Starting /dee2/code/volunteer_pipeline.sh SRR7230821 current disk space = 3052970110976 free memory = 1476600428 SRR7230821 SRAfilesize 3111648a7c0e1e930bff6d624f4e9dff SRR7230821.sra SRR7230821.sra file validated SRR7230821 is paired end SRR7230821 is conventional basespace SRR7230821 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230821_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2395 34.0 33.0 34.0 32.0 34.0 2 33.2965 34.0 33.0 34.0 33.0 34.0 3 33.36575 34.0 33.0 34.0 33.0 34.0 4 33.30125 34.0 33.0 34.0 33.0 34.0 5 33.29675 34.0 33.0 34.0 33.0 34.0 6 37.057 38.0 37.0 38.0 36.0 38.0 7 37.2975 38.0 38.0 38.0 37.0 38.0 8 37.426 38.0 38.0 38.0 37.0 38.0 9 37.38725 38.0 38.0 38.0 37.0 38.0 10-14 37.441649999999996 38.0 38.0 38.0 37.2 38.0 15-19 37.354299999999995 38.0 38.0 38.0 37.2 38.0 20-24 37.15670000000001 38.0 38.0 38.0 36.2 38.0 25-29 37.20945 38.0 38.0 38.0 36.8 38.0 30-34 37.305600000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.19355 38.0 38.0 38.0 36.8 38.0 40-44 36.5818 38.0 38.0 38.0 34.6 38.0 45-49 36.9519 38.0 38.0 38.0 35.8 38.0 50-54 37.1116 38.0 38.0 38.0 36.0 38.0 55-59 36.98665 38.0 38.0 38.0 36.0 38.0 60-64 36.95084999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.9131 38.0 38.0 38.0 35.8 38.0 70-74 30.887999999999998 38.0 24.0 38.0 15.0 38.0 75-79 31.719550000000005 38.0 32.2 38.0 4.4 38.0 80-84 34.328950000000006 38.0 36.6 38.0 25.2 38.0 85-89 35.8125 38.0 37.2 38.0 31.2 38.0 90-94 35.9473 38.0 37.2 38.0 32.4 38.0 95-99 35.96725 38.0 37.2 38.0 32.6 38.0 100-104 35.91545 38.0 37.0 38.0 32.6 38.0 105-109 35.967600000000004 38.0 37.0 38.0 33.2 38.0 110-114 34.3024 37.8 34.4 38.0 23.0 38.0 115-119 33.92999999999999 37.8 33.4 38.0 22.4 38.0 120-124 34.589999999999996 38.0 34.8 38.0 26.4 38.0 125-129 33.746249999999996 38.0 34.2 38.0 20.0 38.0 130-134 33.8397 38.0 34.4 38.0 21.6 38.0 135-139 33.238350000000004 37.8 33.6 38.0 20.4 38.0 140-144 33.524249999999995 38.0 33.8 38.0 21.4 38.0 145-149 32.66375 38.0 33.4 38.0 15.0 38.0 150-151 28.314625 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 2.0 8 0.0 9 0.0 10 1.0 11 0.0 12 2.0 13 1.0 14 1.0 15 7.0 16 3.0 17 4.0 18 9.0 19 9.0 20 6.0 21 11.0 22 11.0 23 14.0 24 18.0 25 18.0 26 29.0 27 36.0 28 42.0 29 58.0 30 63.0 31 94.0 32 131.0 33 187.0 34 350.0 35 496.0 36 901.0 37 1494.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.2 14.524999999999999 17.150000000000002 39.125 2 21.675 20.825 34.8 22.7 3 20.5 27.224999999999998 24.4 27.875 4 22.95 35.175 21.75 20.125 5 21.875 35.65 23.95 18.525 6 17.9 35.875 26.55 19.675 7 13.25 22.2 44.3 20.25 8 18.5 23.25 29.525000000000002 28.725 9 18.45 23.849999999999998 33.175 24.525 10-14 20.571028551427574 28.686434321716085 26.49632481624081 24.24621231061553 15-19 19.59 28.49 28.43 23.49 20-24 20.115 28.410000000000004 28.09 23.385 25-29 19.96197718631179 28.587152291374824 28.16189713828297 23.288973384030417 30-34 19.875 28.51 27.794999999999998 23.82 35-39 19.82099104955248 28.506425321266065 28.176408820441022 23.496174808740435 40-44 19.719509140996745 29.321312296518908 27.417981467568243 23.541197094916104 45-49 20.105 28.075 27.76 24.060000000000002 50-54 19.67 28.599999999999998 27.634999999999998 24.095 55-59 20.018011707609944 27.963176064441885 27.6329614249262 24.385850803021963 60-64 20.69638301065586 28.00040022012107 27.98539196558107 23.317824803642004 65-69 20.624124824964994 28.675735147029407 27.355471094218842 23.344668933786757 70-74 20.336680448907266 28.393384524512697 27.44240992321323 23.827525103366803 75-79 20.18166335509509 28.9582741981266 27.113255747942095 23.74680669883622 80-84 20.385848709456972 28.53913683435841 26.993639278767805 24.08137517741681 85-89 20.462561725284694 29.053713594679024 27.345560818300918 23.13816386173536 90-94 20.25107532259678 28.023407022106632 28.05841752525758 23.667100130039014 95-99 20.25 28.299999999999997 27.47 23.98 100-104 21.141342402720817 28.388516554966493 27.13313994198259 23.3370011003301 105-109 20.895 28.605000000000004 26.96 23.54 110-114 21.02 28.050000000000004 27.11 23.82 115-119 20.621031051552578 28.94644732236612 27.051352567628385 23.381169058452922 120-124 21.365252666900385 27.690689637902537 27.520408674312613 23.42364902088446 125-129 20.89 28.735 26.52 23.855 130-134 20.79 28.78 26.625 23.805 135-139 20.965 28.32 27.27 23.445 140-144 21.235 28.115000000000002 26.790000000000003 23.86 145-149 20.81812271840776 28.659298894834222 26.363954593188975 24.158623793569035 150-151 20.8625 28.599999999999998 26.825 23.7125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 2.5 23 4.5 24 5.0 25 6.0 26 10.0 27 13.0 28 17.5 29 27.0 30 32.5 31 38.5 32 49.0 33 59.0 34 70.0 35 80.0 36 104.0 37 127.0 38 146.0 39 177.5 40 196.0 41 227.5 42 243.5 43 239.0 44 258.0 45 261.0 46 240.5 47 224.0 48 208.5 49 184.5 50 170.5 51 136.5 52 91.5 53 84.0 54 76.5 55 48.5 56 30.5 57 28.0 58 25.5 59 17.0 60 11.0 61 7.5 62 3.5 63 3.0 64 4.0 65 2.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.06 30-34 0.0 35-39 0.005 40-44 0.17500000000000002 45-49 0.0 50-54 0.0 55-59 0.065 60-64 0.055 65-69 0.02 70-74 15.35 75-79 11.924999999999999 80-84 4.885 85-89 0.77 90-94 0.03 95-99 0.0 100-104 0.03 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.165 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.015 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16519099418163 98.0 2 0.6324310650139134 1.25 3 0.15178345560333922 0.44999999999999996 4 0.0 0.0 5 0.025297242600556536 0.125 6 0.0 0.0 7 0.025297242600556536 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACGATATCTCGTATGC 7 0.17500000000000002 TruSeq Adapter, Index 7 (97% over 35bp) CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 1.0625 0.0 0.0 0.0 0.0 98-99 1.2374999999999998 0.0 0.0 0.0 0.0 100-101 1.4375 0.0 0.0 0.0 0.0 102-103 1.5750000000000002 0.0 0.0 0.0 0.0 104-105 1.75 0.0 0.0 0.0 0.0 106-107 2.0375 0.0 0.0 0.0 0.0 108-109 2.3125 0.0 0.0 0.0 0.0 110-111 2.5375 0.0 0.0 0.0 0.0 112-113 2.775 0.0 0.0 0.0 0.0 114-115 3.0 0.0 0.0 0.0 0.0 116-117 3.4125 0.0 0.0 0.0 0.0 118-119 3.75 0.0 0.0 0.0 0.0 120-121 4.25 0.0 0.0 0.0 0.0 122-123 4.65 0.0 0.0 0.0 0.0 124-125 4.975 0.0 0.0 0.0 0.0 126-127 5.3375 0.0 0.0 0.0 0.0 128-129 5.7125 0.0 0.0 0.0 0.0 130-131 6.3125 0.0 0.0 0.0 0.0 132-133 6.85 0.0 0.0 0.0 0.0 134-135 7.275 0.0 0.0 0.0 0.0 136-137 7.824999999999999 0.0 0.0 0.0 0.0 138-139 8.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7230821 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230821_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.70575 33.0 33.0 34.0 32.0 34.0 2 32.88175 34.0 33.0 34.0 32.0 34.0 3 32.8365 34.0 33.0 34.0 32.0 34.0 4 32.76325 34.0 33.0 34.0 32.0 34.0 5 32.76875 34.0 33.0 34.0 32.0 34.0 6 36.6465 38.0 38.0 38.0 36.0 38.0 7 36.771 38.0 38.0 38.0 36.0 38.0 8 36.611 38.0 38.0 38.0 36.0 38.0 9 36.5995 38.0 38.0 38.0 35.0 38.0 10-14 36.59765 38.0 38.0 38.0 35.4 38.0 15-19 36.64235000000001 38.0 38.0 38.0 36.0 38.0 20-24 36.677049999999994 38.0 38.0 38.0 36.0 38.0 25-29 36.6072 38.0 38.0 38.0 35.8 38.0 30-34 36.52265 38.0 38.0 38.0 35.6 38.0 35-39 36.237049999999996 38.0 38.0 38.0 34.4 38.0 40-44 36.136199999999995 38.0 38.0 38.0 33.6 38.0 45-49 36.45235 38.0 38.0 38.0 35.2 38.0 50-54 36.42595 38.0 38.0 38.0 35.2 38.0 55-59 35.80095 38.0 38.0 38.0 32.6 38.0 60-64 36.272800000000004 38.0 38.0 38.0 34.8 38.0 65-69 35.88000000000001 38.0 38.0 38.0 33.0 38.0 70-74 35.73925 38.0 38.0 38.0 32.0 38.0 75-79 36.07515 38.0 38.0 38.0 34.0 38.0 80-84 35.972049999999996 38.0 38.0 38.0 33.6 38.0 85-89 35.96685 38.0 38.0 38.0 33.8 38.0 90-94 35.87615000000001 38.0 38.0 38.0 33.4 38.0 95-99 35.3505 38.0 37.2 38.0 29.8 38.0 100-104 35.368900000000004 38.0 37.4 38.0 30.2 38.0 105-109 34.79115 38.0 36.4 38.0 25.4 38.0 110-114 35.10205 38.0 37.0 38.0 28.4 38.0 115-119 35.06365 38.0 37.0 38.0 28.8 38.0 120-124 34.7989 38.0 36.4 38.0 27.2 38.0 125-129 34.42815 38.0 36.0 38.0 24.4 38.0 130-134 34.27315 38.0 35.2 38.0 23.6 38.0 135-139 33.787850000000006 38.0 34.6 38.0 21.8 38.0 140-144 33.192699999999995 38.0 33.8 38.0 15.4 38.0 145-149 32.2801 38.0 33.0 38.0 8.6 38.0 150-151 26.409 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 15.0 4 3.0 5 4.0 6 2.0 7 1.0 8 6.0 9 4.0 10 4.0 11 3.0 12 4.0 13 3.0 14 7.0 15 10.0 16 7.0 17 9.0 18 8.0 19 8.0 20 9.0 21 11.0 22 12.0 23 14.0 24 22.0 25 16.0 26 18.0 27 31.0 28 45.0 29 45.0 30 48.0 31 69.0 32 92.0 33 105.0 34 155.0 35 287.0 36 605.0 37 2299.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.599999999999998 14.825 23.825 31.75 2 25.775 22.7 34.475 17.05 3 21.875 27.175 31.025000000000002 19.925 4 24.55 33.375 22.325 19.75 5 23.5 34.925 23.0 18.575 6 19.875 34.949999999999996 25.2 19.975 7 17.875 16.85 43.75 21.525 8 20.875 22.475 28.325 28.325 9 21.675 23.825 29.325000000000003 25.174999999999997 10-14 23.06 28.18 26.810000000000002 21.95 15-19 22.91 28.015 28.1 20.974999999999998 20-24 23.200000000000003 27.725 27.905 21.17 25-29 22.505 28.325 28.075 21.095 30-34 22.91 28.084999999999997 28.105000000000004 20.9 35-39 22.450102546145764 27.972587664449 28.017607923565606 21.559701865839628 40-44 23.43351502725409 28.084212631894783 27.849177376606495 20.633094964244634 45-49 22.034406881376274 28.490698139627924 27.855571114222844 21.619323864772955 50-54 23.43 27.224999999999998 28.139999999999997 21.205 55-59 22.7105673865982 27.94643306650556 28.19312289180889 21.14987665508735 60-64 23.138470770615594 27.244086612991946 28.27924188628294 21.338200730109516 65-69 22.9649840836744 27.563033702187862 28.2097923298469 21.262189884290837 70-74 23.03076147251639 27.96268280383258 27.70549672213817 21.301059001512858 75-79 22.564999999999998 28.425 27.68 21.33 80-84 23.634180508304983 27.71162697618571 27.62157294376626 21.032619571743048 85-89 23.544999999999998 28.360000000000003 27.689999999999998 20.405 90-94 23.375 28.21 27.565 20.849999999999998 95-99 23.61 27.62 27.810000000000002 20.96 100-104 23.445 28.17 27.77 20.615 105-109 23.635 27.815 27.950000000000003 20.599999999999998 110-114 24.46 28.215 27.11 20.215 115-119 23.835 28.53 27.325 20.31 120-124 24.54 28.54 26.75 20.169999999999998 125-129 24.67 27.48 27.455000000000002 20.395 130-134 24.97 27.595 27.465 19.97 135-139 25.023753563034457 27.72415862379357 27.17407611141671 20.078011701755262 140-144 25.163807332566396 27.414595108287898 27.364577602160757 20.057019956984945 145-149 24.735 27.894999999999996 27.22 20.150000000000002 150-151 25.525 27.1125 27.325 20.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.5 17 1.5 18 1.5 19 0.5 20 0.5 21 1.5 22 2.5 23 4.5 24 3.5 25 7.0 26 9.5 27 5.5 28 8.0 29 11.5 30 15.5 31 23.5 32 29.0 33 46.5 34 57.0 35 61.0 36 86.5 37 103.0 38 128.0 39 169.0 40 192.0 41 211.5 42 238.0 43 246.0 44 261.5 45 266.5 46 254.5 47 244.5 48 227.5 49 216.0 50 178.5 51 131.5 52 114.0 53 96.5 54 80.5 55 71.5 56 55.0 57 42.0 58 30.0 59 18.5 60 11.0 61 9.0 62 8.0 63 7.5 64 4.0 65 1.0 66 0.5 67 0.0 68 1.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.045 40-44 0.015 45-49 0.02 50-54 0.0 55-59 0.685 60-64 0.015 65-69 1.045 70-74 0.8500000000000001 75-79 0.0 80-84 0.06 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.015 140-144 0.034999999999999996 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06186612576064 97.675 2 0.7352941176470588 1.4500000000000002 3 0.07606490872210953 0.22499999999999998 4 0.05070993914807302 0.2 5 0.02535496957403651 0.125 6 0.02535496957403651 0.15 7 0.02535496957403651 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 7 0.17500000000000002 Illumina Single End PCR Primer 1 (100% over 50bp) AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit CATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 1.0625 0.0 0.0 0.0 0.0 98-99 1.2125 0.0 0.0 0.0 0.0 100-101 1.4125 0.0 0.0 0.0 0.0 102-103 1.5750000000000002 0.0 0.0 0.0 0.0 104-105 1.75 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.35 0.0 0.0 0.0 0.0 110-111 2.5999999999999996 0.0 0.0 0.0 0.0 112-113 2.875 0.0 0.0 0.0 0.0 114-115 3.1625 0.0 0.0 0.0 0.0 116-117 3.5875 0.0 0.0 0.0 0.0 118-119 3.975 0.0 0.0 0.0 0.0 120-121 4.45 0.0 0.0 0.0 0.0 122-123 4.8625 0.0 0.0 0.0 0.0 124-125 5.2 0.0 0.0 0.0 0.0 126-127 5.6 0.0 0.0 0.0 0.0 128-129 6.012499999999999 0.0 0.0 0.0 0.0 130-131 6.6 0.0 0.0 0.0 0.0 132-133 7.1375 0.0 0.0 0.0 0.0 134-135 7.6 0.0 0.0 0.0 0.0 136-137 8.175 0.0 0.0 0.0 0.0 138-139 8.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGGTT 10 0.006843168 144.91249 8 ACTCCAA 10 0.006843168 144.91249 4 ATACTCC 10 0.006843168 144.91249 2 CATACTC 10 0.006843168 144.91249 1 GCTTTAT 10 0.006843168 144.91249 3 >>END_MODULE Read 886425 spots for SRR7230821.sra Written 886425 spots for SRR7230821.sra Read 886425 spots for SRR7230821.sra Written 886425 spots for SRR7230821.sra Read 886425 spots for SRR7230821.sra Written 886425 spots for SRR7230821.sra Read 886425 spots for SRR7230821.sra Written 886425 spots for SRR7230821.sra Read 886425 spots for SRR7230821.sra Written 886425 spots for SRR7230821.sra Read 886425 spots for SRR7230821.sra Written 886425 spots for SRR7230821.sra Read 886425 spots for SRR7230821.sra Written 886425 spots for SRR7230821.sra Read 886425 spots for SRR7230821.sra Written 886425 spots for SRR7230821.sra Read 886425 spots for SRR7230821.sra Written 886425 spots for SRR7230821.sra Read 886425 spots for SRR7230821.sra Written 886425 spots for SRR7230821.sra Read 886425 spots for SRR7230821.sra Written 886425 spots for SRR7230821.sra Read 886425 spots for SRR7230821.sra Written 886425 spots for SRR7230821.sra Read 886425 spots for SRR7230821.sra Written 886425 spots for SRR7230821.sra Read 886425 spots for SRR7230821.sra Written 886425 spots for SRR7230821.sra Read 886425 spots for SRR7230821.sra Written 886425 spots for SRR7230821.sra Read 886425 spots for SRR7230821.sra Written 886425 spots for SRR7230821.sra Read 886425 spots for SRR7230821.sra Written 886425 spots for SRR7230821.sra Read 886435 spots for SRR7230821.sra Written 886435 spots for SRR7230821.sra Read 886425 spots for SRR7230821.sra Written 886425 spots for SRR7230821.sra Read 886425 spots for SRR7230821.sra Written 886425 spots for SRR7230821.sra SRR ids: ['SRR7230821.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aa5t8su4 SRR7230821.sra spots: 17728510 blocks: [[1, 886425], [886426, 1772850], [1772851, 2659275], [2659276, 3545700], [3545701, 4432125], [4432126, 5318550], [5318551, 6204975], [6204976, 7091400], [7091401, 7977825], [7977826, 8864250], [8864251, 9750675], [9750676, 10637100], [10637101, 11523525], [11523526, 12409950], [12409951, 13296375], [13296376, 14182800], [14182801, 15069225], [15069226, 15955650], [15955651, 16842075], [16842076, 17728510]] SRR7230821 file size 5985909 SRR7230821 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230821 SRR7230821_1.fastq SRR7230821_2.fastq Input file: SRR7230821_1.fastq Paired file: SRR7230821_2.fastq trimmed: SRR7230821-trimmed-pair1.fastq, SRR7230821-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:44:12 2025 >> started Tue Feb 11 10:44:30 2025 >> done (17.931s) 17728510 read pairs processed; of these: 40633 ( 0.23%) short read pairs filtered out after trimming by size control 86921 ( 0.49%) empty read pairs filtered out after trimming by size control 17600956 (99.28%) read pairs available; of these: 8653012 (49.16%) trimmed read pairs available after processing 8947944 (50.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 9 0.00% 21 5 0.00% 22 14 0.00% 23 13 0.00% 24 7 0.00% 25 6 0.00% 26 14 0.00% 27 11 0.00% 28 14 0.00% 29 16 0.00% 30 13 0.00% 31 16 0.00% 32 16 0.00% 33 16 0.00% 34 29 0.00% 35 30 0.00% 36 23 0.00% 37 37 0.00% 38 47 0.00% 39 63 0.00% 40 59 0.00% 41 77 0.00% 42 75 0.00% 43 93 0.00% 44 102 0.00% 45 127 0.00% 46 158 0.00% 47 141 0.00% 48 208 0.00% 49 219 0.00% 50 252 0.00% 51 311 0.00% 52 306 0.00% 53 312 0.00% 54 286 0.00% 55 367 0.00% 56 388 0.00% 57 474 0.00% 58 505 0.00% 59 576 0.00% 60 677 0.00% 61 789 0.00% 62 837 0.00% 63 918 0.01% 64 1044 0.01% 65 1245 0.01% 66 1384 0.01% 67 1788 0.01% 68 2314 0.01% 69 3945 0.02% 70 3762 0.02% 71 2577 0.01% 72 2617 0.01% 73 2793 0.02% 74 3008 0.02% 75 3233 0.02% 76 3624 0.02% 77 3840 0.02% 78 4277 0.02% 79 4628 0.03% 80 5097 0.03% 81 5742 0.03% 82 6887 0.04% 83 7200 0.04% 84 9219 0.05% 85 10682 0.06% 86 11126 0.06% 87 11894 0.07% 88 12446 0.07% 89 12877 0.07% 90 13661 0.08% 91 14621 0.08% 92 15540 0.09% 93 16383 0.09% 94 17370 0.10% 95 18192 0.10% 96 19088 0.11% 97 19841 0.11% 98 20520 0.12% 99 21465 0.12% 100 22483 0.13% 101 23828 0.14% 102 24616 0.14% 103 25982 0.15% 104 26927 0.15% 105 28061 0.16% 106 29104 0.17% 107 30021 0.17% 108 31377 0.18% 109 32465 0.18% 110 33750 0.19% 111 34811 0.20% 112 35979 0.20% 113 37192 0.21% 114 38229 0.22% 115 39600 0.22% 116 40628 0.23% 117 41669 0.24% 118 42988 0.24% 119 44169 0.25% 120 45572 0.26% 121 47072 0.27% 122 48322 0.27% 123 50350 0.29% 124 51851 0.29% 125 53038 0.30% 126 54260 0.31% 127 56610 0.32% 128 57910 0.33% 129 60004 0.34% 130 62007 0.35% 131 64314 0.37% 132 66502 0.38% 133 69767 0.40% 134 72881 0.41% 135 76220 0.43% 136 78982 0.45% 137 83840 0.48% 138 87743 0.50% 139 92957 0.53% 140 99145 0.56% 141 106467 0.60% 142 115912 0.66% 143 129324 0.73% 144 146560 0.83% 145 170366 0.97% 146 207644 1.18% 147 275788 1.57% 148 403758 2.29% 149 768900 4.37% 150 3960468 22.50% 151 8947944 50.84% 17600956 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=14 prefix-density=0.46 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=379.73 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=17.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCT criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=23 prefix-density=0.56 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=84.07 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.3 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA SRR7230821 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:45:13 Started mapping on | Feb 11 10:45:14 Finished on | Feb 11 10:47:04 Mapping speed, Million of reads per hour | 576.03 Number of input reads | 17600956 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16346437 Uniquely mapped reads % | 92.87% Average mapped length | 291.35 Number of splices: Total | 15755083 Number of splices: Annotated (sjdb) | 15410474 Number of splices: GT/AG | 15457128 Number of splices: GC/AG | 244585 Number of splices: AT/AC | 8613 Number of splices: Non-canonical | 44757 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 449165 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 52790 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.18% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 839199 839199 839199 N_multimapping 449165 449165 449165 N_noFeature 642541 16046717 763526 N_ambiguous 291041 1111 111602 UnstrandedReadsAssigned:15412855 PositiveStrandReadsAssigned:298609 NegativeStrandReadsAssigned:15471309 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7230821 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230821-trimmed-pair1.fastq SRR7230821-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,600,956 reads, 15,448,875 reads pseudoaligned [quant] estimated average fragment length: 244.139 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 988 rounds 52401 SRR7230821.ke.tsv 34699 SRR7230821.se.tsv 87100 total ==> SRR7230821.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.86 570 18.7095 Potri.005G024800.1.v4.1 1035 791.861 169 12.4334 Potri.004G059700.1.v4.1 961 717.972 11 0.89256 Potri.007G009000.2.v4.1 1416 1172.86 0 0 Potri.003G141000.2.v4.1 2943 2699.86 1030 22.2253 Potri.016G087400.1.v4.1 270 87.7551 690 458.067 Potri.015G069301.1.v4.1 564 329.343 0 0 Potri.010G195200.1.v4.1 1773 1529.86 75 2.85602 Potri.012G127500.1.v4.1 977 733.925 160 12.7005 ==> SRR7230821.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1034 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 304 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 131 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 3 SRR7230821 completed mapping pipeline successfully