 70 2224 0.02% 71 1084 0.01% 72 888 0.01% 73 1021 0.01% 74 1147 0.01% 75 1218 0.01% 76 1247 0.01% 77 1457 0.01% 78 1574 0.01% 79 1910 0.01% 80 2180 0.02% 81 2849 0.02% 82 2695 0.02% 83 3029 0.02% 84 4997 0.04% 85 5476 0.04% 86 5645 0.04% 87 6073 0.04% 88 6288 0.04% 89 6681 0.05% 90 7076 0.05% 91 7470 0.05% 92 7807 0.05% 93 8228 0.06% 94 8737 0.06% 95 9058 0.06% 96 9761 0.07% 97 10039 0.07% 98 10558 0.07% 99 11194 0.08% 100 11963 0.08% 101 12542 0.09% 102 13310 0.09% 103 14263 0.10% 104 14934 0.10% 105 15832 0.11% 106 16353 0.11% 107 16850 0.12% 108 17874 0.13% 109 19292 0.14% 110 19762 0.14% 111 20632 0.14% 112 21670 0.15% 113 22809 0.16% 114 23812 0.17% 115 24937 0.17% 116 25751 0.18% 117 26737 0.19% 118 27729 0.19% 119 28187 0.20% 120 29787 0.21% 121 30962 0.22% 122 32403 0.23% 123 33477 0.23% 124 35475 0.25% 125 36298 0.25% 126 38230 0.27% 127 39624 0.28% 128 41195 0.29% 129 42637 0.30% 130 44059 0.31% 131 46024 0.32% 132 47560 0.33% 133 50405 0.35% 134 52305 0.37% 135 55451 0.39% 136 57881 0.41% 137 60339 0.42% 138 63752 0.45% 139 66983 0.47% 140 71125 0.50% 141 76777 0.54% 142 82766 0.58% 143 92370 0.65% 144 103600 0.73% 145 120826 0.85% 146 144595 1.01% 147 189176 1.33% 148 278222 1.95% 149 535825 3.76% 150 3149285 22.08% 151 7960586 55.81% 14262999 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=23 prefix-density=0.50 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=381.19 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.6 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=21 prefix-density=0.51 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=33.17 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.6 sequence=AACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGTATGCTTTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR7230820 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:53:11 Started mapping on | Feb 11 09:53:11 Finished on | Feb 11 09:54:58 Mapping speed, Million of reads per hour | 479.88 Number of input reads | 14262999 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13022032 Uniquely mapped reads % | 91.30% Average mapped length | 293.78 Number of splices: Total | 11850528 Number of splices: Annotated (sjdb) | 11560016 Number of splices: GT/AG | 11614725 Number of splices: GC/AG | 192164 Number of splices: AT/AC | 7552 Number of splices: Non-canonical | 36087 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.53 Insertion rate per base | 0.03% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 358499 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 203776 % of reads mapped to too many loci | 1.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.48% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 913968 913968 913968 N_multimapping 358499 358499 358499 N_noFeature 678292 12755086 771726 N_ambiguous 269005 1156 94737 UnstrandedReadsAssigned:12074735 PositiveStrandReadsAssigned:265790 NegativeStrandReadsAssigned:12155569 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7230820 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230820-trimmed-pair1.fastq SRR7230820-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,262,999 reads, 12,285,235 reads pseudoaligned [quant] estimated average fragment length: 245.735 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52401 SRR7230820.ke.tsv 34699 SRR7230820.se.tsv 87100 total ==> SRR7230820.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.27 430 16.8206 Potri.005G024800.1.v4.1 1035 790.265 95 8.33866 Potri.004G059700.1.v4.1 961 716.336 7 0.67784 Potri.007G009000.2.v4.1 1416 1171.27 0 0 Potri.003G141000.2.v4.1 2943 2698.27 466.734 11.9986 Potri.016G087400.1.v4.1 270 82.6261 531.338 446.066 Potri.015G069301.1.v4.1 564 326.683 0 0 Potri.010G195200.1.v4.1 1773 1528.27 22 0.998549 Potri.012G127500.1.v4.1 977 732.309 151 14.303 ==> SRR7230820.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1192 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 300 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7230820 completed mapping pipeline successfully